Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Oct 1.
Published in final edited form as: Exp Eye Res. 2012 Sep 4;103:99–113. doi: 10.1016/j.exer.2012.08.010

Signaling pathways used by EGF to stimulate conjunctival goblet cell secretion

Robin R Hodges 1, Jeffrey A Bair 1, Richard B Carozza 1, Dayu Li 1, Marie A Shatos 1, Darlene A Dartt 1,*
PMCID: PMC3595052  NIHMSID: NIHMS409830  PMID: 22975404

Abstract

The purpose of this study was to identify the signaling pathways that epidermal growth factor (EGF) uses to stimulate mucin secretion from cultured rat conjunctival goblet cells and to compare the pathways used by EGF with those used by the known secretagogue muscarinic, cholinergic agonists. To this end, goblet cells from rat conjunctiva were grown in culture using RPMI media. For immunofluorescence experiments, antibodies against EGF receptor (EGFR) and ERK 2 as well as muscarinic receptors (M1AchR, M2AchR, and M3AchR) were used, and the cells viewed by fluorescence microscopy. Intracellular [Ca2+] ([Ca2+]i) was measured using fura 2/AM. Glycoconjugate secretion was determined after cultured goblet cells were preincubated with inhibitors, and then stimulated with EGF or the cholinergic agonist carbachol (Cch). Goblet cell secretion was measured using an enzyme-linked lectin assay with UEA-I or ELISA for MUC5AC. In cultured goblet cells EGF stimulated an increase in [Ca2+]i in a concentration-dependent manner. EGF-stimulated increase in [Ca2+]i was blocked by inhibitors of the EGF receptor and removal of extracellular Ca2+. Inhibitors against the EGFR and ERK 1/2 blocked EGF-stimulated mucin secretion. In addition, cultured goblet cells expressed M1AchR, M2AchR, and M3AchRs. Cch-stimulated increase in [Ca2+]i was blocked by inhibitors for the M1AchRs, matrix metalloproteinases, and EGF receptors. Inhibitors against the EGF receptor and ERK 1/2 also blocked Cch-stimulated mucin secretion. We conclude that in conjunctival goblet cells, EGF itself increases [Ca2+]i and activates ERK 1/2 to stimulate mucin secretion. EGF-stimulated secretion is dependent on extracellular Ca2+. This mechanism of action is similar to cholinergic agonists that use muscarinic receptors to transactivate the EGF receptor, increase [Ca2+]i, and activate ERK 1/2 leading to an increase in mucin secretion.

Keywords: goblet cells, conjunctiva, epidermal growth factor, muscarinic receptors, secretion

1. Introduction

Goblet cells are specialized cells that synthesize and secrete mucins. They are present in a variety of tissues including trachea, colon, pancreas, nose, and conjunctiva (Rubin, 2002; Neutra et al., 1984; Walters, 1965; Lee et al., 2001; Dartt et al., 2000). In the conjunctiva, goblet cells are the major producer of the secreted mucin present in the tear film (Dartt et al., 2000). Goblet cells are interspersed throughout the stratified squamous cells of the conjunctiva and extend from the ocular surface to the basement membrane. Goblet cells occur either singly, as in humans, or in clusters, as in rodents. The presence of goblet cells and their ability to secrete mucins is critical to the health of the ocular surface. Diseases of both increased and decreased numbers of filled goblet cells occur. Diseases such as vitamin A deficiency and cicatricial pemphigoid are characterized by a loss of filled goblet cells in the conjunctiva and are devastating to ocular surface health. Allergic conjunctivitis and its accompanying mucous fishing syndrome and diseases such as vernal keratoconjunctivitis are characterized by an increase in the number of filled goblet cells and are also deleterious to the ocular surface and to patient’s quality of life (Dogru et al., 2005; Aragona et al., 1996).

Mucins are large glycoproteins and on the ocular surface, provide a smooth refractive surface, protect it from bacterial adhesion, and lubricate it during the blink. As either a change in composition or amount of mucus is deleterious to the ocular surface, the secretion of mucins from goblet cells is tightly controlled. The most abundant mucin secreted by goblet cells of the conjunctiva is MUC5AC, a secreted mucin, while stratified squamous cells of the conjunctiva express the membrane-bound mucins MUC1, MUC4 and MUC16 (Mantelli and Argueso, 2008). While these latter three mucins are membrane-bound, the ectodomains of these mucins can be released into the tear film (Govindarajan and Gipson, 2010).

There is ample evidence to support the fact that mucin secretion from conjunctival goblet cells is under neural control, similarly to the regulation of secretion in other epithelial tissues (Karmouty-Quintana et al., 2007; Rogers, 2001; Neutra et al., 1984). Parasympathetic and sympathetic nerves surround the basolateral membranes of the goblet cells (Diebold et al., 2001). Exogenous addition of cholinergic agonists, released from parasympathetic nerves, has been shown to stimulate glycoconjugate secretion from conjunctival pieces (Kanno et al., 2003; Rios et al., 1999). In addition, vasoactive intestinal peptide (VIP) which is also released from parasympathetic nerves stimulates glycoconjugate secretion from conjunctival pieces (Rios et al., 1999).

Epidermal growth factor (EGF) binds to and activates its receptor ErbB1 (also known as EGF receptor (EGFR)). Upon binding of EGF, the EGFR forms homo- and heterodimers with other family members to recruit adaptor molecules such as phospholipase C (PLC) γ, Src, Pyk2, phosphatidylinositol 3-kinase, Shc, and Grb2 (Carpenter, 2000). These adaptor proteins then initiate signaling cascades including extracellular regulated kinase 1/2 (ERK 1/2, also known as p44/p42 mitogen-activated protein kinase) leading to stimulation of a plethora of cellular processes including cell growth, proliferation, differentiation, and gene expression (Ramos, 2008). These processes are long-term occurring over hours or days. Indeed, in the cultured conjunctival goblet cells, EGF stimulates cell proliferation through activation of protein kinase C (PKC)α and -ε isotypes and ERK 1/2 (Shatos et al., 2008, 2009a, 2009b). However, recent evidence has demonstrated that EGF can also mediate short-term events such as protein secretion in the lacrimal gland (Chen et al., 2006, 2005).

Muscarinic receptors (MAchR) of the 1, 2, and 3 subtypes were detected on goblet cells from rat, mouse, and rat conjunctiva (Diebold et al., 2001) and inhibition of these receptors decreased cholinergic agonist-stimulated mucin secretion (Kanno et al., 2003) in rat conjunctival pieces. Activation of the MAchRs stimulates hydrolysis of phosphatidylinositolbisphosphate (PIP2) by phospholiase C. The hydrolysis of PIP2 results in the formation of diacylglycerol (DAG) and 1,4,5 inositol trisphosphate (InsP3). DAG activates the classical isotypes of PKC while InsP3 increases the intracellular [Ca2+] ([Ca2+]i) releasing Ca2+ from intracellular stores. Stimulation of PKC alone with addition of exogenous PKC activators stimulates mucin secretion and incubation with PKC inhibitors blocks cholinergic agonist-stimulated mucin secretion (Dartt et al., 2000). Similarly, increasing the [Ca2+]i with a Ca2+ ionophore stimulates mucin secretion while chelation of extracellular Ca2+ inhibits cholinergic agonist-stimulated mucin secretion (Dartt et al., 2000).

