Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Mar 15.
Published in final edited form as: J Immunol. 2013 Feb 13;190(6):2575–2584. doi: 10.4049/jimmunol.1201920

Cancer-produced metabolites of 5-lipoxygenase induce tumor-evoked Bregs via peroxisome proliferator-activated receptor alpha

Katarzyna Wejksza *,*, Catalina Lee-Chang *,*, Monica Bodogai *, Jessica Bonzo #, Frank J Gonzalez #, Elin Lehrmann $, Kevin Becker $, Arya Biragyn *,1
PMCID: PMC3594535  NIHMSID: NIHMS435204  PMID: 23408836

Abstract

Breast cancer cells facilitate distant metastasis through the induction of immunosuppressive regulatory B cells, designated tBregs. We report here that, to do this, breast cancer cells produce metabolites of the 5-lipoxygenase (5-LO) pathway such as leukotriene B4 (LTB4) to activate the proliferator-activated receptor alpha (PPARα) in B cells. Inactivation of LTB4 signaling or genetic deficiency of PPARα in B cells blocks the generation of tBregs and thereby abrogates lung metastasis in mice with established breast cancer. Thus, in addition to eliciting fatty acid oxidation and metabolic signals, PPARα initiates programs required for differentiation of tBregs. We propose that PPARα in B cells or/and tumor 5-LO pathways represents new targets for pharmacological control of tBreg –mediated cancer escape.

Keywords: tBreg induction, metastasis, PPARα, leukotriene

INTRODUCTION

Arachadonic acid (AA) metabolism generates a wide variety of bioactive eicosanoids, such as prostanoids and leukotrienes, produced as a result of the two alternative pathways induced by cyclooxygenases (COX) and lipoxygenases (LO), respectively. They are often associated with inflammatory pathologies and cancers (1). In particular, activity of COX-2 is linked with the induction of survival, proliferation and differentiation of cancer cells and modulation of cancer escape (1–3). Similarly, various cancer cells (pancreatic, prostate, breast and lung cancer cells) also express 5-LO to induce cell survival and proliferation (4–7). Although the 5-LO metabolites are potent inducers of allergic inflammation (8), their role in cancer immune escape is unknown. Activation of 5-LO by association with the 5-LO activating protein (FLAP) induces biosynthesis of biologically active metabolites by catalyzing AA into 5-hydroxyperoxyeicosatetraenoic acid to subsequently generate 5-hydroxyeicosatetraenoic acid (5-HETE) and instable LTA4. The later is converted into either LTB4 or cysteinyl LTs (LTC4, LTD4 and LTE4) (9). The 5-LO pathway metabolites, in particular LTB4, induce and amplify local inflammation by controlling peroxisome proliferator activator-receptor alpha (PPARα) (10, 11). PPARα is an important transcription factor that mediates lipid homeostasis by inducing genes involved in fatty acid transport and β-oxidation. It also influences glucose and amino acid metabolism and inflammation (12). PPARα is usually active in tissues that require fatty acid oxidation as a source of energy (13). However, its long-term activation induces liver cancer in mice and rats (14) presumably by up regulating myc expression in hepatocytes (15).

Cancer metastasis is a reflection of the loss of immunological controls and poor disease outcome. It involves an active participation of regulatory immune cells (16–18) hijacked by cancers in order to promote escape from immunosurveillance (19). As a result, a poor disease outcome of human and murine cancers is often associated with infiltration/presence of regulatory T cells, specifically CCR4+ Tregs (20, 21). We recently reported that CCR4+ Tregs play an essential role in lung metastasis of 4T1 breast cancer cells growing in the mammary glands of BALB/C mice (22). They inactivated antitumor NK cells by producing β-galactoside binding protein, and thereby functioned as protectors of metastasizing cancer cells. Thus, inactivation of CCR4+ Tregs alone was sufficient to abrogate lung metastasis of 4T1 cells (22). To our surprise, this process also involved an active participation of non-metastatic 4T1 cancer cells that induced the generation of a unique type of regulatory B cells (tBregs) (23). The role of tBregs was to convert non-regulatory CD4+ T cells into the metastasis-supporting FoxP3+ Tregs utilizing TGFβ (23). Although non-metastatic cancer cells induced the generation of tBregs using secreted factors, our attempts to link them with known cytokines and protein-based suppressive factors failed. Thus, the mechanism of this process remains unknown. Here, we report that non-metastatic cancer cells express and utilize metabolites of the 5-LO pathway to induce tBreg generation. The inactivation of this pathway in non-metastatic cells using pharmacological inhibitors or shRNA-induced knockdown of FLAP, completely blocked tBreg generation. Confirming the activity of eicosanoids, PPARα was not only highly expressed in tBregs compared to resting B cells, but also its blockage in B cells by genetic or pharmacologic means almost completely abrogated the generation of tBregs. The tBreg generation involved, at least in part, LTB4 acting through its receptors BLT1 and BLT2. Thus, non-metastatic cancer cells utilize metabolites of the 5-LO/FLAP/leukotriene pathway to induce the generation of tBregs thereby promoting cancer escape and metastasis. As such, inactivation of any step of this pathway can also inhibit metastasis by reversing cancer-induced immunological impairments. Indeed, lung metastasis and tumor progression was significantly reduced in tumor-bearing mice treated with MK886, a 5-LO/FLAP inhibitor (24) and pharmacological antagonist of PPARα (25).

MATERIALS AND METHODS

Reagents, cells and mice

The majority of reagents were described in our recent report (22) and were purchased from Sigma (St. Louis, MO), unless specified otherwise. MK886, CAY10416, Zileuton, Ibuprofen, and inhibitors for BLT1 (U75302) and BLT2 (LY2552833) were from Cayman Chemicals. Monoclonal anti-mouse antibodies (Ab) such as CD19-PerCP, CD81-PE, CD25-PacBl, B7H1-PE, CD4-PE, Tim1-PE, CD3-APC, BAFFR-Alexa Fluor647 were from Biolegend; FoxP3-APC was from eBiosciences and Fc blocker (anti-CD16/32) was from BD Biosciences. To stimulate B cells with IL4 and αIgM Ab, splenic naïve B cells were isolated and cultured with 20 ng/ml recombinant mouse IL4 (Peprotech) and 10 μg/ml F(ab′)2 fragment goat anti-mouse IgM (Jackson ImmunoResearch) for 48h. Female BALB/C, C57Bl/6 mice and μMT mice with mature B cell deficiency (B6.129P2-Igh-Jtm1Cgn/J) were from the Jackson Laboratory (Bar Harbor, ME). Female 129S4/SvJae WT and PPARα KO mice were described earlier (26). 4T1 cells (CRL-2539) and B16F10 melanoma cells were purchased from the American Type Culture Collection. 4T1.2 cells, a subset of 4T1 cells, were a gift from Dr. Robin L. Anderson (Peter McCallum Cancer Center, Australia). Non-metastatic 4T1-PE and 4T1.2-PE cells were generated from 4T1 and 4T1.2 cells, respectively, by using TARC-PE38 chemotoxin (22).

