Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Mar 11.
Published in final edited form as: Tumour Biol. 2012 Jan 12;33(2):363–372. doi: 10.1007/s13277-011-0302-2

DNA methylation biomarker candidates for early detection of colon cancer

Joo Mi Yi 1,✉, Mashaal Dhir 2, Angela A Guzzetta 3, Christine A Iacobuzio-Donahue 4, Kyu Heo 5, Kwang Mo Yang 6, Hiromu Suzuki 7, Minoru Toyota 8, Hwan-Mook Kim 9,✉, Nita Ahuja 10,✉
PMCID: PMC3593674  NIHMSID: NIHMS439637  PMID: 22238052

Abstract

Promoter CpG island hypermethylation of tumor suppressor genes is a common hallmark of all human cancers. Many researchers have been looking for potential epigenetic therapeutic targets in cancer using gene expression profiling with DNA microarray approaches. Our recent genome-wide platform of CpG island hypermethylation and gene expression in colorectal cancer (CRC) cell lines revealed that FBN2 and TCERG1L gene silencing is associated with DNA hypermethylation of a CpG island in the promoter region. In this study, promoter DNA hypermethylation of FBN2 and TCERG1L in CRC occurs as an early and cancer-specific event in colorectal cancer. Both genes showed high frequency of methylation in colon cancer cell lines (>80% for both of genes), adenomas (77% for FBN2, 90% for TCERG1L, n=39), and carcinomas (86% for FBN2, 99% for TCERG1L, n=124). Bisulfite sequencing confirmed cancer-specific methylation of FBN2 and TCERG1L of promoters in colon cancer cell line and cancers but not in normal colon. Methylation of FBN2 and TCERG1L is accompanied by downregulation in cell lines and in primary tumors as described in the Oncomine™ website. Together, our results suggest that gene silencing of FBN2 and TCERG1L is associated with promoter DNA hypermethylation in CRC tumors and may be excellent biomarkers for the early detection of CRC.

Keywords: DNA hypermethylation, Biomarker, Early detection, Colorectal Cancer (CRC), FBN2, TCERGIL

Introduction

Colorectal cancer (CRC) remains the second leading cause of cancer-related mortality in the USA [1]. Current screening modalities have resulted in only a modest decrease in mortality and have failed to achieve high public participation (<50%) [2, 3]. Strategies such as colonoscopy are invasive, whereas stool occult blood tests are of limited use because of the need for repeated measurements and interference by dietary components. The use of biomarkers, specifically epigenetic biomarkers, in serum, plasma, and stool are promising to close that gap between invasive but dependable tests and noninvasive but unreliable studies.

The past few years have seen an explosion of interest in the epigenetics of cancer. Epigenetic alterations have been widely recognized to play an important role in the development of cancer. Aberrant hypermethylation in the promoter regions of the tumor suppressor genes at CpG islands has been recognized as one of the hallmarks of cancer [4]. This hypermethylation of gene promoters is associated with downregulation of expression and the inactivation of critical tumor suppressor genes in human cancers [5]. Methylation of multiple genes in colorectal (CRC) cancer has been described including hMLH1, p16INK4A, APC, MGMT, ,sFRP1, GATA-4and GATA-5 [4, 6, 7]. More recently, DNA hypermethylation of TFPI2 and SOX17 genes have been detected in early stage of CRC patients [8].

We previously described a genome-wide expression array-based approach to identify the “DNA hypermethylome” in colon cancer estimated to contain about 500 hypermethylated genes per individual tumor [9]. Using this platform, we have identified a number of genes that are hypermethylated and underexpressed in colon cancers but not in normal tissues [9]. Furthermore, DNA methylation changes in cancer represent an attractive therapeutic target since epigenetic alterations are more readily reversible than genetic events [10]. However, the great strength of DNA methylation in the clinic promises to be in the area of molecular diagnostics and early detection.

Fibrillin 2 (FBN2), is an extracellular matrix protein. It is associated with elastic fibers in several tissues and is believed to serve as a ligand for alphavbeta3 integrin, the latter being a known morphogen. FBN2 was first discovered to be expressed in the mesenchymal tissues and at the epitheliomesenchymal interface. It has also been demonstrated that the FBN2 antisense oligodeoxynucleotide can induce dysmorphogenesis of the lung explants, suggesting that FBN2 plays a key role in lung development [11]. Recently, the loss of FBN2 expression due to promoter methylation was identified in pancreatic cancer cell lines by means of high-throughput microarray analysis [12].