It is well-established that G-protein coupled receptors (GPCRs) such as MAchRs interact with EGF receptors in many cell types (Rozengurt, 2007; Kalmes et al., 2001; Chen et al., 2006). Activation of MAchRs stimulates matrix metalloproteinases (MMP) to cleave the precursor molecule, which is located in the plasma membrane, generating the pro- and mature form of EGF (Ohtsu et al., 2006b, 2006a). This process is called ectodomain shedding. The shed EGF can bind to and activate EGFRs on the same cell or neighboring cells. In conjunctival pieces, cholinergic agonists increased phosphorylation of the EGFR and EGFR inhibitor AG1478 inhibited cholinergic agonist-stimulated secretion (Kanno et al., 2003). In addition, cholinergic agonists activated Src, Pyk2, and ERK 1/2, proteins associated with the EGFR (Kanno et al., 2003). Inhibition of Src or ERK 1/2 blocked cholinergic agonist-stimulated glyco-conjugate secretion. Therefore, MAchRs transactivate the EGFR leading to glycoconjugate secretion.

Thus far, all studies involving cholinergic activation of muscarinic receptors and their interactions with EGFR in the conjunctiva have only been performed using pieces of the tissue, which include stratified squamous cells and stromal fibroblasts. While the majority of mucin secretion is likely from the goblet cells, the effects of the other cell types on cellular signaling processes or on goblet cell function cannot be excluded. In addition, studies investigating the [Ca2+]i in individual cells are technologically challenging in conjunctiva tissue pieces. To overcome these difficulties, we developed a method to isolate and culture pure conjunctival goblet cells. The purpose of the present study is to determine if EGF stimulates an increase in [Ca2+]i and mucin secretion from cultured rat conjunctival goblet cells and if so, what signaling pathways it uses. In addition, the effects of cholinergic agonists on [Ca2+]i and EGF-stimulated mucin secretion in the cultured goblet cells are examined.

2. Materials and methods

2.1. Methods

The antibody to EGFR was from Cell Signaling Technologies (Beverly, MA). Antibodies to M1AchR, M2AchR, M3AchR and ERK 1/2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). EGF was purchased from Peprotech (Rocky Hill, NJ) while fura 2/AM was purchased from Invitrogen (Carlsbad, CA). RPMI 1640 media is from Lonza (Walkersville, MD). siRNA and transfection reagents were purchased from Dharmacon (Lafayette, CO) while FITC-conjugated Ulex europaeus agglutinin (UEA)-1 lectin, carbachol, gallamine, and pirenzipine were from Sigma–Aldrich (St. Louis, MO). AG1478 was from LC Services (Waltham, MA). 4-DAMP and U0126 were from Tocris (Minneapolis, MN) and TAPI 2 was purchased from EMD Biosciences (San Diego, CA). Rat MUC5AC ELISA kit was purchased from Biotang (Waltham, MA).

2.2. Animals

Male Sprague–Dawley rats (Taconic Farms, Hudson, NY) weighing between 125 and 150 g were anesthetized with CO2 for 1 min, decapitated, and the bulbar and forniceal conjunctiva were removed from both eyes. All experiments were approved by the Schepens Eye Research Institute Animal Care and Use Committee.

2.3. Cell culture

Goblet cells from rat bulbar and forniceal conjunctiva were grown in organ culture as described previously (Shatos et al., 2003, 2001). The tissue plug was removed after nodules of cells were observed. First passage goblet cells were used in all experiments. Cultured cells were periodically checked by evaluating staining with antibody to cytokeratin 7 (detects goblet cell bodies) and the lectin UEA-1 (detects goblet cell secretory product) to ensure that goblet cells predominated.

2.4. Measurement of [Ca2+]i

Goblet cells were incubated for 1 h at 37 °C with Krebs–Ringer bicarbonate buffer with HEPES (KRB-HEPES) (119 mM NaCl, 4.8 mM KCl, 1.0 mM CaCl2, 1.2 mM MgSO4, 1.2 mM KH2PO4, 25 MM NaHCO3, 10 mM HEPES, and 5.5 mM glucose (pH 7.45)) plus 0.5% BSA containing 0.5 µM fura 2/AM, 8 µM pluronic acid F127, and 250 µM sulfinpyrazone followed by washing in KRB-HEPES containing sulfinpyrazone. Calcium measurements were made with a ratio imaging system (In Cyt Im2; Intracellular Imaging) using wave-lengths of 340 and 380 nm and an emission wavelength of 505 nm. At least 10 cells were used for each condition. Inhibitors were added 30 min before agonists. After addition of agonists data were collected in real time. Data are presented as the actual [Ca2+]i with time or as the change in peak [Ca2+]i. Change in peak [Ca2+]i was calculated by subtracting the average of the basal value (no added agonist) from the peak [Ca2+]i. Although data are not shown, the plateau [Ca2+]i was affected similarly to the peak [Ca2+]i.

2.5. siRNA and western blot analysis

First passage goblet cells were grown in 6 well plates. siRNA against either EGFR or ERK 2 (Table 1) were a set of 4 pooled siRNAs (Dharmacon) and were added at a final concentration of 100 nM in antibiotic-free RPMI 1640 using DharmaFect siRNA transfection reagent according to manufacturer’s instructions. Media was removed after 18 h and replaced with fresh, complete RPMI 1640 and incubated for 48 h before use.

Table 1.

siRNA sequences.

Molecule siRNA sequences
EGFR 5′ CGAAAUUUGUGCUACGCAA 3′
5′ CCAGAGACCCACAGCGCUA 3′
5′ CAAUGGACGUACAGCGCCCA 3′
5′ GGGAAAUGCUCUCUACGAA 3′
ERK2 5′ ACACUAAUCUCUCGUACAU 3′
5′ AAAAUAAGGUGCCGUGGAA 3′
5′ UAUACCAAGUCCAUUGAUA 3′
5′ UCGAGUUGCUAUCAAGAAA 3′
Scrambled 5′ UGGUUUACAUGUCGACUAA 3′
Open in a new tab

We initially characterized the transfection efficiency using a scrambled sequence siRNA conjugated to labeled FITC. Transfected cells were fixed with formaldehyde and viewed by fluorescence microscopy. The percentage of cells which expressed the fluorescence was determined to be 90–95% (data not shown).

To ensure the successful depletion of the proteins from the goblet cells, one well was scraped in RIPA buffer (10 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, 1 mM EDTA, 100 µg/ml phenylmethylsulfonyl fluoride, 30 µl/ml aprotinin, and 1 mM sodium orthovanadate). The homogenate was collected and centrifuged for 30 m at 4 °C at 3000 rpm. The proteins in the supernatant were separated by SDS-PAGE and transferred to nitrocellulose membrane. The membranes were blocked in 5% dried milk in TBST (10 mM Tris–HCl ph 8, 500 mM NaCl, 0.05% Tween-20) and incubated with antibodies to either EGFR or ERK 1/2 overnight at 4 °C. The membranes were washed 3 times in TBST before incubation for 1 h with the secondary antibody conjugated to horseradish peroxidase. The immunoreactive bands were visualized by the chemiluminescence method.

2.6. Measurement of high molecular weight glycoconjugate secretion

Cultured goblet cells were serum starved for 2 h before use, preincubated with inhibitors for 30 min, and then stimulated with EGF or the cholinergic agonist carbachol (Cch) in serum-free RPMI 1640 supplemented with 0.5% BSA for 0–4 h. For siRNA experiments, goblet cells were incubated with 100 nM siRNA for EGFR, ERK 2 or scrambled siRNA overnight. The siRNA was removed and cells placed in fresh media for 48 h prior to stimulation. Goblet cell secretion was measured using an enzyme-linked lectin assay (ELLA) with the lectin UEA-I. UEA-1 detects high molecular weight glycoconjugates including mucins produced by rat goblet cells. The media were collected and analyzed for the amount of lectin-detectable glycoconjugates, which quantifies the amount of goblet cell secretion (Kanno et al., 2003; Rios et al., 1999; Dartt et al., 2011). Glycoconjugate secretion was expressed as fold increase over basal that was set to 1.