Microarray and RT-PCR and qRT-PCR

Total RNA was isolated using RNeasy kit (Qiagen), according to the manufacturer’s instructions. cDNA was obtained using iScript cDNA Synthesis kit (Biorad). Microarray analysis was performed using the Illumina platform and data were deposited at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43278. The following primers were used for semi-quantitative RT-PCR: GAPDH: 5′-TGTGGAAGGGCTCATGACCACAGTCCAT-3′ and 5′-GCCTGCTTCACCACCTTCTTGATG-3′, FLAP (5′ TGAAGCAAGCATGGATCAAG 3′, 5′ AAGTGGGGTACGCATCTACG), 5-LO (5′ CTACGATGTCACCGTGGATG 3′, 5′ GTGCTGCTTGAGGATGTGAA 3′), LTC4 (5′ GCTCTTCTGGCTACCGTCAC 3′, 5′ CAGGTAGAACAGTCCGCACA 3′), LTA4H (5′ GTGGCGAGGAACACAGCGGAAAGTA 3′, 5′ CGATGGCCTGGCACTGACTGAAGA 3′), primers for PPARα were described elsewhere (27). Real time PCR for PPARα was performed using primers reported by Bernal-Mizrachi et al. (27) with the Maxima® SYBR Green/ROX qPCR Master Mix (Fermentas) using the Applied Biosystems 7500 PCR system. Relative expression levels of RNA transcripts to 18S RNA were quantified by the delta Ct method.

shRNA-mediated knockdown of FLAP

Lentiviral particles were generated by transfecting HEK293T/17 cells with pLKO.1 shRNA FLAP/Alox5ap plasmid (NM_009663.1-614s1c1 clone Sigma) and MISSION Lentiviral Packaging Mix (Sigma ) using lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Supernatant was harvested 48h posttransfection and used to infect 4T1-PE cells. Stable clones were selected by puromycin treatment (10μg/ml) for several weeks. FLAP/Alox5ap knock-down was verified by RT-PCR. Control 4T1-PE clones were transduced with lentivirus containing empty pLKO.1 plasmid.

In vitro tBreg and Treg generation and T cell suppression assays were performed following our previously described methods (22, 23). In brief, tBregs were generated from murine splenic B cells (>95% purity, isolated by negative selection using the RoboSep system, StemCell Technologies, Vancouver, Canada) by incubating for two days in 50% conditioned medium of 4T1-PE cells (CM-PE) in cRPMI (RPMI 1640 with 10% heat-inactivated fetal bovine serum, 10 mM HEPES-Sodium Pyruvate, 1 mM sodium pyruvate, 0.01% 2-Mercaptoethanol, 2mM L-glutamine, 100U/ml penicillin and 100 μg/ml streptomycin, all from Invitrogen) at a 37°C in humidified atmosphere with 5% CO2. Control B cells were treated with 100 ng/ml of recombinant mouse BAFF (R&D) in cRPMI. To assess the importance of 5-LO/leukotriene and prostaglandin pathways in 4T1-PE cell-mediated tBreg induction, 4T1-PE CM were generated in the presence of CAY10416 (5μM), or MK886 (10μM), or zileuton (50μM), or ibuprofen (10μM), or vehicle (DMSO). To assess in vivo-generated tBregs in tumor-bearing mice, B cells were magnetically isolated from lymph nodes of tumor-bearing or naïve mice using anti-CD19-FITC Ab (Biolegend) and anti-FITC MicroBeads (Miltenyi Biotec). To collect CM from pretreated cells, 4T1-PE cells were first treated with CAY10416 (5 μM), Zileuton (50 μM), ibuprofen (10 μM) or DMSO for 3 days (“unwashed” CM was collected and stored at −80°C). The cells then were washed 3 times with PBS and cultured for three more days in cRPMI at 2×106 cells/flask density before collecting CM (“washed” CM). CM from washed and unwashed cells were tested for tBreg generation. The role of 5-LO/FLAP/Leukotriene in the generation of tBregs was assessed using CAY10416, MK886, zileuton, ibuprofen, U75302, LY2552833, or vehicle (DMSO) at the indicated concentrations. A direct role of inhibitors on tBregs was tested by adding them at the start of tBreg generation. However, the inhibitors were removed prior to T cell suppression assay by washing the B cells with PBS. To test the suppressive activity of B cells, splenic CD3+ T cells were isolated using mouse T-cell enrichment columns (R&D Systems) and labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen) before incubating with B cells at a 1:1 ratio for 5 days in the presence of 1.5–3μg/ml of anti-mouse CD3 Ab (BD Biosciences). Decrease in CFSE expression of T cells correlates with the proportion of cells that underwent divisions. To test the ability of tBregs to generate Tregs, non-Treg CD25-CD4+ T cells were obtained by i) isolating CD3+ T cells (mouse T-cell enrichment columns, R&D Systems), ii) positively depleting CD25+ cells (Dynabeads, Invitrogen) and iii) negatively isolating CD4+ T cells (Mouse CD4+ T-cell isolation kit II, Miltenyi Biotec) Non-Tregs were mixed with B cells at a 1:1 ratio and cultured for 5 days in the presence of bead-conjugated anti-CD3/CD28 Abs (Invitrogen) and 500 U/ml IL-2. Immunoreactive LTB4 was quantified by LTB4 EIA ELISA kit (Cayman Chemicals) in tumor CM and sera of mice following manufacturers instructions.

In vivo manipulations

Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 86-23, 1985). The experiments were performed using 4–8 weeks old female mice in a pathogen-free environment at the National Institute on Aging Animal Facility, Baltimore, MD. BALB/C mice were s.c. challenged into the fourth mammary gland with 5 × 104 4T1 cells and euthanized between day 26 and 30 to assess tumor weight and lung metastasis. The lungs were analyzed for metastasis by ex vivo injecting India ink through the trachea, which was destained in Fekete’s solution to count tumor nodules. For short in vivo studies, BALB/C mice received s.c 5×106 4T1 cells and were culled 10 days after. C57BL/6 or μMT mice were s.c. challenged with 1 × 105 B16F10 melanoma cells and tumor progression was measured every other day. After 16–20 days, B16F10 melanoma challenged mice were euthanized to assess tumor weight. To assess the effect of systemic administration of MK886, 4T1-tumor bearing BALB/C mice received i.p MK886 (20 μg/mouse) or mock control (DMSO) at day 3, 5, 7, 10, 12 and 15 post tumor challenge. To evaluate the importance of 5-LO/FLAP in tBregs in vivo, 4T1 tumor-bearing BALB/C mice were i.p. injected with MK886 (20μg/mouse) or mock control (DMSO) at days 3, 5, 7, 10 and 12. Then at day 14, mice were randomized into 4 mice per group and i.v. injected with tBregs (5×106) pretreated with MK886 or mock with DMSO, or BAFF –treated B cells (5×106). Alternatively, μMT mice with B16F10 melanoma were i.v. injected with tBregs (5×106) from PPARα KO mice or WT C57BL/6 mice pretreated with MK886 or mock with DMSO one day before and 5 days after tumor challenge. To assess in vivo tBregs and Tregs, B cells and T cells were isolated from spleens and inguinal and axillary lymph nodes at indicated days of treatment and post tumor challenge. To demonstrate tumor-specific effector T cells (intracellular IFNγ expressing CD8+ cells), splenocytes were ex vivo stimulated with 5μg/ml melanoma-specific gp10025–32 peptide in cRPMI with 20 ng/ml IL-2 for one week.