Transcription elongation regulator 1-like (TCERG1L) gene located in chromosome 10, emerged as showing frequent cancer-specific methylation in our microarray-based approaches [9]. TCERG1L gene may have similar biological role with TCERG1 (transcription elongation regulator 1), located on human chromosome 5q32. TCERG1 (also known as TAF2S; TATA box-binding protein-associated factor 2S, CA150; transcription factor CA150) was first described as a transcriptional elongation regulator found in human immunodeficiency virus type 1 (HIV-1), tat-responsive HeLa nuclear fractions [13]. TCERG1L may have a function in the elongation-related factors in HeLa nuclear extracts [14] even though little else is known so far. Prior to this study, TCERG1L has not been described as being involved in cancer.

Here, we investigated promoter DNA methylation of FBN2 and TCERG1L genes in CRC cell lines and primary tumors. We present data indicating that FBN2 and TCERG1L genes are hypermethylated in most of CRC cell lines and primary tumors in a cancer-specific manner. Additionally, we demonstrate that methylation of FBN2 and TCERG1L occurs in precancerous colon polyps suggesting that methylation of both of these genes is an early event in CRC. We suggest that FBN2 and TCERG1L methylation could be a useful biomarker for noninvasive detection of precancerous and cancerous colon and rectal tumors.

Materials and methods

Cell culture and treatment

Colorectal cell lines (HCT116, RKO, HT29, SW480, DLD1, COLO 320,SW48, Lovo, Caco-2, andSW620) were obtained from ATCC (Manassas, VA, USA) and cultured in appropriate medium and under conditions described by ATCC, with media obtained from Invitrogen (Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (Gemini Bio-Products, West Sacramento, CA, USA) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). DKO cells (HCT116 cells with genetic disruption of DNMT1 and DNMT3b) were cultured as previously described [15]. For demethylation studies, cultured cells were treated with 1 µM 5-aza-2′-deoxycytidine (DAC; Sigma, St. Louis, MO, USA) for 72 h with media changed every 24 h. Trichostatin A (TSA; Sigma, St. Louis, MO, USA) was obtained from Sigma and used to treat cells at concentration of 300 nM for 18 h. Mock drug treatments were performed in parallel with drug-free PBS.

Primer design

For expression studies using RT-PCR, we designed primers using the open access program Primer3 (http://frodo.wi.mit.edu/primer3). Primer sequences for methylation-specific polymerase chain reaction (MSP) and bisulfite sequencing analysis were designed using MSPPrimer (http://www.mspprimer.org) and their location in the FBN2 and TCERG1L promoter is indicated in Fig. 3. All primer sequences are listed on Table 1.

Fig. 3.

Fig. 3

Fig. 3

Representative Bisulfite sequencing results of FBN2 (a) and TCERG1L (b) in HCT116, DKO, a primary CRC (CRC20), and normal colon (NC10). Open and filled circles represent unmethylated and methylated CpG sites, respectively, and each row represents a single clone. Location of CpG sites (FBN2: upstream region from - 475 to −64; TCERG1L: upstream region from −556 to −275) relative to the transcription start sites (TIS) of Exon 1 is shown Fig. 3. Both genes bisulfate sequencing region include MSP analysis amplicons

Table 1.

Primers for MSP, RT-PCR, and bisulfite sequencing analysis

Gene S (5′–3′) AS(5′–3′)
FBN2 Meth GGGTTTTTAAAATTTTCGCGTCGC CTACGAAACCGAACGAAAATACG
Unmeth GTTTTGTTGGGTTTTTAAAATTTTTGTGTTGTG AAATAACAACTACAAAACCAAACAAAAATACA
RT AGGGATCCTTCATTTGCCAC GCCCGGGGTATTTACACACT
BST CTTCCAACCCYACCTTC GTTTTTAGAAGAAGAGGAGGG
TCERG1L Meth GGTCGTTTGCGTCGGATTC CTACCCAACGCGAAACTAAAAACG
Unmeth TTTGGGGTTGTTTGTGTTGGATTTG CATATCCCACTACCCAACACAAAACTAAAAACA
RT TGCTCTTGCAACCCCTATTG TGAGGTGCTAACACCACCGT
BST AATTTGTTTGGTTTATTTGTGTAATAGAAAT CTAATAACCTCTAACCCTCTAA