To measure MUC5AC secretion, goblet cells were also serum starved for 2 h before use and then stimulated with EGF (10−7 and 10−8 M) or Cch (10−4 M) in serum-free RPMI 1640 supplemented with 0.5% BSA for 1 h. The supernatant was collected and assayed for MUC5AC by ELISA according to the manufacturer’s instructions. The amount of MUC5AC was standardized to the amount of total protein in each well as determined by Bradford assay (Bradford, 1976).

2.7. Immunofluorescence experiments

Goblet cells were grown on glass coverslips as described previously (Dartt et al., 2011; Shatos et al., 2009a, 2009b) Cells were fixed in 4% formaldehyde in PBS before use. M1AchR, M2AchR, and M3AchR antibodies were used at 1:100 dilution overnight at 4 °C. UEA-1 conjugated to FITC (Sigma–Aldrich, St. Louis, MO) was used at a dilution of 1:500 and identified goblet cell secretory product. Secondary antibody was conjugated to Cy 3 (Jackson ImmunoResearch Laboratories, West Grove, PA) and was used at a dilution of 1:150 for 1.5 h at room temperature. Negative control experiment was the isotype control of the primary antibodies. The cells were viewed by fluorescence microscopy (Eclipse E80i; Nikon, Tokyo, Japan) and micrographs were taken with a digital camera (Spot; Diagnostic Instruments, Inc., Sterling Heights, MI).

2.8. Statistical analysis

Results were expressed as the fold-increase above basal. Results are presented as mean ± SEM. Data were analyzed by Student’s t-test. P < 0.05 was considered statistically significant.

3. Results

3.1. Effect of EGF on [Ca2+]i

We previously showed that cultured goblet cells express all four subtypes of EGF receptors and use the EGFR, ErbB2, and ErbB3, but not ErbB4, to stimulate goblet cell proliferation (Gu et al., 2008). Therefore, we investigated the effects of EGF on [Ca2+]i (Fig. 1A). EGF (10−10−10−6 M) increased [Ca2+]i in a concentration dependent manner (Fig. 1B). When the peak [Ca2+]i was calculated, EGF significantly increased [Ca2+]i at all concentrations with a maximum increase above basal of 306.8 ± 95.2 nM occurring at EGF 10−7 M (Fig. 1C).

Fig. 1.

Fig. 1

Open in a new tab

Effect of EGF on [Ca2+]i and inhibition of the EGF receptor on EGF-stimulated [Ca2+]i. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM and [Ca2+]i was measured in response to EGF (10−10−10−6 M). Real time images from a single experiment using EGF at 10−7 M are shown in A. Traces shown in B are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in C. Cultured rat goblet cells were preincubated with the EGF receptor inhibitor AG1478 (10−6 and 10−5 M) for 5 min and [Ca2+]i was measured in response to EGF (10−7 M). Traces shown in D are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in E. Western blot analysis of goblet cells untreated (C) or treated either with scrambled (sc) siRNA or EGF receptor siRNA and incubated with antibodies against EGF receptor and β-actin for standardization. Blot shown in F is representative of 2 independent experiments [Ca2+]i was measured in cells treated with sc siRNA or siRNA for the EGF receptor in response to EGF (10−7 M). Traces shown in G are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in H. * indicates significant difference from basal; # indicates significant difference from EGF alone.

To confirm that EGF is acting through the EGFR, cultured goblet cells were preincubated for 5 min with the EGFR inhibitor AG1478 (10−6 and 10−5 M) (Fig. 1A and D). AG1478 10−5 M significantly decreased EGF-stimulated increase in [Ca2+]i from 150 ± 14.3 nM to 46.7 ± 21.2 nM (Fig. 1E). To confirm these results, goblet cells were then treated with siRNA for EGFR and [Ca2+]i was measured in response to EGF (10−7 M). To ensure that the EGFR was knocked down as a result of the siRNA treatment, western blot analysis was performed on untreated cells (C) and cells treated siRNA with a scrambled sequence (sc siRNA) and siRNA for the EGFR using antibodies to the EGFR and, to control for loading amounts, β-actin. Treatment with sc siRNA did not alter the amount of EGFR while treatment with EGFR siRNA substantially reduced the amount of EGFR (Fig. 1F) [Ca2+]i was then measured on goblet cells in parallel wells. As shown in Fig. 1A, G and H, the scrambled siRNA (sc siRNA) had no significant effect on EGF-stimulated increase in [Ca2+]i while EGFR siRNA significantly decreased the effect from 156.5 ± 27.7 nM to 20.6 ± 18.2 nM.

These results demonstrate that EGF binds to its receptors on conjunctival goblet cells and increases [Ca2+]i.

3.2. Effect of inhibition of ERK 1/2 on EGF-stimulated increase in [Ca2+]i

To determine if ERK 1/2 plays a role in EGF-stimulated increase in [Ca2+]i, cultured rat goblet cells were preincubated with U0126 (10−8 and 10−7 M) for 30 min and [Ca2+]i was measured in response to EGF (10−7 M) (Fig. 2A). EGF significantly increased [Ca2+]i by 165.8 ± 26.1 nM above basal (Fig. 2B and C). Neither concentration of U0126 altered the EGF-stimulated Ca2+ response. Goblet cells were then treated with siRNA for ERK 2 to confirm these results. To ensure that the ERK 2 was knocked down as a result of the siRNA treatment, western blot analysis was performed on untreated cells (C) and cells treated siRNA with a scrambled sequence (NC) and siRNA for ERK 2 using antibodies to the ERK 1/2 and, to control for loading amounts, β-actin. Treatment with NC siRNA did not alter the amount of ERK 2 while treatment with ERK2 siRNA substantially reduced the amount of EGFR (Fig. 2D). Similar to the effect of U0126, ERK 2 siRNA did not have a significant effect on EGF-stimulated increase in [Ca2+]i (Fig. 2A, E and F).

Fig. 2.

Fig. 2

Open in a new tab

Effect of inhibition of ERK 1/2 on EGF-stimulated increase in [Ca2+]i. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM, preincubated with the MEK inhibitor U0126 (10−8 and 10−7 M), and [Ca2+]i was measured in response to EGF (10−7 M). Real time images from a single experiment are shown in A. Traces shown in B are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in C. Western blot analysis of goblet cells untreated (C) or treated either with scrambled (NC) siRNA or ERK 2 siRNA and incubated with antibodies against ERK 2 and β-actin for standardization. Blot shown in D is representative of 2 independent experiments. Traces shown in E are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in F. * indicates significant difference from basal.

Thus the EGF induced increase in [Ca2+]i is proximal in the signaling pathway to the activation of ERK 1/2. This result is similar to that found for cholinergic-agonist stimulated increase in [Ca2+]i.

3.3. Role of Ca2+ influx in EGF-stimulated increase in [Ca2+]i

To determine if EGF releases Ca2+ from intracellular stores via generation of InsP3 or increases the influx of Ca2+ from the extracellular media to increase [Ca2+]i, cultured goblet cells were placed in Ca2+-free buffer, immediately stimulated with EGF (10−7 M), and [Ca2+]i measured (Fig. 3A). As shown in Fig. 3B and C, EGF in Ca2+ containing buffer significantly increased [Ca2+]i above basal by 165.8 ± 26.0 nM. In Ca2+-free buffer, the peak EGF response was 26.1 ± 2.4 nM which was significantly decreased from the EGF response in Ca2+-containing buffer. This suggests that EGF increases [Ca2+]i by opening channels in the plasma membrane which allows Ca2+ to enter the cell.