Statistical Analysis

The results from in vitro studies are presented as the mean of triplicates ± SEM of at least three independent experiments. All in vivo and ex vivo experiments were reproduced at least three times using 4–8 per group mice. Differences were tested using Student’s t test and Log-rank Mantel-Cox test. P-value less than 0.05 was considered statistically significant.

RESULTS

Non-metastatic cancer cells utilize metabolites of 5-LO/FLAP pathway to induce the generation of tBregs

We recently reported that non-metastatic 4T1-PE and 4T1.2-PE cell subsets (from now on collectively designated 4T1-PE cells (22)) induce the generation of unique type of regulatory B cells (tBregs) to facilitate escape and metastasis of their parental 4T1 and 4T1.2 cancer cells (23). As a result, the depletion of tBregs (23) or B-cell deficiency in Jh KO mice (due to a deletion in the J segment of the immunoglobulin heavy chain locus) significantly retard primary tumor progression and lung metastasis (Suppl. Fig. 1A, B). Although tBregs are Tim1+ (a recently defined marker for IL-10 and IL4-expressing CD5+ Bregs which promote tolerance in mice (28)), they appear to represent a unique Breg subset, as they differed in expression of other markers (23), such as were not CD1dHigh nor expressed IL-4 or CD5 (Suppl. Fig. 1C, D). We defined tBregs as phospho-Stat3+ CD81High CD25+ CD19+ B cells that suppress activity of T cells and convert FoxP3+ Tregs (23). However, the mechanism of tBreg conversion remains unknown, and commonly used B-cell stimulants, such as TLR ligands (23), IL-4 and anti-IgM did not affect their generation (Suppl. Fig. 1E, F).

To understand the generation of tBregs, we compared RNA expression profiles of tBreg-inducing 4T1-PE cells with their parental 4T1 cancer cells. 4T1-PE cells preferentially expressed genes involved in leukotriene synthesis, such as 5-LO, FLAP, LTA4 hydrolase and LTC4 synthase (Fig. 1A, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43278), suggesting that the metabolites of this pathway could be involved in the induction of tBregs. To study this possibility, we tested conditioned media (CM) from 4T1-PE cells that were grown in the presence of various pharmacological inhibitors of the 5-LO/FLAP pathway, such as zileuton (5-LO/FLAP inhibitor), CAY10416 (inactivates 5-LO and COX-2 pathways), MK886 (a 5-LO/FLAP inhibitor and pharmacological antagonist of PPARα). Control B cells stimulated with CM from DMSO (vehicle)-treated 4T1-PE cells were readily converted into CD25+CD81High tBregs (Fig. 1B) that efficiently suppressed proliferation of anti-CD3 Ab -stimulated T cells (Fig. 1C), as expected (23). This conversion was not affected if 4T1-PE cells were treated with a COX-2/prostaglandin inhibitor ibuprofen (29) (Fig. 1B, C), excluding the involvement of metabolites of this pathway. In contrast, the generation of tBregs (as shown by up regulation of tBreg-associated markers (Fig. 1B) and inhibition of T cell proliferation (Fig. 1C)) was almost completely lost if CM was from 4T1-PE cells treated with zileuton, MK886 (data not shown) and CAY10416. To further confirm these results, we also tested CM from the inhibitor-pretreated 4T1-PE cells that were washed and cultured for three more days without inhibitors. Pretreatment with zileuton or CAY10416, but not with ibuprofen, also abrogated the ability of 4T1-PE cells to generate tBregs (Suppl. Fig. 2A, B).

Figure 1.

Figure 1

Compared with their parental metastatic 4T1 and 4T1.2 cells, non-metastatic cancer 4T1-PE and 4T1.2-PE cells preferentially expressed genes of the 5-LO/leukotriene pathway, such as 5-LO, FLAP, LTA4 hydrolase (LTA4H) and LTC4 synthase (LTC4S), as shown by mRNA microarray analysis (right panel, A) and RT-PCR (left panel, A) of 3–4 independent samples. Expression of 5-LO/FLAP in 4T1-PE cells was required for tBreg generation, as B cells incubated with 50% CM from 4T1-PE cells treated with zileuton (Zil, 50 μM) or CAY10416 (CAY, 5 μM) did not up regulate tBreg-associated surface markers (B, CD81High CD25+) and suppress proliferation of anti-CD3 antibody -stimulated CD4+ T cells (C). In contrast, CM from ibuprofen (Ibu, 10 μM) or mock (DMSO) -treated cells readily generated tBregs (B, C). Similarly, 4T1-PE cells with shRNA-induced FLAP knocked down (sh FLAP) also did generate tBregs from B cells, as shown by the inability to up regulate CD81High CD25+ (D) and suppress T cell responses (E). Shown in D and E are the results of two independent 4T1-PE cell clones transduced with sh-FLAP (sh FLAP 1 and 2) and control shRNA (sh control 1 and 2). In C and E, B cells and CFSE-labeled T cells (responder) cells were cultured at a 1:1 ratio for four days in the presence of anti-CD3 Ab and 50 U/ml IL-2. Y-axis (% ± SEM of at least three independent triplicate experiments) is for CD81High CD25+ cells (within CD19+ cells, B and D) and non-proliferating CD4+ T cells (CFSE retained, C and E). A representative histogram of CFSE dilution in CD4+ T cells is depicted in C and E (left panel). From here on, *P<0.05; and tBregs designate B cells treated with CM of 4T1-PE cells.

Next, to prove that 4T1-PE cell-produced metabolites of 5-LO/FLAP pathway were responsible for tBreg induction, we created shRNA stable transfectant 4T1-PE cells deficient in FLAP (sh-FLAP KO), a key factor that controls activity of 5-LO and production of downstream metabolites (9). As expected, CM from several independently generated sh-FLAP KO cells failed to induce tBregs, i.e. the B cells did not up regulate CD25 and CD81 (Fig. 1D) and suppress proliferation of T cells (Fig. 1E). Control 4T1-PE cells transduced with a non-specific shRNA retained the tBreg inducing activity (Fig. 1D, E). Taken together, 4T1-PE cells induce the generation of tBregs by producing metabolites of the 5-LO/FLAP pathway.

tBreg-induction requires metabolites of LO/FLAP/leukotriene pathways

The 5-LO/FLAP pathway generates numerous bioactive metabolites, including leukotrienes. Indeed, we detected significantly elevated levels of LTB4 expressed from 4T1-PE cells (Fig. 2A) and in sera of 4T1 cancer-bearing mice (Fig. 2B). Importantly, treatment with CAY10416 or MK886 significantly reduced levels of LTB4 both in vitro and in vivo (Fig. 2A, B). In fact, MK886 treatment of tumor-bearing mice reduced LTB4 to the levels of naïve mice (Fig. 2B) and inhibited lung metastasis of 4T1 cells (see Fig. 5B), suggesting that LTB4 might be involved in induction of metastasis-promoting tBregs. To test this idea, naive B cells were stimulated with CM from 4T1-PE cells (CM-PE) in the presence/absence of selective inhibitors of BLT1 or BLT2, U75302 and LY2552833, respectively. The inhibitors at commonly used doses (>10μM U75302 and >100 μM LY2552833) were cytotoxic (Suppl. Fig. 2C), indicating the importance of LTB4 in the survival of B cells. However, suboptimal/non-cytotoxic doses (Suppl. Fig. 2C) of U75302 (<10 μM) or LY2552833 (<100μM) decreased up-regulation of CD25 and CD81 in B cells treated with CM-PE (Fig. 2C and data not shown). This was associated with the reduced ability of tBregs to suppress the proliferation of T cells (Fig. 2D, E). Conversely, treatment with LTB4 alone rendered B cells suppressive (Fig. 2E), albeit at low levels. Taken together, 4T1-PE cells induce survival and suppressive functions of tBregs utilizing metabolites of the 5-LO/FLAP/leukotriene pathway involving, at least in part, the LTB4 -BLT1/2 axis.

