Selection for Loss of RpoS in Cronobacter sakazakii by Growth in the Presence of Acetate as a Carbon Source

Abstract

We demonstrate that growth of Cronobacter sakazakii in the presence of acetate as a carbon source promotes loss of RpoS, with a consequent reduction in stress tolerance. This suggests that C. sakazakii is capable of regulating cell fitness through mutation of the rpoS gene.

TEXT

Cronobacter sakazakii is considered an emerging opportunistic pathogen associated with sporadic cases of life-threatening illness in infants, including meningitis, necrotizing enterocolitis, and bacteremia, with mortality rates in cases of neonatal meningitis as high as 40 to 80%. In addition, recent reports have highlighted the risks posed to immunocompromised adults, particularly the elderly, linked to symptoms of pneumonia, sepsis, foot ulcers, wound infections, osteomyelitis, and splenic abscesses (1–3).

Several studies have recently focused on the tolerance of C. sakazakii to environmental stress conditions and food processing technologies, and a high degree of heterogeneity among strains has been reported (4–9). We recently linked variability in C. sakazakii stress tolerance to polymorphisms in rpoS among natural isolates of C. sakazakii (9), indicating the important role played by the alternative sigma factor RpoS in the response of C. sakazakii to a wide range of stresses. In particular, we observed significant heterogeneity in RpoS activity, albeit indirectly predicted, which correlated with stress tolerance. In addition, sequence analyses of the rpoS genes were performed, and loss-of-function mutations were found for two C. sakazakii strains sensitive to multiple stresses. After complementation of these strains with a functional rpoS gene, an increase in bacterial tolerance to a range of stresses was observed.

Maintenance of a defective RpoS protein may appear paradoxical, as it is likely to affect bacterial survival under stressful environments. However, studies performed with Escherichia coli have shown that rpoS polymorphisms influence the trade-off between self-preservation and nutritional competence (SPANC), conferring to the cell selective advantages under certain conditions (10). Thus, E. coli rpoS mutant strains have been shown to be better equipped to use novel and alternative carbon sources for their growth (11), and rpoS mutants of increased fitness have been shown to occur by natural selection in E. coli cultures maintained under carbon starvation (12) or in the presence of nonpreferred carbon sources, such as succinate (13, 14). In the case of C. sakazakii, we have previously found that rpoS mutants show increased growth abilities in the presence of acetate as the sole carbon source (9). Here we report that C. sakazakii growth in a minimal medium supplemented with acetate can select for loss of RpoS, with a consequent reduction in stress tolerance.

Thirteen C. sakazakii strains were included in the study, i.e., C. sakazakii NCTC08155, ATCC 12868, ATCC 29004, DSM4485, NCTC11467, DPC 6522, DPC 6524, DPC 6525, DPC 6526, DPC 6527, DPC 6528, DPC 6529, and DPC 6530. All these reference strains and field isolates were gently provided by the Dairy Products Research Centre (DPC), Fermoy, County Cork, Ireland. The rpoS sequences of all these strains were previously described in a recent study by our research group, and polymorphisms were found in 10 nucleotides of the open reading frame (9). Whereas some of these polymorphisms did not change the amino acid composition of the RpoS protein, amino acid substitutions were observed at positions 562 to 564 (glutamine/lysine) and 802 to 804 (proline/alanine). Nevertheless, none of the 13 strains showed nonsense mutations (9). After resuscitation in LB broth, bacteria were plated on LB agar plates, which were incubated at 37°C for 24 h. From the stock LB agar plates, isolated colonies of each strain were selected and used to streak in parallel eight LB agar plates and eight M9 (minimal medium; Fluka) agar plates supplemented with 0.4% acetate (sodium salt) as a carbon source, which were then incubated at 37°C for 48 h. Afterwards, a continued-selection protocol based on the serial propagation of isolated colonies from the 16 selection lines on LB agar (8 selection lines) or M9-acetate agar plates (8 selection lines) was followed. For this, every 48 h, single colonies were used to streak fresh LB or M9-acetate agar plates, respectively, which were again incubated at 37°C for 48 h. The total duration of the selection protocol was 18 days. In a final step, single colonies were isolated from all the selection lines and streaked onto LB agar plates. Following incubation at 25°C for 72 h, colonies were checked for pigmentation and catalase activity, as described elsewhere (9). Variants with a loss of the characteristic yellow pigmentation and lacking catalase activity, interpreted as signs of loss of RpoS activity (9), were observed after propagation on M9-acetate agar in 10 selection lines corresponding to four of the strains, namely, C. sakazakii DPC 6522, DPC 6525, DPC 6526, and DPC 6530 (Table 1; Fig. 1A and B). Broth-based assays demonstrated that the colorless variants grew faster than their corresponding wild-type isolates in M9 broth supplemented with 0.4% acetate, as determined spectrophotometrically by using a temperature-controlled automatic plate reader (Multiscan FC; Thermo Scientific) (Fig. 1C). In contrast, bacterial propagation on LB agar plates did not give rise to any variant.

Table 1.

Loss-of-function mutations in the rpoS gene of colorless variants obtained through propagation in M9-acetate agar

Variant	C. sakazakii strain	Nonsense mutation
1	DPC 6522	Deletion of 137 bp (from base 144 to base 280 of the rpoS open reading frame)
2	DPC 6522	Insertion of 6 bp (GAAGAA) at position 220 of the rpoS open reading frame
3	DPC 6525	Insertion of a thymine at position 721 of the rpoS open reading frame
4	DPC 6525	Insertion of an adenine at position 762 of the rpoS open reading frame
5	DPC 6525	Insertion of 2 bp (GG) at position 376 of the rpoS open reading frame
6	DPC 6525	Deletion of 9 bp (from base 927 to base 936 of the rpoS open reading frame)
7	DPC 6525	Deletion of 8 bp (from base 795 to base 803 of the rpoS open reading frame)
8	DPC 6526	Insertion of a thymine at position 353 of the rpoS open reading frame
9	DPC 6530	Insertion of a guanine at position 556 of the rpoS open reading frame
10	DPC 6530	Insertion of 773 bp (at position 264 of the rpoS open reading frame)a

^aThe inserted sequence showed homology to the IS1 transposase of members of the Enterobacteriaceae family.

Fig 1.

Pigmentation status of wild-type C. sakazakii DPC 6525 and one of its colorless variants (variant 3). (A) Catalase activities of C. sakazakii DPC 6525 (▲) and one of its colorless variants (variant 3) (●). Cells in the mid-exponential phase of growth were pelleted by centrifugation, washed once in phosphate-buffered saline (PBS), and resuspended in PBS containing 40 mM H₂O₂. The decrease in the absorbance at 240 nm is positively correlated to the catalase activity of the strain. Results are expressed as the evolution over time of the ratio between the OD₂₄₀ at time t (OD_240nm-t) and the OD₂₄₀ at time zero (OD_240nm-0) (averages ± standard deviations). (B) Growth curves of C. sakazakii DPC 6525 (▲) and one of its colorless variants (variant 3) (●) in M9 broth supplemented with 0.4% acetate (averages ± standard deviations).

The rpoS genes of the 10 colorless variants were amplified and sequenced using the primers RPOS-1 (TGATTACCTGAGTGCCTACG) and RPOS-2 (TGAACTTCATGAGGGAGAGC), as previously described (9). Nonsense mutations were observed in the rpoS open reading frame for all the colorless variants (GenBank accession numbers KC476353 to KC476366) (Table 1). These included deletions (8 nucleotides in variant 7, 9 nucleotides in variant 6, 137 nucleotides in variant 1), single-base insertions resulting in the introduction of stop codons (variants 3, 4, 8, 9), and multiple-base insertions (variants 2, 5, 10). Of particular interest was the case of variant 10, a C. sakazakii DPC 6530 colorless variant with 773 nucleotides inserted at position 264 of the rpoS reading frame, since additional analyses demonstrated that the inserted sequence showed homology to the IS1 transposase of other members of the Enterobacteriaceae family.

Under our experimental selection protocol, it was possible to obtain rpoS mutants for only 4 of the 13 C. sakazakii strains tested, i.e., DPC 6522, DPC 6525, DPC 6526, and DPC 6530. Five of the 10 variants derived from a single strain, namely, C. sakazakii DPC 6525. This strain, together with C. sakazakii DPC 6522 and C. sakazakii DPC6530, belonged to the group of strains which showed the poorest ability to grow in the presence of acetate as the carbon source (9). For such strains, the adaptive advantage granted by the loss of RpoS would be greater, which would result in the higher mutation rate observed. No links were found between the rpoS sequence of the wild-type strains and the facility to obtain acetate-derived mutants. Other hypotheses, such as differences among strains in the efficacies of their DNA repair systems or the presence of some unknown mutation(s) that may force the occurrence of rpoS mutations through growth in the presence of acetate, should not be ruled out.