Fig. 3.

Fig. 3

Open in a new tab

Effect of Ca2+ Influx on EGF-stimulated increase in [Ca2+]i. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM and [Ca2+]i was measured in response to EGF (10−7 M) in the presence or absence of 1 mM Ca2+. Real time images from a single experiment are shown in A. Traces shown in B are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM in C. * indicates significant difference from basal; # indicates significant difference from EGF in the presence of Ca2+o.

3.4. Effect of EGF on high molecular weight glycoconjugate secretion from cultured rat goblet cells

Previous studies have shown that EGF stimulates goblet cell proliferation and the current study demonstrates that EGF increases [Ca2+]i. To determine if EGF also increases high molecular weight glycoconjugate secretion, cultured goblet cells were incubated with EGF (10−8 and 10−7 M) for 0–4 h. High molecular weight glycoconjugate secretion was measured by ELLA. EGF 10−8 M increased secretion by 2.4 ± 1.2, 4.0 ± 0.3, 2.4 ± 1.1, and 1.3 ± 0.3 fold above basal at 0.5, 1, 2, and 4 h, respectively (Fig. 4A). EGF 10−7 M increased secretion by 1.3 ± 0.3, 2.0 ± 0.2, 1.4 ± 0.5, and 0.6 ± 0.2 fold above basal at 0.5, 1, 2, and 4 h, respectively (Fig. 4A). For both concentrations, maximum secretion, which was significantly increased above basal, occurred at 1 h. As a positive control, Cch (10−4 M) increased high molecular weight secretion 4.1 ± 2.3 fold above basal.

Fig. 4.

Fig. 4

Open in a new tab

Effect of EGF on high molecular weight glycoconjugate secretion from cultured rat goblet Cells. Cultured rat goblet cells were serum starved for 2 h and then stimulated with EGF (10−8 and 10−7 M) for 0–4 h or carbachol (Cch, 10−4 M) for 2 h. The mean ± SEM of 3 independent experiments is shown in A. Cultured goblet cells were preincubated for 30 min with either AG1478 (10−6 and 10−5 M) shown in B or U0126 (10−7 and 10−6 M) shown in C and then stimulated with EGF (10−7 M) for 1 h. Data are mean ± SEM of 3 independent experiments. Cultured goblet cells were stimulated for 1 h by EGF (10−8 and 10−7 M) in the presence or absence of 1 mM Ca2+ and high molecular weight glyco-conjugate secretion measured. Data in D are mean ± SEM of 3 independent experiments. * indicates significant difference from basal; # indicates significant difference from EGF in the presence of Ca2+o. Cultured rat goblet cells were serum starved for 2 h and then stimulated with EGF (10−8 and 10−7 M) or carbachol (Cch, 10−5 and 10−4 M) for 1 h. The amount of MUC5AC in the supernatant was determined by ELISA. Data from 1 experiment is shown in E.

To ensure that EGF is activating EGFR to stimulate high molecular weight secretion, goblet cells were preincubated with AG1478 (10−6 and 10−5 M) and stimulated with EGF (10−7 M) for 1 h. EGF significantly increased high molecular weight glycoconjugate secretion 1.4 ± 0.1 fold above basal (Fig. 4B). AG1478 10−5 M completely inhibited this response (Fig. 4B). AG1478 (10−5 M) alone had no significant effect on basal secretion (data not shown).

We determined if EGF activates ERK 1/2 to stimulate secretion in cultured goblet cells. To this end, cultured goblet cells were preincubated with U0126 for 30 m and EGF-stimulated secretion was measured after 1 h. EGF significantly increased secretion 1.4 ± 0.1 fold above basal (Fig. 4C). Again, U0126 (10−6 M) completely inhibited the EGF-stimulated response (Fig. 4C). U0126 (10−6 M) alone had no significant effect on basal secretion (data not shown).

The next set of experiments were designed to determine if EGF-stimulated high molecular weight glycoconjugate secretion is dependent on the increase in [Ca2+]i. Cultured goblet cells were incubated in Ca2+-free media and secretion was measured in response to EGF (10−7 M) for 1 h. Basal secretion in the absence of Ca2+o was 1.1 ± 0.0 fold above the basal in the presence of Ca2+o, which was 1.0 ± 0.0. This is a significant increase (Fig. 4D). EGF (10−8 M) in the presence of Ca2+o significantly increased secretion 2.1 ± 0.2 fold above basal in presence of Ca2+o. This was significantly decreased to 1.2 ± 0.2 fold above basal without Ca2+o (Fig. 4D). Similar results were obtained when cells were incubated with EGF 10−7 M (Fig. 4D).

Our results demonstrate that EGF stimulates conjunctival goblet cell secretion by binding to its receptor to increase [Ca2+]i and activate ERK 1/2.

To ensure that our measurement of high molecular weight glycoconjugate secretion reflected the secretion of MUC5AC, cultured goblet cells were incubated with either EGF (10−8 and 10−7 M) or Cch (10−5 and 10−4 M) for 1 h. The amount of MUC5AC was determined in the supernatant with a commercially available MUC5AC ELISA kit. The amount of MUC5AC was standardized to the amount of total protein from each well. EGF 10−8 and 10−7 M increased secretion 1.5 and 4.5 fold above basal and Cch 10−5 and 10−4 M increased secretion 4.1 and 6.5 fold above basal respectively while respectively (Fig. 4E). These data indicate that the ELLA used to measure high molecular weight glycoconjugate secretion mirrored MUC5AC secretion as measured by the much more sensitive ELISA method.

3.5. Presence of muscarinic receptors in cultured rat conjunctival goblet cells

We previously showed that the EGFR and muscarinic receptors interact to stimulate mucin secretion from goblet cells in the conjunctiva. To explore the interactions of these two receptors in cultured goblet cells, we first determined which muscarinic receptors are expressed in cultured goblet cells. Goblet cells were grown on coverslips and immunofluorescence microscopy was performed using antibodies directed against the M1AchR, M2AchR, and M3AchR muscarinic receptors. To ensure that cells were goblet cells, the cells were double labeled with the lectin UEA-1. As shown in Fig. 5, cultured goblet cells express M1AchR, M2AchR, and M3AchR muscarinic receptors (shown in red). Muscarinic receptors were expressed in cells that were positive for UEA-1 (shown in green) indicating that cultured goblet cells do express M1AchR, M2AchR and M3AchRs.

Fig. 5.

Fig. 5

Open in a new tab

Presence of M1AchR, M2AchR, and M3AchR subtypes of muscarinic receptors in cultured rat goblet Cells. Cultured rat goblet cells were grown on glass coverslips and immunofluorescence experiments performed with antibodies to M1AchR, M2AchR, and M3AchR muscarinic receptors. Cells were double labeled with the lectin Ulex europaeus agglutinin (UEA)-1 which stains secretory products. Muscarinic receptors are shown in red in left column. Cells labeled with UEA-1 are shown in green in middle column. Overlay of muscarinic receptors and UEA-1 are shown in right column. Co-localization appears as yellow. Magnification 200×.

3.6. Effect of cholinergic agonists on [Ca2+]i in cultured rat goblet cells

We next determined the effects of muscarinic agonists on [Ca2+]i by measuring [Ca2+]i in response to increasing concentrations of Cch (10−6−10−3 M). As shown in Fig. 6A, Cch (10−4 M) increased [Ca2+]i. Additional concentrations of Cch (10−6−10−3 M) also increased [Ca2+]i (Fig. 6B). When peak [Ca2+]i was calculated, all concentrations significantly increased [Ca2+]i with a maximum increase of 305.0 ± 35.6 nM above basal at 10−4 M carbachol (Fig. 6C).