Figure 2.

Figure 2

(A) LTB4 expression in 4T1-PE cells is reduced by inactivating 5-LO/FLAP with MK886 (MK, 10 μM) and CAY10416 (CAY, 5 μM ), but not ibuprofen (Ibu, 10 μM). Shown are ELISA results in CM of 2e6 cells cultured for 72 hours. (B) Serum levels of LTB4 is enhanced in 4T1 tumor-bearing mice, which was reduced back to the levels of naïve mice by treatment with MK886 (20 μg/mouse). Control tumor-bearing mice were treated with DMSO (mock). Y-axis levels of LTB4 pg/ml ± SEM in sera of three per group mice measured using ELISA. (C–D) 4T1-PE cells induced the generation of tBregs, at least in part, utilizing LTB4, as B cells treated with CM-PE together with inhibitors of BLT1 and BLT2 (U75302 and LY2552833, respectively) had reduced capability to up regulate CD81High CD25+ (C) and suppress proliferation of T cells (D, E). Conversely, B cells treated with free LTB4 in cRPMI slightly (but significantly) were rendered suppressive (E). In E, B cells were treated with indicated amounts of LTB4 in cRPMI or U75302 in CM of 4T1-PE cells (CM) and tested for suppression or proliferation of T cells, respectively. Y-axis shows % T cell suppression or proliferation ± SEM of T cells stimulated with indicated B cells compared with control B cells (100% tBregs or naïve B cells, respectively). Shown are results of triplicate experiments reproduced twice (A, B, E) and three times (C and D).

Figure 5.

Figure 5

4T1 cancer progression and metastasis are reduced by in vivo inactivation of 5-LO/PPARα using MK886. BALB/C mice were i.p. treated with MK886 (20 μg/mouse) or DMSO every other day for 7 times starting from day 3 post s.c. challenge with 5×104 4T1 cells in mammary gland. Mice were sacrificed at day 28 to assess the weight of the primary tumor in the mammary gland (A) and count metastatic foci in the lungs (B), as we previously described (22). The survival benefit of MK886 treatment was tested in 8 mice per group experiment (C). Control mice were treated with DMSO (mock). The MK886 treatment reduces the proportion of tBregs in tumor-bearing mice to the levels of naïve mice (D). Antitumor activity of MK886 involves inactivation of tBregs (E–L). Tumor bearing BALB/C mice were treated with MK886 as in (A) to reduce tBregs, but until day 12. At day 14 post tumor challenge (when free MK886 is presumably cleared) the mice were randomized and either injected with PBS, or adoptively transferred with naive B cells, or tBregs ex vivo pretreated with DMSO or MK886 (E). Progression of primary tumor in mammary gland (E, mm2) was measured every other day. Metastatic foci in the lungs (F) and numbers of FoxP3+ (G) and IFNγ+ (H) CD4+ T cells and INFγ+CD8+ T cells (L) per 106 splenocytes were counted at day 28. Shown are mean ± SEM of a representative 4–5 mice per group experiment reproduced at least three times.

The importance of 5-LO/FLAP and PPARα in tBregs

LTB4 is an agonistic ligand of PPARα and an inducer of 5-LO/FLAP signaling (10, 11), suggesting that this pathway could also be involved in the induction of tBregs. To test this idea, naïve B cells were stimulated with CM-PE together with MK886 (a 5-LO/FLAP inhibitor and pharmacological antagonist of PPARα). The presence of MK886 significantly reduced the expression of almost every tBreg-associated marker, such as decreased expression of CD25, CD81, BAFFR and B7-H1 (Fig. 3A) and phosphorylation of Stat3 (Fig. 3B). Functionally, these cells also failed to suppress proliferation of T cells (Fig. 3C) and did not induce conversion of FoxP3+ CD4+ Tregs from non-Treg CD4+ T cells (Fig. 3D). Similar results were generated when we used other inhibitors of 5-LO/FLAP, such as CAY10416 and zileuton (data not shown and see Fig. 3B). In contrast, the generation of tBregs was not affected by ibuprofen, ruling out the involvement of the COX/prostaglandin pathway (data not shown). Thus, 4T1-PE cell-mediated tBreg generation requires at least in part the LTB4 -BLT1/2 axis, suggesting that it can also activate PPARα (10, 11). In support, we detected significantly increased amounts of PPARα mRNA in tBregs, while control B cells only expressed low background levels of it (Fig. 3E). To further prove the role of PPARα, we tried to generate tBregs from B cells of mice deficient in PPARα (PPARα KO). Compared with WT cells, PPARα KO B cells were poorly converted into tBregs after CM-PE pretreatment. For example, CM-PE inefficiently up-regulated tBreg-associated surface markers (CD25+/CD81High, Fig. 3F), and the treated PPARα KO B cells poorly suppressed proliferation of T cells (Fig. 3G). Importantly, the already poor responses of PPARα KO B cells were not affected by U75302 (Fig. 3F), while the inhibition of BLT1 abrogated the generation of tBregs from WT B cells (Fig. 3F and Fig. 2D–E). Thus, PPARα is required for the generation of tBregs, which is induced in response to metabolites of 5-LO/FLAP/leukotriene pathway produced by 4T1-PE cells, suggesting its inactivation should also inhibit cancer escape.

Figure 3.

Figure 3

B cells treated with CM-PE in the presence of MK886 (10 μM) cannot generate tBregs, as shown by decreased expression of CD81, CD25, BAFF-R, and B7-H1 (A) and down regulation of pStat3 (B, western blot hybridization of a total cell lysate); and by the inability to suppress T cell proliferation (C) and induce conversion of FoxP3+ Tregs from CD25-CD4+ T cells (D). A representative histogram and dot plot of CFSE diluted (C, left panel) and FoxP3 –expressing (D, upper panel) CD4+ T cells are shown. (E–G) The generation of tBregs requires PPARα, as it is expressed in tBregs (E, qRT-PCR data); and B cells from PPARα KO mice cannot efficiently generate tBregs, i.e. up regulate CD81 and CD25 (F) and suppress proliferation of T cells (G). Control B cells were treated with BAFF. Importantly, BLT1 inhibitor U75302 only inhibited tBreg generation from WT, but not PPARα KO, B cells (F). Data shown in F are repeated twice, while the rest ones are reproduced at least three times in triplicate experiments.