In order to confirm the physiological consequences of the loss of RpoS, one of the colorless variants (variant 3) was complemented with a functional rpoS gene amplified from wild-type C. sakazakii DPC 6525 using primers RPOS-3 (CTAGCCATGGATCAGAATACGCTGAAA) and RPOS-4 (GTCATCTAGAGTGATTATTCGCGGAACA). The PCR product was purified, digested with NcoI and XbaI, and ligated to similarly digested plasmid pNZ44 (15). Electrocompetent C. sakazakii cells were transformed by electroporation, and transformants were selected on LB agar plates supplemented with 10 μg/ml chloramphenicol at 37°C. As expected, the complementation of the variant strain with a functional rpoS gene restored the yellow pigmentation and catalase activity (data not shown). The abilities of the wild-type strain, the colorless variant, and the complemented variant to cope with stressful acidic (pH 2.5), alkaline (pH 11.0), osmotic (8 days of dehydration), oxidative (30 mM H₂O₂), and hot (60°C) environments were subsequently assessed as previously described (9). Experimental results were compared by performing the Student t test for independent samples with the Windows 7.0 program Statistica. Except with heat stress, the colorless variant strain was significantly more sensitive (P < 0.01) to the array of stresses imposed than the wild-type C. sakazakii strain (Fig. 2A). Moreover, when the variant strain was complemented with a functional rpoS gene, an increase in stress tolerance was observed, and the log cycles of inactivation found after acidic, alkaline, osmotic, oxidative, and heat stress exposures were similar to those observed for the wild-type strain (Fig. 2A). Complementation with the empty vector did not influence the phenotype. The growth of the three C. sakazakii strains under several sublethal stress conditions was also tested. For these experiments, overnight cultures were inoculated into LB broth containing various concentrations of HCl, NaOH, H₂O₂, and NaCl in 96-well culture plates (inoculation level of 1%). Cell growth at 37°C or 45°C was measured spectrophotometrically by determining the optical density at 600 nm (OD₆₀₀), and the time to detection (TTD), chosen as the time (h) at which the culture reaches an OD₆₀₀ of 0.2, was determined for each strain under the different conditions tested (9). Whereas the three C. sakazakii strains showed similar behaviors under sublethal acid and heat stress conditions, a statistically significant delay in growth was observed for the colorless variant strain when exposed to sublethal alkaline (P < 0.05), osmotic (P < 0.05), and oxidative (P < 0.01) stresses (Fig. 2B). When the variant strain was complemented with a functional rpoS gene, the phenotype observed was again similar to that of the wild-type strain, with the exception of that observed with osmotic exposures (Fig. 2B). The results of the stress tolerance experiments are in agreement with those reports highlighting the role played by the alternative sigma factor RpoS in the general stress response of Gram-negative microorganisms (16, 17).

Fig 2.

(A) Reduction in cell numbers (log CFU/ml) for C. sakazakii DPC 6525 (black), its colorless variant, i.e., variant 3 (gray), the variant 3 strain complemented with pNZ44 (striped), and the variant 3 strain complemented with a functional rpoS gene (white) after different lethal treatments. Values are averages ± standard deviations. Shown are the results of acid stress (60-min treatment in LB broth adjusted to pH 2.5 using HCl), alkaline stress (60-min treatment in LB broth adjusted to pH 11.0 using NaOH), osmotic stress (dehydration for 8 days at room temperature), oxidative stress (60-min treatment in LB broth supplemented with 30 mM H₂O₂), and heat stress (5-min treatment in LB broth at 60°C). a, significantly different from the value for the wild-type C. sakazakii DPC 6525 strain (P < 0.05); b, significantly different from the value for the wild-type C. sakazakii DPC 6525 strain (P < 0.01). (B) Growth capacities (TTDs) of C. sakazakii DPC 6525 (black), colorless variant 3 (gray), the variant 3 strain complemented with pNZ44 (striped), and the variant 3 strain complemented with a functional rpoS gene (white) under different sublethal stress conditions. Values are averages ± standard deviations. Shown are the results of acid stress (LB broth adjusted to pH 4.2 using HCl), alkaline stress (LB broth adjusted to pH 10.0 using NaOH), osmotic stress (LB broth supplemented with 8% NaCl), oxidative stress (LB broth supplemented with 2 mM H₂O₂), and heat stress (LB broth at 45°C). a, significantly different from the value for the wild-type C. sakazakii DPC 6525 strain (P < 0.05); b, significantly different from the value for the wild-type C. sakazakii DPC 6525 strain (P < 0.01).

In conclusion, this study describes a metabolic selection mechanism for loss of RpoS in C. sakazakii, based on growth on acetate, which may be responsible for the occurrence of rpoS mutations among natural C. sakazakii isolates. Taking into account the fact that selection for loss of RpoS has previously been achieved in E. coli by using other carbon sources, such as succinate, or by maintaining cultures under carbon starvation (12, 13, 14), it is likely that C. sakazakii rpoS mutants may also arise under experimental conditions different from those here described. Therefore, research on other carbon sources would be warranted. Our findings suggest that cell fitness may be achieved through modulation of RpoS. Thus, while activation of RpoS protects the cell against stress conditions, growth on poor carbon sources can promote loss of RpoS, which may result in better growth abilities by means of enhanced metabolic capabilities. rpoS mutations may confer an adaptive advantage on C. sakazakii during nutrient-limited growth in the natural environment or within the host during infection. Future research assessing the virulence properties of C. sakazakii rpoS mutants is needed to clarify this issue.