Fig. 6.

Fig. 6

Open in a new tab

Effect of the cholinergic agonist carbachol on [Ca2+]i in cultured rat goblet Cells. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM and [Ca2+]i was measured in response to carbachol (Cch, 10−6−10−3 M). Real time images are shown in A from a single experiment using Cch (10−4 M) while traces shown in B are mean of 5 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 5) in C. Cultured rat goblet cells were preincubated with the muscarinic receptor inhibitors 4-DAMP (10−5 M), gallamine (Gal, 10−5 M) or pirenzipine (Pir, 10−5 M) for 30 min and [Ca2+]i was measured in response to Cch (10−4 M). Real time images are shown in D from a single experiment. Traces shown in E are mean of 6 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 6) in F. * indicates significant difference from basal; # indicates significant difference from Cch alone.

To ensure that Cch is not acting non-specifically but is indeed activating muscarinic receptors, cultured rat goblet cells were preincubated for 30 min with three inhibitors, 4-DAMP (10−5 M), which shows selectivity toward M3AchRs (Sharif et al., 1995), gallamine (10−5 M) which shows selectivity toward M2AchRs (Franken et al., 2000), and pirenzepine (10−5 M), which is selective toward M1AchRs (Hammer et al., 1980), and [Ca2+]i measured in response to Cch 10−4M (Fig. 6D). When peak [Ca2+]i was calculated, Cch increased [Ca2+]i 305.0 ± 35.6 nM. 4-DAMP decreased Cch-stimulated [Ca2+]i response to 194.2 ± 61.9 nM, gallamine decreased it to 146.4 ± 71.2 nM, and pirenzepine decreased it to 94.3 ± 21.5 nM (Fig. 6E and F). Only the decrease seen with pirenzepine was significantly different from the Cch response (Fig. 6F). None of the inhibitors alone had a significant effect on basal [Ca2+]i (data not shown).

Cholinergic agonists increase [Ca2+]i in conjunctival goblet cells predominantly by activating M1AchR. A small effect of M2AchR and M3AchR cannot be excluded.

3.7. Effect of inhibition of EGF receptor on cholinergic agonist-stimulated increase in [Ca2+]i

To explore the interactions of the EGF and muscarinic receptors, goblet cells were preincubated with the MMP inhibitor TAPI 2 (10−6 M) for 30 min prior to stimulation with Cch (10−4 M) and [Ca2+]i was measured (Fig. 7A). Incubation with TAPI 2 significantly decreased the Cch response to 74.7 ± 25.3 nM from 292.4 ± 74.4 nM (Fig. 7B and C). TAPI 2 alone did not have a significant effect on basal [Ca2+]i (data not shown).

Fig. 7.

Fig. 7

Open in a new tab

Effect of inhibition of matrix metalloproteinases MMPs and the EGF receptor on carbachol-stimulated [Ca2+]i and high molecular weight glycoconjugate Secretion. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM. TAPI 2 (10−6 M) was added 30 min prior and AG1478 (10−6 and 10−5 M) was added 5 min prior to measurement of [Ca2+]i in response to carbachol (Cch, 10−4 M). Real time images from a single experiment are shown in A. Traces shown in B and D are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 3) in C and E. Cultured rat goblet cells were incubated with a scrambled sequence siRNA (sc siRNA) and siRNA for the EGF receptor [Ca2+]i was measured in response to Cch (10−4 M). Traces shown in F are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 3) in G. Serum-starved cultured goblet cells were preincubated with AG1478 (10−8−10−5 M) and stimulated with Cch (10−4 M) for 2 h. High molecular weight glycoconjugate secretion was measured. Data shown in H is mean ± SEM from 4 independent experiments. * indicates significant difference from basal; # indicates significant difference from Cch alone.

Cultured rat goblet cells were also preincubated with the EGFR inhibitor AG1478 (10−6 and 10−5 M) for 5 min prior to stimulation with Cch (10−4 M) and [Ca2+]i was measured (Fig. 7A). Cch increased [Ca2+]i by 308.3 ± 48.7 nM (Fig. 7D and E). This response was decreased to 108.0 ± 68.3 and 122.2 ± 22.0 nM at AG1478 10−6 and 10−5 M, respectively. The decrease seen at 10−5 M AG1478 was significantly decreased from Cch alone. AG1478 alone did not have a significant effect on basal [Ca2+]i (data not shown).

To confirm effect of cholinergic agonists on the EGFR, goblet cells were incubated with siRNA for the EGF receptor. In parallel wells, the [Ca2+]i was measured in response to Cch (10−4 M) (Fig. 7A and F). Cch increased [Ca2+]i by 234.3 ± 7.5 nM. This was not significantly altered by incubation with a scrambled sequence siRNA and was 172.8 ± 81.9 nM. Incubation with EGF receptor siRNA significantly decreased [Ca2+]i from the response to Cch alone and was 70.8 ± 55.5 nM (Fig. 7G).

It has been demonstrated that Cch stimulates high molecular weight glycoconjugate secretion from goblet cells in conjunctival pieces via transactivation of the EGF receptor (Kanno et al., 2003). In addition, Cch stimulates high molecular weight glycoconjugate secretion from cultured goblet cells (Rios et al., 2008), but it is unknown if in cultured goblet cells Cch also transactivates the EGF receptor to stimulate high molecular weight glycoconjugate secretion. To answer this question, cultured goblet cells were preincubated for 30 min with AG1478 10−8−10−5 M. Cch (10−4 M) was then added for 1 h. High molecular weight glycoconjugate secretion was measured by ELLA. Cch increased secretion 2.4 ± 0.5 fold above basal (Fig. 7H). Cch-stimulated secretion was decreased in a concentration-dependent manner with AG1478. Inhibition obtained at AG1478 10−6 and 10−5 M was significantly different than Cch alone. AG1478 alone did not have a significant effect on basal secretion (data not shown).

Taken together, these data indicate that in cultured goblet cells cholinergic agonists transactivate the EGFR to increase [Ca2+]i and cause high molecular weight glycoconjugate secretion.

3.8. Effect of inhibition of ERK 1/2 on cholinergic agonist-stimulated [Ca2+]i

It is well known that one consequence of activation of the EGFR is phosphorylation of ERK 1/2 thereby activating this kinase. In conjunctival pieces, inhibition of ERK 1/2 with the inhibitor U0126 blocked cholinergic agonist-induced high molecular weight glycoconjugate secretion (Kanno et al., 2003). In cultured rat goblet cells, Cch (10−4 M) significantly increased [Ca2+]i by 292.4 ± 74.4 nM above basal (Fig. 8A–C). Neither concentration of U0126 significantly decreased the Cch-stimulated in [Ca2+]i. U0126 alone did not have a significant effect on basal [Ca2+]i (data not shown).

Fig. 8.

Fig. 8

Open in a new tab

Effect of inhibition of ERK 1/2 on carbachol-stimulated increase in [Ca2+]i. Cultured rat goblet cells were incubated with the Ca2+ indicator dye fura 2/AM. U0126 (10−8 and 10−7 M) were added 30 min prior to measurement of [Ca2+]i in response to carbachol (Cch, 10−4 M). Real time images from a single experiment are shown in A. Traces shown in B are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 3) in C. Cultured rat goblet cells were incubated with a scrambled sequence siRNA (sc siRNA) or siRNA for the ERK 2 and [Ca2+]i was measured in response to Cch (10−4 M). Traces shown in D are mean of 3 individual experiments. Peak [Ca2+]i was calculated and shown as mean ± SEM (n = 3) in E. * indicates significant difference from basal.