We tested this possibility using a different tumor model, B16-F10 melanoma in B-cell deficient μMT C57BL/6 mice, due to a current availability of congeneic PPARα KO mice. The μMT mice poorly support B16 melanoma growth unless they are adoptively transferred with ex vivo-generated tBregs from WT mice (p<0.05, Fig. 4A, B and Suppl. Fig. 3A), as we reported (23). However and importantly, this ability to restore B16 melanoma growth was almost completely lost if tBregs were from PPARα KO mice (Fig. 4A, B) or the mice were transferred with MK886-pretreated tBregs from WT C57BL/6 mice (Suppl. Fig. 3A). This loss was associated with the inability to enhance numbers and proportion of FoxP3+ Tregs (Fig. 4C and Suppl. Fig. 3C, D–F), a key function of tBregs (23). Importantly, unlike WT tBregs (which significantly enhanced numbers of FoxP3+ Tregs (Fig. 4C and Suppl. Fig. 3C, D–F) and, conversely, reduced IFNγ-producing CD8+ T cells recognizing melanoma-specific gp10025–32 peptide (Fig. 4D, E and Suppl. Fig. 3G)), the transfer of PPARα KO tBregs failed to suppress IFNγ+CD8+ T cells (Fig. 4D, E and Suppl. Fig. 3G). Taken together, considering the ability of Tregs to regulate CD8+ T cells (30, 31) and the importance of IFNγ+CD8+ T cells in control of B16 melanoma (32, 33), our data indicate that the cancer escape-promoting activity of tBregs is lost if PPARα is deficient in B cells.

Figure 4.

Figure 4

A poor progression of B16 melanoma in μMT mice (23) is reversed by adoptive transfer of WT, but not PPARα deficient, tBregs. μMT mice with s.c. challenged B16F10 melanoma cells (105 cells) were i.v. injected with tBregs (5×106) from PPARα KO or WT C57BL/6 mice one day before and 5 days after tumor challenge. Y-axis shows mean ± SEM of 4–5 mice per group experiment, such as tumor size (mm2, A) and weight (g, B), numbers of FoxP3+CD4+ T cells (C) and IFNγ+CD8+ T cells (D) per 106 splenocytes or IFNγ+CD8+ T cells per mm2 blood (E). IFNγ (intracellular staining) was assessed in CD8+ T cells after one week ex vivo expansion with melanoma-specific gp10025–32 peptide. The results were reproduced at least twice.

Pharmacological inhibitors of the 5-LO/FLAP/PPARα pathway can control cancer escape

Next, we tested whether cancer escape and metastasis can be controlled by blocking the 5-LO/FLAP/Leukotriene/PPARα axis in mice with established 4T1.2 cancer, as they were already used to alleviate human allergic and inflammatory responses (8, 34, 35). BALB/c mice with 4T1.2 cancer growing in the mammary gland were treated with MK886 (20 μg/mouse) at days 3, 5, 7, 10, 12 and 15 post tumor challenge. Compared to control vehicle-treated (DMSO) mice, MK886 treatment indeed reduced primary tumor growth in the mammary glad (Fig. 5A) and lung metastasis (Fig. 5B). Although it did not eradicate cancer, MK886 treatment substantially prolonged survival of tumor-bearing mice (p<0.05, Fig. 5C). The MK886 treatment reduced the presence of tBregs (CD25+/CD81High within CD19+ cells, Fig. 5D) as well as FoxP3+Tregs (suppl. Fig. 4A), indicating that it inhibited cancer escape, at least in part, by blocking tBregs.

To confirm this possibility, we performed a separate experiment where tumor-bearing BALB/c mice were briefly treated with MK886 every other day until day 12 to reduce an endogenous pool of tBregs. Then, at day 14 (when free MK886 presumably was cleared) the mice were randomized and adoptively transferred with syngeneic naïve B cells, or tBregs that were ex vivo pretreated with MK886 or DMSO (Fig. 5E). The transfer of naïve B cells only slightly (although non-significantly) augmented tumor growth in MK886-pretreated mice (Fig. 5E), presumably indicating in vivo conversion of tBregs (23). However, mice transferred with ex vivo-generated control tBregs (tBregs + DMSO) significantly increased 4T1.2 cancer progression (Fig. 5E) and lung metastasis (Fig. 5F and Suppl. Fig. 4B, C). In contrast, these effects were almost completely lost if tBregs were pre-treated with MK886 (p<0.05, tBregs+MK886 vs. tBregs+DMSO, Fig. 5E, F and Suppl. Fig. 4B, C). Thus, as in μMT mice with B16 melanoma (Suppl. Fig. 3A), MK886-mediated inhibition of tBregs is sufficient to abrogate 4T1.2 cancer escape by presumably disabling conversion of metastasis-promoting Tregs (22, 23) and suppression of effector CD8+ T cells. Indeed, as in 4T1.2 cancer-bearing mice (which enhanced both tBregs and Tregs, Fig. 5D and Suppl. Fig. 4A), adoptive transfer of control DMSO-treated tBregs Fig. 5E) also significantly increased numbers of FoxP3+Tregs in peripheral blood (Suppl. Fig. 4E) and the secondary lymphoid organs, such as spleen (Fig. 5G) and draining lymph nodes (Suppl. Fig. 4F). In contrast, no significant Treg expansion was detected if mice were transferred with MK886-pretreated tBregs (Fig. 5G and Suppl. Fig. 4E, F). These results were inversely associated with the presence of IFNγ-expressing CD4+ T cells (Fig. 5H) and importantly with the increased numbers of CD8+T cells (Fig. 5L and Suppl. Fig. 4D, G, H). Taken together, our data clearly indicate that the inactivation of the 5-LO/FLAP/leukotriene/PPARα pathways in tBregs, for example, using MK886 is sufficient to abrogate cancer escape and metastasis through the loss of Tregs and the release of effector CD8+ T cells.