Gene expression and methylation analyses

For MSP analysis, DNA was extracted following a standard phenol–chloroform extraction method. Bisulfite modification of genomic DNA was carried out using the EZ DNA Methylation Kit (Zymo Research, Orange, CA, USA). We performed methylation analysis of the FBN2 and TCERG1L promoter using MSP primer pairs covering the putative transcriptional start site in the 5′ CpG island with 1 µl of bisulfite-treated DNA as template and JumpStart Red Taq DNA Polymerase (Sigma, St. Louis, MO, USA) for amplification as previously described [16].

Quantitative RT-PCR

Total RNA was extracted from all cell lines using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA), and was treated using the DNaseI protocol (QIAGEN, Valencia, CA, USA). One microgram total RNA was subjected to the Superscript II first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer’s instructions. For quantitative real-time analyses, the iQ™ SYBR Green Supermix kit (Bio-Rad) was used and the amplification conditions consisted of an initial 10-min denaturation step at 95°C, followed by 40 cycles of denaturation at 95°C for 15 s and annealing and extension for 30 and 60 s, respectively. A Bio-Rad CFX384 real-time PCR System was used (Bio-Rad) and we used the comparative Ct method to compute relative expression values. We averaged expression of GAPDH as internal reference genes to normalized input cDNA. Also, we used normal colon and DKO cells (HCT116 cells with genetic disruption of DNMT1 and DNMT3b) cDNA samples as positive controls for FBN2 and TCERG1L gene expression.

Bisulfite sequencing analysis

One microgram of genomic DNA from each sample was bisulfite converted using the EZ DNA Methylation Kit (Zymo Research, Orange, CA, USA) following manufacturer’s protocol. MSP primer sequences are provided in Table 1. The PCR amplicons were gel-purified and subcloned into pCRII-TOPO vector (Invitrogen, Carlsbad, CA, USA). At least ten clones were randomly selected and sequenced on an ABI3730xl DNA analyzer to ascertain the methylation patterns of each locus.

Primary human tissue samples

Primary tissue samples were obtained from the archives of the Department of Pathology, Johns Hopkins University with Institutional Review Board approval and Health Insurance Portability and Accountability Act compliance. We compiled data from 124 formalin-fixed and paraffin-embedded primary CRCs of tumor stages I to IV (stage I— n=33, stage II—n=37, stage III—n=36, stage IV—n=18; mean age, 65.2 years). We also examined 39 colorectal adenomas from patients without an associated invasive CRC (tubular—n=17, villous—n=22). We compared these samples to 20 normal colon controls of patients without any colorectal neoplasm (Table 2).

Table 2.

Baseline characteristics of CRC patients in this study

Characteristics N (%)
CRC (n=124)
Age (years)
  Median 65.2
Sex
  Male 68 (55%)
  Female 56 (45%)
Race
  White 84 (68%)
  Black 33 (27%)
  Asian   2 (1%)
  Other   5 (4%)
Grade
  Well-differentiated 39 (31%)
  Moderately differentiated 63 (51%)
  Poorly differentiated 22 (18%)
Location
  Right 71 (58%)
  Left 51 (41%)
  Right and left   2 (1%)
Stage
  I 33 (27%)
  II 37 (30%)
  III 36 (29%)
  IV 18 (14%)
Adenomas (n=39)
  Tubular 17 (44%)
  Villous 22 (56%)
Normal colon (n=20) 20

Results

Correlation between DNA promoter methylation and gene silencing of FBN2 and TCERG1L in colon cancer cell lines

We previously developed an expression microarray technique to characterize the spectrum of hypermethylated genes in cancers [9]. Based on our previous study, some of the cancer-specific methylated genes detected in early stage of colon cancer could also function as diagnostic and prognostic biomarkers [8, 9]. FBN2 and TCERG1L genes were identified in our hypermethylome approach and both have a dense CpG island in the promoter region upstream from the transcriptional start site (Fig. 3). To query these genes for methylation, we designed primers in promoter region of each gene for methylation-specific PCR (MSP) assays. Having confirmed our MSP primers and their monitoring of methylation density, we then tested both primers in ten different colon cancer cell lines (Fig. 1). We found complete methylation of FBN2 promoter region in all ten colon cancer cell lines (100%, 10/10) (cell lines; HCT116, SW480, RKO, HT29, Caco-2, Lovo, COLO 320, COLO 205, DLD1, SW48, and SW620) (Fig. 1a). TCERG1L also showed complete methylation (80%, 8/10) in the majority of colon cancer cell lines except for Colo320 and Lovo (Fig. 1b). To ensure that methylation in these samples was associated with downregulation of gene expression, we then tested the expression of FBN2 and TCERG1L using RT-PCR in a same panel of CRC cell lines with/without DAC and TSA treatment. Quantitative real-time PCR results confirmed re-expression of FBN2 and TCERG1L genes after treatment with DAC, a demethylating agent, in most of CRC cell lines. Furthermore, we detected little or no expression of FBN2 and TCERG1L in ten CRC lines, but all of these lines showed significantly increased expression of FBN2 and TCERG1L following DAC treatment (Fig. 1a,b). In the case of TCERG1L, even though it has basal expression in Lovo cells, its expression level increased after DAC treatment compared to basal expression. Interestingly, expression levels by RT-PCR of these two genes are not increased after treatment with TSA, a histone deacetylase inhibitor. Therefore, inactivation of FBN2 and TCERG1L gene appears to be primarily regulated by promoter DNA hypermethylation in colon cancers.

Fig. 1.

Fig. 1

Epigenetic inactivation of FBN2 and TCERG1L in colon cancer cell lines. Methylation analysis of (a) FBN2 and (b) TCERG1L gene promoter (Upper panel) and real-time RT-PCR results for (c) FBN2 and (d) TCERG1L gene in colon cancer cell lines after DAC and TSA treatment with mock in each cell lines. GAPDH was used as control for equal amplification. PCR products recognize unmethylated (U) and methylated (M). DKO cells [15] were used for unmethylated control. IVD = in-vitro methylated control, ddH2O=water control containing no DNA. M, A, and T indicate mock, DAC treated cells, Trichostatin A (TSA) treated cells, respectively

Aberrant hypermethylation of the FBN2 and TCERG1L gene in primary CRC tumors

Next, we expanded this study in a large cohort of CRC patient samples. One hundred twenty-four CRC samples (stages I–IV), 39 adenomas, and 20 normal patient samples were examined. Neither gene displayed methylation in normal colon samples (Fig. 2a). FBN2 was found to be methylated in 90% (30/33) of stage I, 83% (31/37) of stage II, 91% (33/36) of stage III, and 72% (13/18) of stage IV colon cancers. TCERG1L was found to be methylated in 100% (33/33) of stage 1, 100% (37/37) of stage II, 97% (35/36) of stage 3, and 100% (18/18) of stage 4, CRC samples (Fig. 2b). This data indicates that FBN2 and TCERG1L gene methylation is cancer-specific. Moreover, we tested FBN2 and TCERG1L promoter methylation in tubular and villous adenomas which are considered precancerous. Interestingly, FBN2 methylation was observed in 71% of tubular adenomas (12 of 17), and 82% of villous adenomas (18 of 22). TCERG1L methylation was observed in 88% of tubular adenomas (15 of 17), and 91% of villous adenomas (20 of 22). This data strongly suggest that FBN2 and TCERG1L hypermethylation occur as very early event during the progression of primary CRC. Therefore, detecting of DNA methylation for FBN2 and TCERG1L genes could be useful as early detection biomarker in CRC.

Fig. 2.

Fig. 2

Epigenetic inactivation of FBN2 and TCERG1L in colon primary tissues versus normal colon tissues. (a) normal colon tissues (b) primary CRC tissues. M = methylation signal; U = unmethylated signal. IVD = in vitro methylated DNA. ddH2O=water control adding no DNA. Numbers represent normal colon (NA1-20). NC indicates normal colon. Bar graph showing MSP results of all primary samples (stage I-IV: n=124) and adenomas (tubular adenoma (TA), villous adenoma (VA), n=39)

We also confirmed DNA methylation status of FBN2 and TCERG1L genes in a representative colon cancer cell line (HCT116) and primary CRC tumor sample by bisulfite sequencing analysis. Bisulfite sequencing of FBN2 and TCERG1L gene promoter region showed dense DNA methylation in the colon cancer cell line HCT116 and CRC tumor sample and no methylation was detected in DKO cells and normal colonic tissues (Fig. 3). This data further supports our premise that FBN2 and TCERG1L are methylated in a cancer-specific fashion in CRC.

FBN2 and TCERG1L gene expression is downregulated in CRC

Aberrant DNA hypermethylation has been well known to be associated with gene silencing in cancer. We observed FBN2 and TCERG1L gene DNA hypermethylation is correlated with decreased gene expression and reactivated by DAC compare to basal expression level in colon cancer cell lines (Fig. 1a, b), suggesting that both of gene expression in colon cancer cell lines where methylation tightly correlated with lack of expression. However, since we have seen DNA hypermethylation of both genes in most of colon primary tissues, we wonder if these expression levels are correlated with DNA methylation status in colon primary tumors. Therefore, we utilized the gene expression microarray data previously published on Oncomine™ (Compendia Bioscience, Ann Arbor, MI, USA). The Oncomine™ database is a web-based data-mining platform aimed at facilitating gene discovery from genome-wide expression analyses in cancer [17]. We therefore queried the expression of FBN2 and TCERG1L in colon primary tumors from several studies (Table 3). Very interestingly, we found that that both genes are significantly downregulated in six independent colon primary tumor datasets [18–21]. This information, in combination with our cell lines data, strongly suggests that FBN2 and TCERG1L are methylated and downregulated in a cancer-specific fashion in CRC.

Table 3.

FBN2 and TCERG1L gene expression changes in colon tumor samples from ONCOMINE database

Colon cancer Sample no. Median log2 ratioa
References
TCERG1L FBN2
Adenomas
  Colon villous adenoma 17 −1.862 −1.078 Not published since 2005 (Bittner Group)
Carcinoma
  Colon adenocarcinoma 41 −1.41 −1.142 Kaiser et al. [18]
  Colon mucinous adenocarcinoma 13 −1.454 −1.184 Kaiser et al. [18]
  Colon adenocarcinoma 137 −0.698 −0.51 Jorissen et al. [19]
  Colorectal adenocarcinoma 177 −1.465 −1.229 Smith et al. [20]
  Colon adenocarcinoma 239 −1.121 −0.808 Not published since 2005 (Bittner Group)
  Colon mucinous adenocarcinoma 42 −1.623 −0.794 Not published since 2005(Bittner Group)
  Colorectal carcinoma 84 −1.459 −1.598 Watanabe et al. [21]
a

log2 median-centered intensity which is array-based gene expression log-fold changes. Oncomine threshold by p value (<0.0001), fold change (>2)

Discussion

Genome-wide approaches have contributed to our understanding of the molecular pathways driving tumorigenesis as well as providing useful new biomarkers for cancer risk assessment, early diagnosis, and prognosis [22]. Previous studies have confirmed that our microarray strategy is an effective approach to identify genes that are silenced by promoter hypermethylation in colon and breast cancer [9, 23, 24]. DNA methylation of gene promoters is among the earliest and most frequent oncologic alterations. A number of genes are commonly hypermethylated in CRC, however, genes methylated in early-stage tissues with high frequency are rare [9, 24, 25]. Previously, we have reported aberrant methylation of TFPI2 and SOX17 in CRC using our established array-based platform [26]. TFPI2 gene promoter methylation has been identified in early stage of colon cancer and is highly sensitive in stool samples making it an excellent choice for noninvasive surveillance for CRC [8].

We have now discovered two additional genes which show cancer-specific methylation which are detected with high frequency in early stages of colorectal cancer formation. FBN2 and TCERG1L are genes harboring cancer-specific promoter methylation in human colorectal cancer. Promoter DNA hypermethylation of FBN2 and TCERG1L in CRC (86% for FBN2, 99% for TCERG1L, n=124, respectively) are frequent and cancer-specific events. Hypermethylation of FBN2 has also been reported in pancreatic [12] and lung cancers [27–29], yet has not been described in CRC. TCERG1L has not previously been described in cancer. To our knowledge, this is the first description of FBN2 and TCERG1L promoter methylation occurring as an early event in colon cancer progression.

Methylation biomarkers for the detection of an oncologic process requires that the DNA be obtained in a noninvasive fashion, either through blood, stool, or mucous. TFPI2 has been shown to be sensitive and specific in stool samples. Plasma and serum biomarkers have also been shown to have relatively high specificity in CRC [30–32]. Therefore, testing our genes in stool, plasma, or serum, samples is necessary to confirm whether either gene could be useful biomarker for early detection in cancer in the near future. Additionally, other excellent early detection biomarkers have already been published by us and others [8, 33]. Any future study would need to test FBN2 and TCERG1L in combination with TFPI2 in colon cancer. It has been well known that methylation of CpG islands in gene promoter regions is associated with aberrant silencing of transcription and is a mechanism for inactivation of tumor suppressor genes (p16, APC, Rb) from many other studies [4, 25]. Recently, newly identified hypermethylated genes in cancer by genome-wide microarray approach showed its biological roles such as tumor-suppressive effect in cancer cells [8, 34]. Therefore, it could have a possibility that FBN2 and TCERG1L might have tumor-suppressive effect in colon cancer but further study is need to define the functions of FBN2 and TCERG1L in colon tumorigenesis.

In conclusion, FBN2 and TCERG1L gene methylation is an early and frequent event in precancerous and cancerous lesions of the colon and rectum. Furthermore, this methylation is cancer-specific and was not detected in any normal colon samples. Finally, the methylation of FBN2 and TCERG1L is associated with a phenotypic underexpression these gene products. These three factors warrant further examination of FBN2 and TCERG1L in noninvasive studies for the early detection of colorectal cancer. We have reported for the first time that FBN2 and TCERG1L promoter methylation is a feasible epigenetic marker for early detection of CRC and may be useful for CRC screening in the future.

Acknowledgments

The study is supported by the National R&D program (50595 and 50596) through the Dongnam Institute of Radiological & Medical Sciences (DIRAMS) funded by the Korean Ministry of Education, Science and Technology. This study is also supported by NIH/NCI K23CA127141, American College of Surgeons/Society of University Surgeons Career Development Award and the Jeannik M. Littlefield-AACR grant in metastatic colon cancer research. We thank the Johns Hopkins Cancer Registry for the assistance with the primary cancer databases.

Footnotes

Conflicts of interest None

Contributor Information

Joo Mi Yi, Research Center, Dongnam Institute of Radiological & Medical Sciences (DIRAMS), Busan, South Korea, jmlee76@gmail.com.

Mashaal Dhir, Department of Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA.

Angela A. Guzzetta, Department of Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA

Christine A. Iacobuzio-Donahue, Department of Pathology, The Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA

Kyu Heo, Research Center, Dongnam Institute of Radiological & Medical Sciences (DIRAMS), Busan, South Korea.

Kwang Mo Yang, Research Center, Dongnam Institute of Radiological & Medical Sciences (DIRAMS), Busan, South Korea.

Hiromu Suzuki, Department of Molecular Biology, Sapporo Medical University, Sapporo, Japan.

Minoru Toyota, Department of Molecular Biology, Sapporo Medical University, Sapporo, Japan.

Hwan-Mook Kim, Department of Pharmacy, College of Pharmacy, Gacheon University of Medicine and Science, Incheon, South Korea, hwanmook@gachon.ac.kr.

Nita Ahuja, Department of Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA nahuja@jhmi.edu.

References

  • 1.Jemal ASR, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics. CA Cancer J Clin. 2009;59:225–249. doi: 10.3322/caac.20006. [DOI] [PubMed] [Google Scholar]
  • 2.Heresbach DMS, D'halluin PN, Bretagne JF, Branger B. Review in depth and meta-analysis of controlled trials on colorectal cancer screening by faecal occult blood test. Eur J Gastroenterol Hepatol. 2006;18:427–433. doi: 10.1097/00042737-200604000-00018. [DOI] [PubMed] [Google Scholar]
  • 3.Meissner HI, Breen N, Klabunde CN, Vernon SW. Patterns of colorectal cancer screening uptake among men and women in the United States. Cancer Epidemiol Biomarkers & Prevention. 2006;15:389–394. doi: 10.1158/1055-9965.EPI-05-0678. [DOI] [PubMed] [Google Scholar]
  • 4.Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med. 2003;349:2042–2054. doi: 10.1056/NEJMra023075. [DOI] [PubMed] [Google Scholar]
  • 5.Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128:683–692. doi: 10.1016/j.cell.2007.01.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Suzuki H, Watkins DN, Jair KW, Schuebel KE, Markowitz SD, Dong Chen W, et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet. 2004;36:417–422. doi: 10.1038/ng1330. [DOI] [PubMed] [Google Scholar]
  • 7.Akiyama Y, Watkins N, Suzuki H, Jair KW, van Engeland M, Esteller M, et al. Gata-4 and gata-5 transcription factor genes and potential downstream antitumor target genes are epigenetically silenced in colorectal and gastric cancer. Mol Cell Biol. 2003;23:8429–8439. doi: 10.1128/MCB.23.23.8429-8439.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Glockner SC, Dhir M, Yi JM, McGarvey KE, Van Neste L, Louwagie J, et al. Methylation of tfpi2 in stool DNA: a potential novel biomarker for the detection of colorectal cancer. Cancer Res. 2009;69:4691–4699. doi: 10.1158/0008-5472.CAN-08-0142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Schuebel KE, Chen W, Cope L, Glöckner SC, Suzuki H, Yi JM, et al. Comparing the DNA hypermethylome with gene mutations in human colorectal cancer. PLoS Genetics. 2007;3:1709–1723. doi: 10.1371/journal.pgen.0030157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Karpf ARJD. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Oncogene. 2002;21:5496–5503. doi: 10.1038/ng1330. [DOI] [PubMed] [Google Scholar]
  • 11.Yang Q, Ota K, Tian Y, Kumar A, Wada J, Kashihara N, et al. Cloning of rat fibrillin-2 cDNA and its role in branching morphogenesis of embryonic lung. Dev Biol. 1999;212:229–242. doi: 10.1006/dbio.1999.9331. [DOI] [PubMed] [Google Scholar]
  • 12.Hagihara A, Miyamoto K, Furuta J, Hiraoka N, Wakazono K, Seki S, et al. Identification of 27 5′ CpG islands aberrantly methylated and 13 genes silenced in human pancreatic cancers. Oncogene. 2004;23:8705–8710. doi: 10.1038/sj.onc.1207783. [DOI] [PubMed] [Google Scholar]
  • 13.Sune C, Hayashi T, Liu Y, Lane WS, Young RA, Garcia-Blanco MA. Ca150, a nuclear protein associated with the RNA polymerase ii holoenzyme, is involved in Tat-activated human immunodeficiency virus type 1 transcription. Mol Cell Biol. 1997;17:6029–6039. doi: 10.1128/mcb.17.10.6029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sanchez-Alvarez M, Goldstrohm AC, Garcia-Blanco MA, Sune C. Human transcription elongation factor ca150 localizes to splicing factor-rich nuclear speckles and assembles transcription and splicing components into complexes through its amino and carboxyl regions. Mol Cell Biol. 2006;26:4998–5014. doi: 10.1128/MCB.01991-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rhee I, Bachman KE, Park BH, Jair KW, Yen RW, Schuebel KE, et al. DNMT1 and DNMT3B cooperate to silence genes in human cancer cells. Nature. 2002;416:552–556. doi: 10.1038/416552a. [DOI] [PubMed] [Google Scholar]
  • 16.Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A. 1996;93:9821–9826. doi: 10.1073/pnas.93.18.9821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rhodes DRYJ, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, et al. Oncomine: a cancer microarray database and integrated data-mining platform. Neoplasia. 2004;6:1–6. doi: 10.1016/s1476-5586(04)80047-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kaiser SPY, Franklin JL, Halberg RB, Yu M, Jessen WJ, Freudenberg J, et al. Transcriptional recapitulation and subversion of embryonic colon development by mouse colon tumor models and human colon cancer. Genome Biol. 2007;8:R131. doi: 10.1186/gb-2007-8-7-r131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Jorissen RN, Gibbs P, Christie M, Prakash S, Lipton L, Desai J, et al. Metastasis-associated gene expression changes predict poor outcomes in patients with dukes stage b and c colorectal cancer. Clin Cancer Res. 2009;15:7642–7651. doi: 10.1158/1078-0432.CCR-09-1431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Smith JJ, Deane NG, Wu F, Merchant NB, Zhang B, Jiang A, et al. Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer. Gastroenterology. 2010;138:958–968. doi: 10.1053/j.gastro.2009.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Watanabe T, Kobunai T, Toda E, Yamamoto Y, Kanazawa T, Kazama Y, et al. Distal colorectal cancers with microsatellite instability (MSI) display distinct gene expression profiles that are different from proximal MSI cancers. Cancer Res. 2006;66:9804–9808. doi: 10.1158/0008-5472.CAN-06-1163. [DOI] [PubMed] [Google Scholar]
  • 22.Egger G, Liang G, Aparicio A, Jones PA. Epigenetics in human disease and prospects for epigenetic therapy. Nature. 2004;429:457–463. doi: 10.1038/nature02625. [DOI] [PubMed] [Google Scholar]
  • 23.Chan TAGS, Yi JM, Chen W, Van Neste L, Cope L, Herman JG, et al. Convergence of mutation and epigenetic alterations identifies common genes in cancer that predict for poor prognosis. PLoS Med. 2008;5:0823–0838. doi: 10.1371/journal.pmed.0050114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yi JM, Dhir M, Van Neste L, Downing SR, Jeschke J, Glockner SC, et al. Genomic and epigenomic integration identifies a prognostic signature in colon cancer. Clin Cancer Res. 2011;17:1535–1545. doi: 10.1158/1078-0432.CCR-10-2509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Esteller M. Epigenetic gene silencing in cancer: the DNA hypermethylome. Hum Mol Genet. 2007;16:R50–R59. doi: 10.1093/hmg/ddm018. [DOI] [PubMed] [Google Scholar]
  • 26.Zhang W, Glockner SC, Guo M, Machida EO, Wang DH, Easwaran H, et al. Epigenetic inactivation of the canonical Wnt antagonist SRY-box containing gene 17 in colorectal cancer. Cancer Research. 2008;68:2764–2772. doi: 10.1158/0008-5472.CAN-07-6349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tsunoda SSE, De Young NJ, Wang X, Tian ZQ, Liu JF, Jamieson GG, et al. Methylation of CLDN6, FBN2, RBP1, RBP4, TFPI2, and TMEFF2 in esophageal squamous cell carcinoma. Oncological Report. 2009;21:1067–1073. doi: 10.3892/or_00000325. [DOI] [PubMed] [Google Scholar]
  • 28.Cortese R, Hartmann O, Berlin K, Eckhardt F. Correlative gene expression and DNA methylation profiling in lung development nominate new biomarkers in lung cancer. Int J Biochem Cell Biol. 2008;40:1494–1508. doi: 10.1016/j.biocel.2007.11.018. [DOI] [PubMed] [Google Scholar]
  • 29.Chen H, Suzuki M, Nakamura Y, Ohira M, Ando S, Iida T, et al. Aberrant methylation of FBN2 in human non-small cell lung cancer. Lung Cancer. 2005;50:43–49. doi: 10.1016/j.lungcan.2005.04.013. [DOI] [PubMed] [Google Scholar]
  • 30.Laird PW. The power and the promise of DNA methylation markers. Nat Rev Cancer. 2003;3:253–266. doi: 10.1038/nrc1045. [DOI] [PubMed] [Google Scholar]
  • 31.Lofton-Day C, Model F, DeVos T, Tetzner R, Distler J, Schuster M, et al. DNA methylation biomarkers for blood-based colorectal cancer screening. Clin Chem. 2008;54:414–423. doi: 10.1373/clinchem.2007.095992. [DOI] [PubMed] [Google Scholar]
  • 32.Kim MSLJ, Sidransky D. DNA methylation markers in colorectal cancer. Cancer Metastasis Review. 2010;29:181–206. doi: 10.1007/s10555-010-9207-6. [DOI] [PubMed] [Google Scholar]
  • 33.Melotte VLM, van den Bosch SM, Hellebrekers DM, de Hoon JP, Wouters KA, Daenen KL, et al. N-Myc downstream-regulated gene 4 (NDGR4): a candidate tumor suppressor gene and potential biomarker for colorectal cancer. J Natl Canc Inst. 2009;101:916–927. doi: 10.1093/jnci/djp131. [DOI] [PubMed] [Google Scholar]
  • 34.Melotte V, Lentjes MHFM, van den Bosch SM, Hellebrekers DMEI, de Hoon JPJ, Wouters KAD, et al. N-Myc downstreamregulated gene 4 (NDRG4): a candidate tumor suppressor gene and potential biomarker for colorectal cancer. J National Cancer Institute. 2009;101:916–927. doi: 10.1093/jnci/djp131. [DOI] [PubMed] [Google Scholar]

RESOURCES