To confirm the results with U0126, cultured goblet cells were incubated with siRNA for ERK 2. In parallel wells, the [Ca2+]i was determined in response to Cch (Fig. 4A). Scrambled siRNA had no effect on Cch-stimulated increase in [Ca2+]i. ERK 2 siRNA also did not significantly affect Cch-stimulated increase in [Ca2+]i (Fig. 8A, D and E).

These results indicate that cholinergic agonist-stimulated increase in [Ca2+]i is not dependent on activation of ERK 1/2. Furthermore, activation of ERK 1/2 is more distal in the cholinergic agonist-dependent signaling pathway than the increase in [Ca2+]i (Fig. 9).

Fig. 9.

Fig. 9

Open in a new tab

Schematic diagram of the signal pathways used by EGF and cholinergic agonists to increase [Ca2+]i and secretion in cultured rat goblet Cells. MAchRs – muscarinic receptors; Gαq/11-α subunit of Gq/11 protein; PLCβ – phospholipase C β; InsP3 – inositiol trisphosphate; DAG – diacylglycerol; PKC – protein kinase C; MMP – matrix metalloproteinases; EGF – epidermal growth factor; EGFR – epidermal growth factor receptor; TK – tyrosine kinase; Shc, Grb2, and Sos – adaptor proteins; Ras – GTPase; Raf – mitogen activated protein kinase kinase kinase; MEK – mitogen activated protein kinase kinase; ERK 1/2 – extracellular regulated kinase 1/2 also known as mitogen activated protein kinase.

4. Discussion

In this study, we identified the signaling pathways used by the growth factor EGF and cholinergic agonists to stimulate mucin secretion from rat conjunctival goblet cells. EGF causes an increase in [Ca2+]i and activates ERK 1/2 to stimulate mucin secretion, similar to cholinergic agonists. In addition, cholinergic agonists transactivate the EGFR causing an increase in [Ca2+]i. Because the ERK 1/2 inhibitor U0126 and ERK 2 siRNA had no effect on [Ca2+]i, the increase in [Ca2+]i must be upstream of ERK 1/2 (Fig. 9). The increase in [Ca2+]i leads to activation ERK 1/2 followed by mucin secretion.

Most activators of conjunctival goblet cell mucin secretion identified have been neurotransmitters released from nerves upon stimulation. The present study demonstrates that the growth factor EGF can also stimulate mucin secretion. EGF is synthesized as a membrane bound glycosylated precursor (precursor EGF) which can be cleaved by MMPs resulting in the shedding the proEGF. ProEGF can be further cleaved to the mature 6 kDa form. This process is known as ectodomain shedding (Fig. 9). All forms of the EGF molecule (precursor, pro or mature) are biologically active and can bind to and activate EGF receptors on the same or neighboring cells. Growth factors such as EGF generally activate long term processes such as gene expression, cell differentiation, and proliferation. However, EGF has also been shown to stimulate short term processes such as protein secretion from the lacrimal gland (Chen et al., 2005), insulin secretion from pancreatic β cells (Lee et al., 2008), chloride secretion from a bronchial cell line (Jeulin et al., 2008), and glutamine transport in human enterocytes (Avissar et al., 2008).

EGF-stimulated secretion from goblet cells is dependent upon extracellular Ca2+ as removal of Ca2+ from the media significantly inhibited EGF-stimulated secretion. This suggests that EGF does not release Ca2+ from internal stores but rather activates channels in the plasma membrane to allow Ca2+ to enter the cell. Tajeddine and Gailly have demonstrated that the non-selective cation channel TRPC1 is activated by EGFR and plays a major role in EGF-stimulated cell proliferation (Tajeddine and Gailly, 2012). In these studies, depletion of TRPC1 also reduced the phosphorylation of ERK 1/2. It is not known if TRPC1 plays a role in mucin secretion from conjunctival goblet cells.

EGF plays an important role in the regulation of goblet cells from other tissues. In the rat trachea, EGF increased the number of goblet cells after challenge with ovalbumin or TNFα and the increase in cell number was prevented by EGF receptor inhibitors (Takeyama et al., 1999). Perrais et al have shown that EGF increased MUC5AC mRNA in a human pulmonary cell line (Perrais et al., 2002). Similar results have been obtained in intestine as EGF receptor activation increased goblet cell proliferation (Jarboe et al., 2005) and EGF treatment reduced intestinal permeability and increased goblet cell density and mucin production in a neonatal rat model of necrotizing entercolitis (Clark et al., 2006).

Previous studies demonstrated that EGF stimulated proliferation in cultured conjunctival goblet cells by activating and translocating ERK 1/2 from the cytoplasm to the nucleus. Activation and translocation of ERK 1/2 occurred with two peaks occurring 1 m and 18 h after EGF addition. As EGF stimulates secretion from conjunctival goblet cells with a peak at 1 h after addition of EGF the rapid, first peak of ERK 1/2 activity is likely to be used by EGF to stimulate goblet cell secretion.

Our earlier studies demonstrated that cholinergic agonists stimulate high molecular weight glycoconjugate secretion from pieces of rat conjunctiva. Results from the present study shows that cholinergic agonists can stimulate high molecular weight glycoconjugate secretion directly from conjunctival goblet cells in culture without the effects of other cell types present in the conjunctiva. These results also show that EGFR was activated in cultured goblet cells is also similar to goblet cells in the conjunctiva. In this study, we also show that EGF itself can stimulate goblet cell secretion.

In conjunctival pieces, cholinergic agonist-stimulated high molecular weight glyco-conjugate secretion was significantly reduced by pirenzipine, gallamine, and 4-DAMP antagonists selective for M1AchR, M2AchR, and M3AchR, respectively. In cultured goblet cells, when cholinergic agonist stimulated increase in [Ca2+]i was measured, only pirenzipine the compound that preferentially inhibits M1AchRs, significantly reduced cholinergic agonist-stimulated mucin secretion. While all three MAchRs are present in cultured goblet cells M2AchR and M3AchR were less effective. All three MAchRs are present both in cultured goblet cells as in goblet cells in conjunctival pieces. As cholinergic agonists use Ca2+i, PKC, transactivation of the EGFR, and ERK 1/2 to stimulate secretion, it is possible that M2AchR and M3AchR are more dependent upon PKC, transactivation of the EGFR, and ERK 1/2 than on Ca2+ to stimulate secretion, whereas M1AchR is more dependent upon [Ca2+]i.

Two methods were used to detect cholinergic agonist- and EGF-stimulated mucin secretion from rat goblet cells. The first method which has been used previously is an ELLA using the lectin UEA-1 which binds to specific carbohydrate groups present on the mucins and potentially other secretory proteins in goblet cells (Dartt et al., 2011; Kanno et al., 2003; Rios et al., 2008; Rios et al., 1999). The second method is an ELISA with a rat MUC5AC antibody. Both methods gave similar results though the ELISA appeared to be more sensitive. Thus, both methods can be used to measure mucin secretion from goblet cells. As our cell preparation is overwhelmingly goblet cells, the high molecular weight glycoconjugate secretion detected by the ELLA after stimulation is specifically from goblet cells. In addition our present results support our previous conclusion that high molecular weight glycoconjugate secretion includes mucin secretion and is an index for mucin secretion as EGF and cholinergic agonists stimulated MUC5AC secretion from cultured conjunctival goblet cells. That we measured agonist stimulated MUC5AC secretion from our cultured cells also provides confirmation that our cells in culture are a reliable model for conjunctival goblet cells in vivo.