DISCUSSION

AA metabolism plays an important role in inflammatory responses and cancers (1) (36). Its cancer escape-promoting functions are often linked to the generation of metabolites of the COX-2 pathway, although recent findings also indicate the importance of other eicosanoids (36). For example, metabolites of 15-lipoxygenase-2 pathway produced from tumor-associated macrophages induce expression of CCL2 and IL-10 and promote immunosuppression in the renal cancer microenvironment (37), while epoxyeicosatrienoic acids (AA metabolite of the cytochrome P450 epoxygenases) up regulate VEGF from tumors and endothelial cells facilitating metastasis and tumor escape from dormancy (38). Human cancer cell lines, such as pancreatic, prostate, breast and lung cancer cells, express high levels of 5-LO that are mostly thought to promote cell survival and proliferation (4–7). Here, we show that metastasis of murine 4T1 cancer cells is mostly supported by their non-metastatic subsets by producing 5-LO metabolites to generate metastasis-promoting tBregs. To the best of our knowledge, this is the first report that links cancer cell-produced 5-LO metabolites with the modulation of Bregs. We identified at least one metabolite of the pathway, LTB4 that, by acting via its BLT1/2 receptors, controlled the survival and suppressive functions of tBregs. However, a relatively weak (albeit significant) ability of free LTB4 to generate tBregs from naïve B cells may also indicate the involvement of other metabolites of the 5-LO/leukotriene pathway. Generation of tBregs appears to also require LTC4, as it was abrogated in B cells treated with montelukast, a specific inhibitor of the CysLT1 receptor (A. B., data not shown). On the other hand, B cells require oxidative stress to catabolize or generate LTB4 and biologically active 5-exo-ETE from 5-HETE, a relatively inert leukotriene precursor (39). Many cancers, including 4T1 cells (40, 41), express reactive oxygen species (ROS) and their inducer pro-inflammatory cytokines. They are used to promote cancer escape, for example, by ROS -mediated inactivation of CD3ζ and IL-2 receptor signaling in T cells (42, 43). Thus, CM of non-metastatic cancer 4T1-PE cells could modulate the activation state of B cells and responses to LTB4 and its derivatives by also utilizing ROS or ROS-inducing inflammatory cytokines and other factors. Compared with metastatic cancer cells, the non-metastatic 4T1-PE cells abundantly expressed ROS –inducing cytokines, such as IL1β and TNFα (data not shown and ref. (22, 44). Interestingly, the generation of tBregs also required the expression/activation of 5-LO/FLAP in B cells, as specific inhibitors of the pathway almost completely abrogated the process. Similar activation of 5-LO and expression of leukotriene metabolites (including LTB4) was reported in mantle zone B cells (45) and in B cells under oxidative stress (46, 47). Although the molecular mechanism of this is not known and is a focus of a different study, this raises an interesting possibility that tBregs activate the 5-LO pathway either to amplify stimulations from non-metastatic cancer cells, or/and to promote survival of cancer cells, for example, via production of various factors like VEGF (7).

Inflammatory responses induced by LTB4 and its derivatives also activate LTB4 catabolism in inflammatory cells at the site of inflammation (48), which involves PPARα inducing a negative feedback loop (10). As such, the prolonged duration of inflammation in PPARα deficient mice was associated with an inefficient clearance of free LTB4. However, the role of PPARα in modulation of regulatory immune responses is not known, although the PPARα deficiency can reduce numbers of Tregs by limiting the supply of IL2 during allergic contact dermatitis (49). In contrast, our data shown here suggest a direct role of PPARα in the generation of tBregs. In fact, PPARα is required for tBreg generation, as its genetic deficiency significantly abrogated the ability of B cells to become tBregs. Similarly, tBregs were not generated from WT B cells treated with MK886, a specific antagonist of PPARα (50). Thus, considering the importance of tBregs in suppression of T cell responses and induction of FoxP3+Tregs (23), a greater severity of inflammation (10) and lack of Tregs in PPARα KO mice with allergic contact dermatitis (49) may also be explained by impairments of tBregs or tBreg-like cells.

In summary, we show that activation of the 5-LO pathway in non-metastatic cancer cells plays an important immunoregulatory role. Utilizing its metabolites, such as LTB4, non-metastatic cancer cells induce the generation of tBregs in a PPARα-dependent manner. Although inhibitors of 5-LO were proposed for induction of apoptosis of 5-LO-dependent cancer cells (6, 7), our data suggest that the strategies that inactivate any step of the 5-LO/FLAP/leukotriene pathway will also block cancer escape and metastasis by inactivating tBregs. Indeed, by using MK886, which is known for its beneficial effects to alleviate allergic inflammation in humans (35), we could significantly reduce lung metastasis in mice with established breast cancer. Although MK886 also decreases serum levels of LTB4 in tumor-bearing mice and, as such, exerts beneficial effects in reducing the systemic inflammation necessary for metastasis (44, 51), our data shown in two different murine tumor models suggest that the inactivation of tBregs alone is sufficient to block tumor-mediated immunosuppression by freeing antitumor effector immune responses.

Supplementary Material

1
2

Acknowledgments

We are grateful to Ana Lustig (NIA/NIH) and Dr. Edward Goetzl (UCSF) for helpful comments and suggestions, and William H. Wood III for technical assistance with microarray study.