Our earlier results demonstrated that cultured human conjunctival goblet cells behave similarly to cultured rat conjunctival goblet cells in many respects. EGF stimulates ERK 1/2 activity leading to cell proliferation in both rat and human goblet cells with a similar magnitude and similar time course (Horikawa et al., 2003). The cysteinyl leukotrienes also stimulate secretion in human goblet cells similar to that seen in rat goblet cells (Dartt et al., 2011). Thus it would be expected that cholinergic agonists transactivate the EGF receptor to increase [Ca2+]i, activate ERK 1/2, and stimulate mucin secretion in human cells similarly to rat goblet cells.

Interestingly both cholinergic agonists and EGF activate EGFRs. The EGFR has multiple phosphorylation sites which are used to recruit multiple adaptor proteins leading to the downstream effects. It is not known if transactivation of the EGFR by cholinergic agonists causes the phosphorylation of the same sites as those activated when EGF binds to its receptor in the absence of cholinergic agonists perhaps because cholinergic agonists release TGFα or HB-EGF, rather than EGF, by ectodomain shedding.

5. Conclusions

In conclusion, EGF acting through its receptor increased [Ca2+]i and ERK 1/2 activated leading to an increase in mucin secretion in cultured goblet cells. This secretion is dependent on Ca2+o. In addition, conjunctival goblet cells in culture express MAchRs whose activation leads to in an increase in [Ca2+]i.

Acknowledgment

This study was funded by NIH EY019470.

References

  1. Aragona P, Romeo GF, Puzzolo D, Micali A, Ferreri G. Impression cytology of the conjunctival epithelium in patients with vernal conjunctivitis. Eye (Lond) 1996;10(Pt 1):82–85. doi: 10.1038/eye.1996.12. [DOI] [PubMed] [Google Scholar]
  2. Avissar NE, Sax HC, Toia L. In human entrocytes, GLN transport and ASCT2 surface expression induced by short-term EGF are MAPK, PI3K, and Rho-dependent. Dig. Dis. Sci. 2008;53(8):2113–2125. doi: 10.1007/s10620-007-0120-y. [DOI] [PubMed] [Google Scholar]
  3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  4. Carpenter G. The EGF receptor: a nexus for trafficking and signaling. Bioessays. 2000;22(8):697–707. doi: 10.1002/1521-1878(200008)22:8<697::AID-BIES3>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
  5. Chen L, Hodges RR, Funaki C, Zoukhri D, Gaivin RJ, Perez DM, Dartt DA. Effects of alpha1D-adrenergic receptors on shedding of biologically active EGF in freshly isolated lacrimal gland epithelial cells. Am. J. Physiol. Cell. Physiol. 2006;291(5):C946–C956. doi: 10.1152/ajpcell.00014.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen L, Johansson JK, Hodges RR, Zoukhri D, Ghinelli E, Rios JD, Dartt DA. Differential effects of the EGF family of growth factors on protein secretion, MAPK activation, and intracellular calcium concentration in rat lacrimal gland. Exp. Eye Res. 2005;80(3):379–389. doi: 10.1016/j.exer.2004.10.006. [DOI] [PubMed] [Google Scholar]
  7. Clark JA, Doelle SM, Halpern MD, Saunders TA, Holubec H, Dvorak K, Boitano SA, Dvorak B. Intestinal barrier failure during experimental necrotizing enterocolitis: protective effect of EGF treatment. Am. J. Physiol. Gastrointest. Liver Physiol. 2006;291(5):G938–G949. doi: 10.1152/ajpgi.00090.2006. [DOI] [PubMed] [Google Scholar]
  8. Dartt DA, Hodges RR, Li D, Shatos MA, Lashkari K, Serhan CN. Conjunctival goblet cell secretion stimulated by leukotrienes is reduced by resolvins D1 and E1 to promote resolution of inflammation. J. Immunol. 2011;186(7):4455–4466. doi: 10.4049/jimmunol.1000833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dartt DA, Rios JD, Kanno H, Rawe IM, Zieske JD, Ralda N, Hodges RR, Zoukhri D. Regulation of conjunctival goblet cell secretion by Ca(2+) and protein kinase C. Exp. Eye Res. 2000;71(6):619–628. doi: 10.1006/exer.2000.0915. [DOI] [PubMed] [Google Scholar]
  10. Diebold Y, Rios JD, Hodges RR, Rawe I, Dartt DA. Presence of nerves and their receptors in mouse and human conjunctival goblet cells. Invest. Ophthalmol. Vis. Sci. 2001;42(10):2270–2282. [PubMed] [Google Scholar]
  11. Dogru M, Okada N, Asano-Kato N, Tanaka M, Igarashi A, Takano Y, Fukagawa K, Shimazaki J, Tsubota K, Fujishima H. Atopic ocular surface disease: implications on tear function and ocular surface mucins. Cornea. 2005;24(8 Suppl.):S18–S23. doi: 10.1097/01.ico.0000178741.14212.53. [DOI] [PubMed] [Google Scholar]
  12. Franken C, Trankle C, Mohr K. Testing the specificity of allosteric modulators of muscarinic receptors in phylogenetically closely related histamine H1-receptors. Naunyn. Schmiedebergs. Arch. Pharmacol. 2000;361(2):107–112. doi: 10.1007/s002109900176. [DOI] [PubMed] [Google Scholar]
  13. Govindarajan B, Gipson IK. Membrane-tethered mucins have multiple functions on the ocular surface. Exp. Eye Res. 2010;90(6):655–663. doi: 10.1016/j.exer.2010.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gu J, Chen L, Shatos MA, Rios JD, Gulati A, Hodges RR, Dartt DA. Presence of EGF growth factor ligands and their effects on cultured rat conjunctival goblet cell proliferation. Exp. Eye Res. 2008;86(2):322–334. doi: 10.1016/j.exer.2007.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hammer R, Berrie CP, Birdsall NJ, Burgen AS, Hulme EC. Pirenzepine distinguishes between different subclasses of muscarinic receptors. Nature. 1980;283(5742):90–92. doi: 10.1038/283090a0. [DOI] [PubMed] [Google Scholar]
  16. Horikawa Y, Shatos MA, Hodges RR, Zoukhri D, Rios JD, Chang EL, Bernardino CR, Rubin PA, Dartt DA. Activation of mitogen-activated protein kinase by cholinergic agonists and EGF in human compared with rat cultured conjunctival goblet cells. Invest. Ophthalmol. Vis. Sci. 2003;44(6):2535–2544. doi: 10.1167/iovs.02-1117. [DOI] [PubMed] [Google Scholar]
  17. Jarboe MD, Juno RJ, Stehr W, Bernal NP, Profitt S, Erwin CR, Warner BW. Epidermal growth factor receptor signaling regulates goblet cell production after small bowel resection. J. Pediatr. Surg. 2005;40(1):92–97. doi: 10.1016/j.jpedsurg.2004.09.009. [DOI] [PubMed] [Google Scholar]
  18. Jeulin C, Seltzer V, Bailbe D, Andreau K, Marano F. EGF mediates calcium-activated chloride channel activation in the human bronchial epithelial cell line 16HBE14o-: involvement of tyrosine kinase p60c-src. Am. J. Physiol. Lung Cell. Mol. Physiol. 2008;295(3):L489–L496. doi: 10.1152/ajplung.90282.2008. [DOI] [PubMed] [Google Scholar]
  19. Kalmes A, Daum G, Clowes AW. EGFR transactivation in the regulation of SMC function. Ann. N. Y. Acad. Sci. 2001;947:42–54. doi: 10.1111/j.1749-6632.2001.tb03929.x. Discussion 54-45. [DOI] [PubMed] [Google Scholar]
  20. Kanno H, Horikawa Y, Hodges RR, Zoukhri D, Shatos MA, Rios JD, Dartt DA. Cholinergic agonists transactivate EGFR and stimulate MAPK to induce goblet cell secretion. Am. J. Physiol. Cell. Physiol. 2003;284(4):C988–C998. doi: 10.1152/ajpcell.00582.2001. [DOI] [PubMed] [Google Scholar]
  21. Karmouty-Quintana H, Cannet C, Sugar R, Fozard JR, Page CP, Beckmann N. Capsaicin-induced mucus secretion in rat airways assessed in vivo and non-invasively by magnetic resonance imaging. Br. J. Pharmacol. 2007;150(8):1022–1030. doi: 10.1038/sj.bjp.0707168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lee HM, Malm L, Dabbagh K, Dao-Pick T, Ueki IF, Kim S, Shim JJ, Nadel JA. Epidermal growth factor receptor signaling mediates regranulation of rat nasal goblet cells. J. Allergy Clin. Immunol. 2001;107(6):1046–1050. doi: 10.1067/mai.2001.115140. [DOI] [PubMed] [Google Scholar]
  23. Lee HY, Yea K, Kim J, Lee BD, Chae YC, Kim HS, Lee DW, Kim SH, Cho JH, Jin CJ, Koh DS, Park KS, Suh PG, Ryu SH. Epidermal growth factor increases insulin secretion and lowers blood glucose in diabetic mice. J. Cell. Mol. Med. 2008;12(5A):1593–1604. doi: 10.1111/j.1582-4934.2007.00169.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mantelli F, Argueso P. Functions of ocular surface mucins in health and disease. Curr. Opin. Allergy Clin. Immunol. 2008;8(5):477–483. doi: 10.1097/ACI.0b013e32830e6b04. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Neutra MR, Phillips TL, Phillips TE. Regulation of intestinal goblet cells in situ, in mucosal explants and in the isolated epithelium. Ciba. Found. Symp. 1984;109:20–39. doi: 10.1002/9780470720905.ch3. [DOI] [PubMed] [Google Scholar]
  26. Ohtsu H, Dempsey PJ, Eguchi S. ADAMs as mediators of EGF receptor transactivation by G protein-coupled receptors. Am. J. Physiol. Cell. Physiol. 2006a;291(1):C1–C10. doi: 10.1152/ajpcell.00620.2005. [DOI] [PubMed] [Google Scholar]
  27. Ohtsu H, Dempsey PJ, Frank GD, Brailoiu E, Higuchi S, Suzuki H, Nakashima H, Eguchi K, Eguchi S. ADAM17 mediates epidermal growth factor receptor transactivation and vascular smooth muscle cell hypertrophy induced by angiotensin II. Arterioscler. Thromb. Vasc. Biol. 2006b;26(9):e133–e137. doi: 10.1161/01.ATV.0000236203.90331.d0. [DOI] [PubMed] [Google Scholar]
  28. Perrais M, Pigny P, Copin MC, Aubert JP, Van Seuningen I. Induction of MUC2 and MUC5AC mucins by factors of the epidermal growth factor (EGF) family is mediated by EGF receptor/Ras/Raf/extracellular signal-regulated kinase cascade and Sp1. J. Biol. Chem. 2002;277(35):32258–32267. doi: 10.1074/jbc.M204862200. [DOI] [PubMed] [Google Scholar]
  29. Ramos JW. The regulation of extracellular signal-regulated kinase (ERK) in mammalian cells. Int. J. Biochem. Cell. Biol. 2008;40(12):2707–2719. doi: 10.1016/j.biocel.2008.04.009. [DOI] [PubMed] [Google Scholar]
  30. Rios JD, Shatos MA, Urashima H, Dartt DA. Effect of OPC-12759 on EGF receptor activation, p44/p42 MAPK activity, and secretion in conjunctival goblet cells. Exp. Eye Res. 2008;86(4):629–636. doi: 10.1016/j.exer.2008.01.007. [DOI] [PubMed] [Google Scholar]
  31. Rios JD, Zoukhri D, Rawe IM, Hodges RR, Zieske JD, Dartt DA. Immunolocalization of muscarinic and VIP receptor subtypes and their role in stimulating goblet cell secretion. Invest. Ophthalmol. Vis. Sci. 1999;40(6):1102–1111. [PubMed] [Google Scholar]
  32. Rogers DF. Motor control of airway goblet cells and glands. Respir. Physiol. 2001;125(1–2):129–144. doi: 10.1016/s0034-5687(00)00209-7. [DOI] [PubMed] [Google Scholar]
  33. Rozengurt E. Mitogenic signaling pathways induced by G protein-coupled receptors. J. Cell. Physiol. 2007;213(3):589–602. doi: 10.1002/jcp.21246. [DOI] [PubMed] [Google Scholar]
  34. Rubin BK. Physiology of airway mucus clearance. Respir. Care. 2002;47(7):761–768. [PubMed] [Google Scholar]
  35. Sharif NA, To ZP, Wong KH, Delmendo RE, Whiting RL, Eglen RM. M3 muscarinic receptors on murine HSDM1C1 cells: further functional, regulatory, and receptor binding studies. Neurochem. Res. 1995;20(1):61–68. doi: 10.1007/BF00995154. [DOI] [PubMed] [Google Scholar]
  36. Shatos MA, Gu J, Hodges RR, Lashkari K, Dartt DA. ERK/p44p42 mitogen-activated protein kinase mediates EGF-stimulated proliferation of conjunctival goblet cells in culture. Invest. Ophthalmol. Vis. Sci. 2008;49(8):3351–3359. doi: 10.1167/iovs.08-1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shatos MA, Hodges RR, Bair JA, Lashkari K, Dartt DA. Stimulatory role of PKCalpha in extracellular regulated kinase 1/2 pathway in conjunctival goblet cell proliferation. Invest. Ophthalmol. Vis. Sci. 2009a;50(4):1619–1625. doi: 10.1167/iovs.08-2930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shatos MA, Hodges RR, Oshi Y, Bair JA, Zoukhri D, Kublin C, Lashkari K, Dartt DA. Role of cPKCalpha and nPKCepsilon in EGF-stimulated goblet cell proliferation. Invest. Ophthalmol. Vis. Sci. 2009b;50(2):614–620. doi: 10.1167/iovs.08-2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shatos MA, Rios JD, Horikawa Y, Hodges RR, Chang EL, Bernardino CR, Rubin PA, Dartt DA. Isolation and characterization of cultured human conjunctival goblet cells. Invest. Ophthalmol. Vis. Sci. 2003;44(6):2477–2486. doi: 10.1167/iovs.02-0550. [DOI] [PubMed] [Google Scholar]
  40. Shatos MA, Rios JD, Tepavcevic V, Kano H, Hodges R, Dartt DA. Isolation, characterization, and propagation of rat conjunctival goblet cells in vitro. Invest. Ophthalmol. Vis. Sci. 2001;42(7):1455–1464. [PubMed] [Google Scholar]
  41. Tajeddine N, Gailly P. TRPC1 protein channel is major regulator of epidermal growth factor receptor signaling. J. Biol. Chem. 2012;287(20):16146–16157. doi: 10.1074/jbc.M112.340034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Takeyama K, Dabbagh K, Lee HM, Agusti C, Lausier JA, Ueki IF, Grattan KM, Nadel JA. Epidermal growth factor system regulates mucin production in airways. Proc. Natl. Acad. Sci. U S A. 1999;96(6):3081–3086. doi: 10.1073/pnas.96.6.3081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Walters MN. Goblet-cell metaplasia in ductules and acini of the exocrine pancreas. J. Pathol. Bacteriol. 1965;89:569–572. doi: 10.1002/path.1700890215. [DOI] [PubMed] [Google Scholar]

RESOURCES