References

  • 1.Greene ER, Huang S, Serhan CN, Panigrahy D. Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat. 2011;96:27–36. doi: 10.1016/j.prostaglandins.2011.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sano H, Kawahito Y, Wilder RL, Hashiramoto A, Mukai S, Asai K, Kimura S, Kato H, Kondo M, Hla T. Expression of cyclooxygenase-1 and -2 in human colorectal cancer. Cancer research. 1995;55:3785–3789. [PubMed] [Google Scholar]
  • 3.Dannenberg AJ, Subbaramaiah K. Targeting cyclooxygenase-2 in human neoplasia: rationale and promise. Cancer Cell. 2003;4:431–436. doi: 10.1016/s1535-6108(03)00310-6. [DOI] [PubMed] [Google Scholar]
  • 4.Ding XZ, Iversen P, Cluck MW, Knezetic JA, Adrian TE. Lipoxygenase inhibitors abolish proliferation of human pancreatic cancer cells. Biochem Biophys Res Commun. 1999;261:218–223. doi: 10.1006/bbrc.1999.1012. [DOI] [PubMed] [Google Scholar]
  • 5.Ghosh J, Myers CE. Inhibition of arachidonate 5-lipoxygenase triggers massive apoptosis in human prostate cancer cells. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:13182–13187. doi: 10.1073/pnas.95.22.13182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Avis I, Hong SH, Martinez A, Moody T, Choi YH, Trepel J, Das R, Jett M, Mulshine JL. Five-lipoxygenase inhibitors can mediate apoptosis in human breast cancer cell lines through complex eicosanoid interactions. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2001;15:2007–2009. doi: 10.1096/fj.00-0866fje. [DOI] [PubMed] [Google Scholar]
  • 7.Romano M, Catalano A, Nutini M, D’Urbano E, Crescenzi C, Claria J, Libner R, Davi G, Procopio A. 5-lipoxygenase regulates malignant mesothelial cell survival: involvement of vascular endothelial growth factor. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2001;15:2326–2336. doi: 10.1096/fj.01-0150com. [DOI] [PubMed] [Google Scholar]
  • 8.Pergola C, Werz O. 5-Lipoxygenase inhibitors: a review of recent developments and patents. Expert Opin Ther Pat. 2010;20:355–375. doi: 10.1517/13543771003602012. [DOI] [PubMed] [Google Scholar]
  • 9.Sigal E. The molecular biology of mammalian arachidonic acid metabolism. The American journal of physiology. 1991;260:L13–28. doi: 10.1152/ajplung.1991.260.2.L13. [DOI] [PubMed] [Google Scholar]
  • 10.Devchand PR, Keller H, Peters JM, Vazquez M, Gonzalez FJ, Wahli W. The PPARalpha-leukotriene B4 pathway to inflammation control. Nature. 1996;384:39–43. doi: 10.1038/384039a0. [DOI] [PubMed] [Google Scholar]
  • 11.Narala VR, Adapala RK, Suresh MV, Brock TG, Peters-Golden M, Reddy RC. Leukotriene B4 is a physiologically relevant endogenous peroxisome proliferator-activated receptor-alpha agonist. The Journal of biological chemistry. 2010;285:22067–22074. doi: 10.1074/jbc.M109.085118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kersten S, Mandard S, Escher P, Gonzalez FJ, Tafuri S, Desvergne B, Wahli W. The peroxisome proliferator-activated receptor alpha regulates amino acid metabolism. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2001;15:1971–1978. doi: 10.1096/fj.01-0147com. [DOI] [PubMed] [Google Scholar]
  • 13.Peters JM, Shah YM, Gonzalez FJ. The role of peroxisome proliferator-activated receptors in carcinogenesis and chemoprevention. Nat Rev Cancer. 2012;12:181–195. doi: 10.1038/nrc3214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Reddy JK, Azarnoff DL, Hignite CE. Hypolipidaemic hepatic peroxisome proliferators form a novel class of chemical carcinogens. Nature. 1980;283:397–398. doi: 10.1038/283397a0. [DOI] [PubMed] [Google Scholar]
  • 15.Shah YM, Morimura K, Yang Q, Tanabe T, Takagi M, Gonzalez FJ. Peroxisome proliferator-activated receptor alpha regulates a microRNA-mediated signaling cascade responsible for hepatocellular proliferation. Mol Cell Biol. 2007;27:4238–4247. doi: 10.1128/MCB.00317-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.DuPre SA, Hunter KW., Jr Murine mammary carcinoma 4T1 induces a leukemoid reaction with splenomegaly: association with tumor-derived growth factors. Exp Mol Pathol. 2007;82:12–24. doi: 10.1016/j.yexmp.2006.06.007. [DOI] [PubMed] [Google Scholar]
  • 17.Mantovani A, Schioppa T, Porta C, Allavena P, Sica A. Role of tumor-associated macrophages in tumor progression and invasion. Cancer Metastasis Rev. 2006;25:315–322. doi: 10.1007/s10555-006-9001-7. [DOI] [PubMed] [Google Scholar]
  • 18.Nagaraj S, Gabrilovich DI. Tumor escape mechanism governed by myeloid-derived suppressor cells. Cancer Res. 2008;68:2561–2563. doi: 10.1158/0008-5472.CAN-07-6229. [DOI] [PubMed] [Google Scholar]
  • 19.Byrne WL, Mills KH, Lederer JA, O’Sullivan GC. Targeting regulatory T cells in cancer. Cancer research. 2011;71:6915–6920. doi: 10.1158/0008-5472.CAN-11-1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gobert M, Treilleux I, Bendriss-Vermare N, Bachelot T, Goddard-Leon S, Arfi V, Biota C, Doffin AC, Durand I, Olive D, Perez S, Pasqual N, Faure C, Ray-Coquard I, Puisieux A, Caux C, Blay JY, Menetrier-Caux C. Regulatory T cells recruited through CCL22/CCR4 are selectively activated in lymphoid infiltrates surrounding primary breast tumors and lead to an adverse clinical outcome. Cancer research. 2009;69:2000–2009. doi: 10.1158/0008-5472.CAN-08-2360. [DOI] [PubMed] [Google Scholar]
  • 21.Curiel TJ, Coukos G, Zou L, Alvarez X, Cheng P, Mottram P, Evdemon-Hogan M, Conejo-Garcia JR, Zhang L, Burow M, Zhu Y, Wei S, Kryczek I, Daniel B, Gordon A, Myers L, Lackner A, Disis ML, Knutson KL, Chen L, Zou W. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med. 2004;10:942–949. doi: 10.1038/nm1093. [DOI] [PubMed] [Google Scholar]
  • 22.Olkhanud PB, Baatar D, Bodogai M, Hakim F, Gress R, Anderson RL, Deng J, Xu M, Briest S, Biragyn A. Breast cancer lung metastasis requires expression of chemokine receptor CCR4 and regulatory T cells. Cancer Res. 2009;69:5996–6004. doi: 10.1158/0008-5472.CAN-08-4619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Olkhanud PB, Damdinsuren B, Bodogai M, Gress RE, Sen R, Wejksza K, Malchinkhuu E, Wersto RP, Biragyn A. Tumor-evoked regulatory B cells promote breast cancer metastasis by converting resting CD4 T cells to T-regulatory cells. Cancer research. 2011;71:3505–3515. doi: 10.1158/0008-5472.CAN-10-4316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Evans JF, Ferguson AD, Mosley RT, Hutchinson JH. What’s all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 2008;29:72–78. doi: 10.1016/j.tips.2007.11.006. [DOI] [PubMed] [Google Scholar]
  • 25.Esposito E, Cuzzocrea S. Targeting the peroxisome proliferator-activated receptors (PPARs) in spinal cord injury. Expert Opin Ther Targets. 2011;15:943–959. doi: 10.1517/14728222.2011.581231. [DOI] [PubMed] [Google Scholar]
  • 26.Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, Gonzalez FJ. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol. 1995;15:3012–3022. doi: 10.1128/mcb.15.6.3012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bernal-Mizrachi C, Weng S, Feng C, Finck BN, Knutsen RH, Leone TC, Coleman T, Mecham RP, Kelly DP, Semenkovich CF. Dexamethasone induction of hypertension and diabetes is PPAR-alpha dependent in LDL receptor-null mice. Nature Medicine. 2003;9:1069–1075. doi: 10.1038/nm898. [DOI] [PubMed] [Google Scholar]
  • 28.Ding Q, Yeung M, Camirand G, Zeng Q, Akiba H, Yagita H, Chalasani G, Sayegh MH, Najafian N, Rothstein DM. Regulatory B cells are identified by expression of TIM-1 and can be induced through TIM-1 ligation to promote tolerance in mice. The Journal of clinical investigation. 2011;121:3645–3656. doi: 10.1172/JCI46274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Rainsford KD. Ibuprofen: pharmacology, efficacy and safety. Inflammopharmacology. 2009;17:275–342. doi: 10.1007/s10787-009-0016-x. [DOI] [PubMed] [Google Scholar]
  • 30.Giroux M, Yurchenko E, St-Pierre J, Piccirillo CA, Perreault C. T regulatory cells control numbers of NK cells and CD8alpha+ immature dendritic cells in the lymph node paracortex. J Immunol. 2007;179:4492–4502. doi: 10.4049/jimmunol.179.7.4492. [DOI] [PubMed] [Google Scholar]
  • 31.Rubtsov YP, Rasmussen JP, Chi EY, Fontenot J, Castelli L, Ye X, Treuting P, Siewe L, Roers A, Henderson WR, Jr, Muller W, Rudensky AY. Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity. 2008;28:546–558. doi: 10.1016/j.immuni.2008.02.017. [DOI] [PubMed] [Google Scholar]
  • 32.Overwijk WW, Theoret MR, Finkelstein SE, Surman DR, de Jong LA, Vyth-Dreese FA, Dellemijn TA, Antony PA, Spiess PJ, Palmer DC, Heimann DM, Klebanoff CA, Yu Z, Hwang LN, Feigenbaum L, Kruisbeek AM, Rosenberg SA, Restifo NP. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J Exp Med. 2003;198:569–580. doi: 10.1084/jem.20030590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Schiavo R, Baatar D, Olkhanud P, Indig FE, Restifo N, Taub D, Biragyn A. Chemokine receptor targeting efficiently directs antigens to MHC class I pathways and elicits antigen-specific CD8+ T-cell responses. Blood. 2006;107:4597–4605. doi: 10.1182/blood-2005-08-3207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sampson AP. FLAP inhibitors for the treatment of inflammatory diseases. Curr Opin Investig Drugs. 2009;10:1163–1172. [PubMed] [Google Scholar]
  • 35.Friedman BS, Bel EH, Buntinx A, Tanaka W, Han YH, Shingo S, Spector R, Sterk P. Oral leukotriene inhibitor (MK-886) blocks allergen-induced airway responses. Am Rev Respir Dis. 1993;147:839–844. doi: 10.1164/ajrccm/147.4.839. [DOI] [PubMed] [Google Scholar]
  • 36.Wang D, Dubois RN. Eicosanoids and cancer. Nat Rev Cancer. 2010;10:181–193. doi: 10.1038/nrc2809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Daurkin I, Eruslanov E, Stoffs T, Perrin GQ, Algood C, Gilbert SM, Rosser CJ, Su LM, Vieweg J, Kusmartsev S. Tumor-associated macrophages mediate immunosuppression in the renal cancer microenvironment by activating the 15-lipoxygenase-2 pathway. Cancer research. 2011;71:6400–6409. doi: 10.1158/0008-5472.CAN-11-1261. [DOI] [PubMed] [Google Scholar]
  • 38.Panigrahy D, Edin ML, Lee CR, Huang S, Bielenberg DR, Butterfield CE, Barnes CM, Mammoto A, Mammoto T, Luria A, Benny O, Chaponis DM, Dudley AC, Greene ER, Vergilio JA, Pietramaggiori G, Scherer-Pietramaggiori SS, Short SM, Seth M, Lih FB, Tomer KB, Yang J, Schwendener RA, Hammock BD, Falck JR, Manthati VL, Ingber DE, Kaipainen A, D’Amore PA, Kieran MW, Zeldin DC. Epoxyeicosanoids stimulate multiorgan metastasis and tumor dormancy escape in mice. The Journal of clinical investigation. 2012;122:178–191. doi: 10.1172/JCI58128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Grant GE, Gravel S, Guay J, Patel P, Mazer BD, Rokach J, Powell WS. 5-oxo-ETE is a major oxidative stress-induced arachidonate metabolite in B lymphocytes. Free Radic Biol Med. 2011;50:1297–1304. doi: 10.1016/j.freeradbiomed.2011.02.010. [DOI] [PubMed] [Google Scholar]
  • 40.Pani G, Galeotti T, Chiarugi P. Metastasis: cancer cell’s escape from oxidative stress. Cancer Metastasis Rev. 2010;29:351–378. doi: 10.1007/s10555-010-9225-4. [DOI] [PubMed] [Google Scholar]
  • 41.McAllister SD, Murase R, Christian RT, Lau D, Zielinski AJ, Allison J, Almanza C, Pakdel A, Lee J, Limbad C, Liu Y, Debs RJ, Moore DH, Desprez PY. Pathways mediating the effects of cannabidiol on the reduction of breast cancer cell proliferation, invasion, and metastasis. Breast Cancer Res Treat. 2011;129:37–47. doi: 10.1007/s10549-010-1177-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rodriguez PC, Quiceno DG, Zabaleta J, Ortiz B, Zea AH, Piazuelo MB, Delgado A, Correa P, Brayer J, Sotomayor EM, Antonia S, Ochoa JB, Ochoa AC. Arginase I production in the tumor microenvironment by mature myeloid cells inhibits T-cell receptor expression and antigen-specific T-cell responses. Cancer research. 2004;64:5839–5849. doi: 10.1158/0008-5472.CAN-04-0465. [DOI] [PubMed] [Google Scholar]
  • 43.Mazzoni A, Bronte V, Visintin A, Spitzer JH, Apolloni E, Serafini P, Zanovello P, Segal DM. Myeloid suppressor lines inhibit T cell responses by an NO-dependent mechanism. Journal of immunology. 2002;168:689–695. doi: 10.4049/jimmunol.168.2.689. [DOI] [PubMed] [Google Scholar]
  • 44.Olkhanud PB, Rochman Y, Bodogai M, Malchinkhuu E, Wejksza K, Xu M, Gress RE, Hesdorffer C, Leonard WJ, Biragyn A. Thymic stromal lymphopoietin is a key mediator of breast cancer progression. Journal of immunology. 2011;186:5656–5662. doi: 10.4049/jimmunol.1100463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mahshid Y, Lisy MR, Wang X, Spanbroek R, Flygare J, Christensson B, Bjorkholm M, Sander B, Habenicht AJ, Claesson HE. High expression of 5-lipoxygenase in normal and malignant mantle zone B lymphocytes. BMC Immunol. 2009;10:2. doi: 10.1186/1471-2172-10-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jakobsson PJ, Shaskin P, Larsson P, Feltenmark S, Odlander B, Aguilar-Santelises M, Jondal M, Biberfeld P, Claesson HE. Studies on the regulation and localization of 5-lipoxygenase in human B-lymphocytes. Eur J Biochem. 1995;232:37–46. doi: 10.1111/j.1432-1033.1995.tb20778.x. [DOI] [PubMed] [Google Scholar]
  • 47.Werz O, Szellas D, Steinhilber D. Reactive oxygen species released from granulocytes stimulate 5-lipoxygenase activity in a B-lymphocytic cell line. Eur J Biochem. 2000;267:1263–1269. doi: 10.1046/j.1432-1327.2000.01000.x. [DOI] [PubMed] [Google Scholar]
  • 48.Kikuta Y, Kusunose E, Endo K, Yamamoto S, Sogawa K, Fujii-Kuriyama Y, Kusunose M. A novel form of cytochrome P-450 family 4 in human polymorphonuclear leukocytes. cDNA cloning and expression of leukotriene B4 omega-hydroxylase. The Journal of biological chemistry. 1993;268:9376–9380. [PubMed] [Google Scholar]
  • 49.Dubrac S, Elentner A, Schoonjans K, Auwerx J, Schmuth M. Lack of IL-2 in PPAR-alpha-deficient mice triggers allergic contact dermatitis by affecting regulatory T cells. European journal of immunology. 2011;41:1980–1991. doi: 10.1002/eji.201041357. [DOI] [PubMed] [Google Scholar]
  • 50.Kehrer JP, Biswal SS, La E, Thuillier P, Datta K, Fischer SM, Vanden Heuvel JP. Inhibition of peroxisome-proliferator-activated receptor (PPAR)alpha by MK886. Biochem J. 2001;356:899–906. doi: 10.1042/0264-6021:3560899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Taranova AG, Maldonado D, 3rd, Vachon CM, Jacobsen EA, Abdala-Valencia H, McGarry MP, Ochkur SI, Protheroe CA, Doyle A, Grant CS, Cook-Mills J, Birnbaumer L, Lee NA, Lee JJ. Allergic pulmonary inflammation promotes the recruitment of circulating tumor cells to the lung. Cancer Res. 2008;68:8582–8589. doi: 10.1158/0008-5472.CAN-08-1673. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES