Skip to main content
PLOS One logoLink to PLOS One
. 2013 Mar 12;8(3):e57967. doi: 10.1371/journal.pone.0057967

Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

Dhruva K Mishra 1, Yanyuan Wu 1,2,3, Marianna Sarkissyan 1, Suren Sarkissyan 1, Zujian Chen 1, Xiying Shang 1, May Ong 1, David Heber 2,3, H Phillip Koeffler 4,5, Jaydutt V Vadgama 1,2,3,*
Editor: Ming Tat Ling6
PMCID: PMC3595235  PMID: 23554871

Abstract

Background

Vitamin D plays a role in cancer development and acts through the vitamin D receptor (VDR). Although African-Americans have the lowest levels of serum vitamin D, there is a dearth of information on VDR gene polymorphisms and breast cancer among African-Americans and Hispanics. This study examines whether VDR gene polymorphisms are associated with breast cancer in these cohorts.

Methods

Blood was collected from 232 breast cancer patients (Cases) and 349 non-cancer subjects (Controls). Genotyping for four polymorphic variants of VDR (FokI, BsmI, TaqI and ApaI) was performed using the PCR-RFLP method.

Results

An increased association of the VDR-Fok1 f allele with breast cancer was observed in African-Americans (OR = 1.9, p = 0.07). Furthermore, the FbTA, FbtA and fbtA haplotypes were associated with breast cancer among African-Americans (p<0.05). Latinas were more likely to have the VDR-ApaI alleles (Aa or aa) (p = 0.008). The VDR-ApaI aa genotype was significantly associated with poorly-differentiated breast tumors (p = 0.04) in combined Cases. Kaplan-Meier survival analysis showed decreased 5-year disease-free-survival (DFS) in breast cancer patients who had the VDR-Fok1 FF genotype (p<0.05). The Cox regression with multivariate analysis revealed the independent predictor value of the VDR-FokI polymorphism for DFS. The other three variants of VDR (BsmI, TaqI and ApaI) were not associated with disease outcome.

Conclusions

VDR haplotypes are associated with breast cancer in African-Americans, but not in Hispanic/Latinas. The VDR-FokI FF genotype is linked with poor prognosis in African-American women with breast cancer.

Introduction

Several studies have demonstrated a decrease in Vitamin D receptor (VDR) expression in breast cancer cells compared to normal breast cells [1]. Decreased levels of VDR in breast cancer cells could be due to VDR gene polymorphisms [2], and/or DNA methylation [3]–[5]. Alterations in VDR expression and activity could lead to deregulation of Vitamin D uptake, metabolism, and serum levels of biologically active Vitamin D.

VDR gene has multiple gene polymorphisms [6], and four important single nucleotide polymorphisms (SNPs) in exon 2 and 3′UTR region. These are VDR-FokI (rs2228570), VDR-BsmI (rs1544410), VDR-TaqI (rs731236) and VDR-ApaI (rs7975232). Functional studies have identified that the VDR-FokI polymorphism leads to a shorter VDR protein by altering a translation initiation site [7], [8]. Large meta-analyses have demonstrated a significant association of the VDR FokI polymorphisms with breast cancer [9], [10], and other cancers across multiple ethnic cohorts [11], [12]. The functional role of VDR-BSMI, VDR-TaqI, and VDR-ApaI, which are all located near the 3′UTR region, are not as clear. However, studies do suggest that these polymorphisms may alter the polyadenylation of the VDR mRNA transcript, and thus affect mRNA stability [13]. Several studies show contradictory results on these polymorphisms and risk for breast cancer. Some studies found an association of breast cancer with BsmI, TaqI and ApaI [14]–[18] polymorphisms while others found no associations [19]–[21].

We have examined four VDR polymorphisms (FokI, TaqI, BsmI, ApaI) in African-American and Hispanic women from South Los Angeles and their association with breast cancer risk and survival.

Materials and Methods

Ethics Statement

This study, including the consent protocol, was approved by the Charles R. Drew University of Science and Medicine Institutional Review Board (Approval # 00-06-041-13). Written informed consent was obtained from all participants.

Study Population

This is a retrospective cohort hospital-based study. Subjects were selected from our current breast study database in the Division of Cancer Research and Training, at Charles R. Drew University of Medicine and Science. We selected 232 women with breast cancer as Cases (115 African-Americans and 117 Hispanic/Latinas), and 349 normal, healthy women as Controls (73 African-Americans and 276 Latinas). Subjects were recruited between 1995 and 2007, and had documented personal history, clinical history, and tumor pathology data.

VDR polymorphisms

Genomic DNA was extracted from buffy coat samples using the Qiagen DNA extraction kit. Vitamin D receptor genotyping for all four single-nucleotide polymorphic sites (SNPs) was done by the PCR-RFLP method (polymerase chain reaction- restriction fragment length polymorphism analysis). We used the following flanking primers [16], [21]. The BsmI polymorphism was detected using one primer originating in exon 7 (Forward: 5′-CAACCAAGACTACAAGTACCGCGTCAGTGA-3′) and a second in intron 8 (Reverse: 5′-AACCAGCGGAAGAGGTCAAGGG-3′), amplifying an 823 base pair (bp) fragment spanning the BsmI site. The ApaI and TaqI polymorphisms were detected using one primer in intron 8 (Forward: 5′- AGAGCATGGACAGGGAGCAAG- 3′) and the other in exon 9 (Reverse: 5′-GCAACTCCTCATGGCTGAGGTCTCA- 3′), yielding a 745 bp fragment spanning the ApaI and TaqI site. VDR-FokI polymorphic site was amplified using following primers Forward -5′GATGCCAGCTGGCCCTGGCACTG3′ and Reverse – 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′. PCR conditions were as follows: denaturation at 94°C for 5 min, followed by 40 cycles of PCR at 94°C (30 sec), 60°C–63.5°C (30 sec), and 72°C (30 sec). Annealing temperature for BsmI, ApaI/TaqI and FokI PCR are 63.5°C, 61°C and 59.5°C, respectively. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel. Genotypes were assigned as BB, Bb, bb for the BsmI polymorphisms, AA, Aa, aa for the ApaI polymorphisms, TT, Tt and tt for the TaqI polymorphisms and FF, Ff and ff for the VDR-FokI polymorphisms. For the BsmI cleaved PCR products, the single resultant fragment was 823 bp, whereas the two resultant fragments were 648 bp and 175 bp. The PCR products digested with TaqI enzyme resulted in fragments of 496 bp and 249 bp in the presence of the polymorphic cutting site. PCR products digested with ApaI enzyme result in fragments of 531 bp and 214 bp in the presence of the polymorphic cutting site. The PCR products of VDR-FokI polymorphism (273 bp) digested with FokI enzyme result in 198 bp and 75 bp products in the presence of restriction site.

Statistical Analysis

We used SPSS (ver 11.5) software to analyze our data. The Pearson Chi-square test was used to determine the statistically significant differences in frequency distribution of VDR genotypes between Cases and Controls. If the Table had cells with a frequency less than 5, Fisher's exact test was utilized. The 2-sided exact p-value<0.05 was considered statistically significant. The deviation of distribution of VDR genotypes from Hardy-Weinberg equilibrium (HWE) was estimated using the web tool HWE Testing calculator, available online [22]. Associations between each VDR polymorphism and breast cancer was estimated using the Logistic Regression test at 95% confidence interval, and controlled for age and BMI. For each polymorphic site, the wild type genotype (FF, BB, AA, TT) was considered as the reference based on published literature. We also performed analysis of linkage disequilibrium (LD) between polymorphic sites in a locus, to identify “clusters” of highly correlated sites based on LD statistics. We calculated the haplotype frequencies and LD in Cases and Controls using the Haplotype software package available online [23], [24].

Results

Table 1 shows the characteristics of subjects in the study. The mean age of African-American Cases and Controls is 52.9 and 50.7 years, respectively, and for Hispanic/Latinas Cases and Controls is 49.2 and 45.6 years, respectively. The mean BMI is >30 kg/m∧2. Among Cases, the distribution of histopathological characteristics between African-American and Hispanic women with breast cancer was similar (Table 1), and approximately ∼59.9% Cases had Stage I/II disease and 26.7% had Stage III/V disease. The majority of our patients had infiltrating ductal carcinoma (62.2%), moderately to poorly differentiated (>70%).

Table 1. Characteristics of Breast Cancer Cases and Controls.

Subject Characteristics African-American Latina P-Value*
(N = 188) (N = 393)
Mean Age±SD (Range)
Cases 53±9 49±11 0.006
Controls 51±10 46±10 0.001
P-Value** 0.13 0.003
Mean BMI±SD (Range)
Cases 34±9 32±7 0.01
Controls 35±8 31±6 <0.001
P-Value** 0.74 0.19
Cases Only (N = 232) N (%) N (%)
ER/PR Status
ER/PR+ 60 (52) 54 (46) 0.24
ER/PR- 42 (37) 43 (37)
Unknown 13 (11) 20 (17)
HER2 Status
3+ 16 (14) 22 (19) 0.64
2+ 12 (10) 14 (12)
1+ 27 (24) 21 (18)
Negative 40 (35) 35 (30)
Unknown 20 (17) 25 (21)
Histology
Infiltrating Ductal Carcinoma 72 (63) 72 (62) 0.77
Infiltrating Lobular Carcinoma 20 (17) 15 (13)
Infiltrating Adenocarcinoma 4 (4) 2 (2)
Infiltrating Intraductal Carcinoma 0 (0) 1 (1)
Ductal 0 (0) 1 (1)
Lobular 2 (2) 2 (2)
Unknown 17 (15) 24 (2)
Differentiation
Well 10 (9) 6 (5) 0.23
Moderately 33 (29) 30 (26)
Poorly 55 (48) 55 (47)
Unknown 17 (15) 26 (22)
Stage
0 7 (6) 8 (7) 0.05
I 23 (20) 8 (7)
II 46 (40) 47 (40)
III 22 (19) 29 (25)
IV 4 (4) 7 (6)
Unknown 13 (11) 18 (15)
*

P-value<0.05 is significant.

**

P-value assesses significance within the column. (P<0.05 is significant).

The VDR gene polymorphisms were genotyped in 188 African-American and 393 Hispanics/Latina women. No deviation was observed from Hardy-Weinberg equilibrium (HWE) in the genotypic distribution of the VDR-FokI, VDR-BsmI and VDR-ApaI polymorphisms in the study subjects. However, the VDR-TaqI distribution was not within HWE. Further analysis identified that the deviation of VDR-TaqI was contributed from Cases (p allele = 0.75, q allele = 0.25, χ2 = 13.52), but not from Controls (p allele = 0.79, q allele = 0.21, χ2 = 2.34) – data not shown.

Logistic regression analysis was also performed (adjusted for age and BMI) and showed no significant association of breast cancer with any of the VDR polymorphisms when all of the Cases were pooled together (Table 2). However, when the analysis was performed based on ethnic stratification of the African-American and Hispanic/Latina subjects, the VDR-FokI Ff genotype (OR = 2.2, 95% CI = 0.95-5.1, p = 0.06) and the f allele (OR = 1.9, 95% CI = 0.9-3.7, p = 0.07) showed an increased association with breast cancer among African-American subjects (Table 2) compared with the Hispanic/Latina subjects. In the Hispanic/Latina population, we found no significant difference in the frequency distribution of the VDR genotypes between Cases and Controls, and no association with any of the genotypes with breast cancer based on logistic regression analysis (Table 2).

Table 2. Distribution of VDR-FokI, VDR-BsmI, VDR-TaqI and VDR-ApaI genotypes in African-American and Hispanic/Latina Cases and Controls.

All Subjects† African-American Subjects†† Hispanic/Latina Subjects††
Control N (%) Case N (%) OR at 95% CI * P-value Control N (%) Case N (%) OR at 95% CI * P-value Control N (%) Case N (%) OR at 95% CI * P-value
N = 73 N = 115 N = 73 N = 115 N = 276 N = 117
VDR-FokI
FF 148 (42) 95 (41) 1.0 38 (52) 53 (46) 1.0 110 (40) 42 (36) 1.0
Ff 144 (41) 110 (47) 1.3 (0.8–2.1) 0.26 30 (41) 55 (48) 2.2 (0.95–5.1) 0.06 114 (41) 55 (47) 1.0 (0.5–1.8) 0.98
ff 57 (16) 27 (12) 1.3 (0.7–2.6) 0.43 5 (7) 7 (6) 2.9 (0.3–26.3) 0.33 52 (19) 20 (17) 1.0 (0.5–2.2) 0.91
F allele 440 (63) 300 (64) 1.0 106 (73) 161 (70) 1.0 334 (61) 139 (59) 1.0
f allele 258 (37) 164 (35) 1.2 (0.9–1.7) 0.29 40 (27) 69 (30) 1.9 (0.9–3.7) 0.07 218 (40) 95 (41) 1.0 (0.7–1.5) 0.92
VDR-BsmI
BB 26 (7) 19 (8) 1.0 8 (11) 9 (8) 1.0 18 (7) 10 (9) 1.0
Bb 141 (40) 90 (39) 0.8 (0.3–1.9) 0.57 31 (43) 40 (35) 0.7 (0.1–3.6) 0.63 110 (40) 50 (43) 0.9 (0.3–2.4) 0.76
bb 182 (52) 123 (53) 0.9 (0.3–1.9) 0.59 34 (47) 66 (57) 1.4 (0.3–7.9) 0.68 148 (54) 57 (49) 0.6 (0.2–1.7) 0.34
B allele 193 (28) 128 (28) 1.0 47 (32) 58 (25) 1.0 146 (26) 70 (30) 1.0
b allele 505 (72) 336 (72) 0.9 (0.7–1.3) 0.76 99 (68) 172 (75) 1.6 (0.9–2.9) 0.15 406 (74) 164 (70) 0.75 (0.5–1.1) 0.19
VDR-TaqI
TT 223 (64) 141 (61) 1.0 40 (55) 66 (57) 1.0 183 (66) 75 (64) 1.0
Tt 106 (30) 66 (28) 0.8 (0.5–1.3) 0.31 28 (38) 35 (30) 0.6 (0.3–1.4) 0.24 78 (28) 31 (27) 0.9 (0.5–1.6) 0.66
tt 20 (6) 25 (11) 1.3 (0.5–3.0) 0.58 5 (7) 14 (12) 1.1 (0.3–4.4) 0.91 15 (5) 11 (9) 1.4 (0.5–4.0) 0.59
T allele 552 (79) 348 (75) 1.0 108 (74) 167 (73) 1.0 444 (80) 181 (77) 1.0
t allele 146 (21) 116 (25) 0.9 (0.7–1.4) 0.85 38 (26) 63 (27) 0.8 (0.5–1.6) 0.60 108 (20) 53 (23) 1.0 (0.6–1.6) 0.91
VDR-ApaI
AA 110 (32) 82 (35) 1.0 28 (38) 49 (43) 1.0 82 (29) 33 (28) 1.0
Aa 185 (53) 115 (50) 1.0 (0.6–1.7) 0.88 33 (45) 54 (47) 0.8 (0.3–1.8) 0.51 152 (55) 61 (52) 1.3 (0.7–2.4) 0.49
aa 54 (16) 35 (15) 1.1 (0.5–2.1) 0.88 12 (16) 12 (10) 0.6 (0.2–2.2) 0.45 42 (15) 23 (20) 1.3 (0.6–3.0) 0.47
A allele 405 (58) 279 (60) 1.0 89 (61) 152 (66) 1.0 316 (57) 127 (54) 1.0
a allele 293 (42) 185 (40) 1.0 (0.7–1.4) 0.88 57 (39) 78 (34) 0.8 (0.4–1.4) 0.42 236 (43) 107 (46) 1.2 (0.8–1.7) 0.47

Note: For analysis of alleles F and f, B and b, T and t, A and a, each subject was used twice. F- wild type FokI, f- polymorphic FokI; B- wild type BsmI, b-polymorphic BsmI; T- wild type TaqI, t- polymorphic TaqI; A- wild type ApaI, a- polymorphic ApaI.

*

P-value is significant if P<0.05;

†

Analysis adjusted for age, BMI and ethnicity;

††

Analysis adjusted for age and BMI.

Haplotype analysis of the polymorphic variants produced 16 different haplotypes (Table 3). The FBTA (FokI-F, BsmI-B, TaqI-T and ApaI-A) was the most common haplotype in Controls and Hispanic/Latina Cases (Table 3). The most common haplotype in African-American Cases was the FbTA haplotype (FokI-F, BsmI-b, TaqI-T and ApaI-A). Several VDR-haplotypes were significantly associated with breast cancer in the African-American cohort, however, no association was observed between breast cancer and VDR-haplotypes in the Hispanic/Latina cohort. Logistic regression analysis, using wild-type alleles (FBTA) as the reference category, revealed that FbTA was 1.9 times higher (p = 0.02), FbtA was 1.6 times higher (p = 0.03) and fbtA was 1.4 times higher (p = 0.05) in Cases than in Controls in the African-American cohort (Table 3). Logistic regression analysis performed in Cases showed that African-American women with breast cancer were more likely to have the FbTA (OR = 2.4, p = 0.005) and FbtA (OR = 1.7, p = 0.04) haplotypes compared with Hispanic/Latina women with breast cancer. In contrast to Cases, African-American Controls with the fbTa (OR = 0.8, p<0.001), fbTA (OR = 0.8, p = 0.03), fBTA (OR = 0.8, p = 0.04) and fbtA (OR = 0.7, p = 0.02) haplotypes were significantly less frequently observed than among Hispanic/Latina Controls.

Table 3. VDR haplotypes, Breast Cancer, and Ethnicity.

Association of VDR haplotypes and breast cancer in African-American and Hispanic/Latina women
African-American Hispanic/Latina
VDR Haplotypes Nucleo-tides Frequencies (%) Odds Ratio Frequencies (%) Odds Ratio
Cases Controls OR∧ (95% CI) P Cases Controls OR∧ (95% CI) P
FBTA TGTC 17.0 25.4 1 19.5 16.7 1
FbTA TATC 26.3 20.6 1.9 (1.1–3.3) 0.02 12.4 15.6 0.7 (0.4–1.2) 0.20
FbTa TATA 7.1 13.4 0.9 (0.8–1.1) 0.53 14.6 11.4 1.0 (0.9–1.1) 0.76
fbTa CATA 12.1 5.8 1.1 (1.0–1.2) 0.002 16.8 16.4 0.9 (0.9–1.0) 0.65
fbTA CATC 5.8 5.2 1.1 (0.9–1.4) 0.22 8.0 7.4 0.9 (0.8–1.2) 0.82
FbtA TACC 7.6 4.5 1.6 (1.1–2.4) 0.03 3.1 2.9 0.9 (0.6–1.6) 0.86
FBTa TGTA 1.8 2.1 1.0 (0.9–1.2) 0.70 2.2 2.7 0.9 (0.8–1.1) 0.57
fBTA CGTC 1.8 2.1 1.0 (0.8–1.2) 0.70 2.2 4.0 0.9 (0.8–1.1) 0.18
fBTa CGTA 0.9 0.7 1.0 (0.9–1.2) 0.51 0.9 1.6 0.9 (0.8–1.1) 0.38
fbtA CACC 4.5 2.4 1.4 (1.1–1.9) 0.05 5.8 4.8 1.0 (0.8–1.3) 0.94
FBtA TGCC 3.1 4.8 1.0 (0.8–1.2) 0.96 3.1 2.9 0.9 (0.8–1.2) 0.86
Fbta TACA 6.3 4.8 1.1 (0.9–1.1) 0.12 3.1 4.8 0.9 (0.8–1.0) 0.23
fBta CGCA 0.0 1.7 - 0.9 0.3 1.1 (0.9–1.3) 0.40
fBtA CGCC 0.0 1.7 - 0.4 1.1 0.8 (0.7–1.2) 0.37
FBta TGCA 0.4 0.0 - 1.3 0.0 -
fbta CACA 5.4 4.8 1.0 (0.9–1.1) 0.25 5.8 7.4 0.9 (0.9–1.0) 0.29
∧

Cases vs. Controls, Significance is P<0.05;

*

African-American vs. Hispanic/Latina ethnicity, Significance is P<0.05.

Table 4 demonstrates the results from linkage disequilibrium (LD) analysis performed on the four VDR variants. The strongest LD is observed between VDR-TaqI and VDR-ApaI among Hispanic/Latina subjects (D′ = 0.66). Weaker LDs were observed between VDR-FokI and the other 3 variants (VDR-BsmI, VDR-ApaI and, VDR-TaqI) in both African-American and Hispanic/Latinas.

Table 4. Linkage disequilibrium (LD) between VDR polymorphisms in African-American and Hispanic/Latina women.

Locus 1 Locus 2 D′ (CI) LOD r2
African-American VDRF VDRB 0.09 (0.00–0.04) 0.06 0.001
VDRF VDRA 0.14 (0.02–0.29) 0.56 0.01
VDRF VDRT 0.17 (0.00–0.44) 0.21 0.004
VDRB VDRA 0.09 (0.00–0.37) 0.07 0.002
VDRB VDRT 0.16 (0.03–0.28) 1.01 0.02
VDRA VDRT 0.32 (0.07–0.53) 0.94 0.02
Hispanic/Latina VDRF VDRB 0.12 (0.00–0.30) 0.27 0.003
VDRF VDRA 0.08 (0.00–0.18) 0.58 0.006
VDRF VDRT 0.14 (0.01–0.30) 0.30 0.003
VDRB VDRA 0.25 (0.08–0.40) 1.48 0.02
VDRB VDRT 0.38 (0.27–0.48) 7.80 0.10
VDRA VDRT 0.66 (0.49–0.77) 8.44 0.09

Note: All samples were in Hardy-Weinberg Equilibrium (HWE) among the groups. LD was calculated between markers among African-Americans or Hispanics/Latinas. D′ is the prime between the loci; LOD is the log of likelihood odds ratio, a measure of confidence in the D'value; r2 is the correlation coefficient between the two loci.

The associations between the VDR genotypes and breast tumor histopathology, tumor stage, and metastatic disease progression were assessed in Table 5. The VDR-FokI FF genotype was significantly more common in African-American patients than in Hispanic/Latina patients (46.1% vs. 35.9%, respectively, p = 0.02), while the VDR-FokI ff genotype was more common in Hispanic/Latina patients as compared to African-American patients (17.1% vs. 6.1%, respectively). African-American patients were more likely to have VDR-ApaI AA genotype and Hispanic/Latina patients were likely to have VDR-ApaI Aa or aa genotypes (p = 0.008). There was also a significant association identified between VDR-ApaI polymorphisms and tumor differentiation (p = 0.04). Poorly differentiated tumors were more likely to express a polymorphic allele of VDR-ApaI (Aa or aa). There were no other significant associations found between any of the polymorphic VDR variants and tumor stage, tumor differentiation, and ER/PR/HER2 receptor status.

Table 5. Association of VDR genotypes with Tumor Pathology and Ethnicity.

VDR-FokI VDR-BsmI VDR-TaqI VDR-ApaI
FF Ff ff BB Bb bb TT Tt tt AA Aa aa
Ethnicity
AA 46% 48% 6% 8% 35% 57% 57% 30% 12% 43% 47% 10%
Latina 36% 47% 17% 9% 43% 49% 64% 27% 9% 28% 52% 20%
p = 0.02 p = n.s. p = n.s. p = 0.008
ER/PR Status
ER/PR+ve 42% 47% 11% 8% 41% 51% 59% 29% 12% 36% 49% 15%
ER/PR -ve 42% 46% 12% 6% 39% 55% 62% 25% 13% 35% 51% 14%
p = n.s. p = n.s. p = n.s. p = n.s.
HER2 Status
HER2 +ve 40% 55% 5% 11% 40% 50% 63% 21% 16% 42% 45% 13%
HER2 -ve 42% 45% 13% 7% 40% 54% 60% 28% 11% 36% 52% 12%
p = n.s. p = n.s. p = n.s. p = n.s.
Distant Metastasis
Yes 44% 56% 0% 11% 33% 56% 56% 22% 22% 33% 33% 33%
No 41% 47% 12% 7% 40% 53% 61% 28% 11% 37% 48% 15%
p = n.s. p = n.s. p = n.s. p = n.s.
Differentiation
Well 44% 33% 22% 0% 44% 56% 56% 44% 0% 67% 33% 0%
Moderate 34% 51% 15% 7% 53% 41% 59% 31% 10% 33% 61% 7%
Poor 44% 47% 9% 8% 38% 55% 61% 24% 16% 34% 46% 20%
p = n.s. p = n.s. p = n.s. p = 0.04
Stage
0 53% 33% 13% 13% 27% 60% 60% 40% 0% 40% 27% 33%
Ι 39% 48% 13% 10% 32% 58% 55% 36% 10% 32% 48% 19%
ΙΙ 39% 50% 12% 5% 42% 53% 63% 24% 13% 41% 47% 12%
ΙΙΙ 46% 47% 8% 6% 43% 51% 65% 24% 12% 31% 55% 14%
ΙV 36% 46% 18% 9% 36% 55% 46% 27% 27% 36% 36% 27%
p = n.s. p = n.s. p = n.s. p = n.s.

Note: N.s. is not-significant with a P-value>0.05. Significance is P<0.05.

The 5-year disease-free-survival (DFS) from breast cancer in association with VDR polymorphisms is shown in Figure 1. The 5-year DFS in patients carrying VDR-FokI FF genotype is reduced significantly compared to VDR-FokI Ff and ff genotypes (p = 0.05). The VDR-BsmI, VDR-ApaI and VDR-TaqI polymorphisms did not influence DFS significantly. Results of multivariate analyses, adjusted for the tumor characteristics, ethnicity, and the four VDR polymorphic variants, confirm the independent predictor value of VDR-FokI in DFS as shown in Table 6. The relative risk of tumor recurrence or metastases was decreased by 43% in patients who had the polymorphic VDR-FokI alleles, Ff or ff, compared to subjects who had VDR-FokI FF genotype (Table 6).

Figure 1. Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms.

Figure 1

Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P<0.05 was considered statistically significant.

Table 6. Relative Risk of worse Disease-Free-Survival in relation to VDR gene polymorphisms (Multivariate Analysis).

Polymorphism RR* (95% CI) P-value
FokI
FF 1 (0.3–0.9) 0.05
Ff+ff 0.57
BsmI
BB 1 (0.3–1.9) 0.45
Bb+bb 0.67
ApaI
AA 1 (0.5–1.7) 0.80
Aa+aa 0.92
TaqI
TT 1 (0.7–2.4) 0.48
Tt+tt 1.3
*

RR: Relative Risk adjusted for tumor characteristics and ethnicity.

Discussion

The results from our study reveal an increased association between one of the VDR polymorphic variants, VDR-FokI, and breast cancer in the African-American cohort. The odds ratio (OR) for breast cancer in association with the VDR-FokI f allele was 1.9 (95% CI = 0.9–3.7; p = 0.07). This is consistent with other studies [25] which have identified a positive association between the VDR-FokI ff genotype and/or f allele and breast cancer (Table 7). Our study further identifies that this trend is present among African-American women, but not Hispanic/Latina women. The other most commonly studied VDR polymorphism, VDR-BsmI, was not associated with breast cancer in our study, similar to most of the other studies conducted on this polymorphism (Table 7). While Ingles et al [14] identified a significant association of the B allele with breast cancer among Hispanics, recent large studies and meta-analyses on various ethnic groups, including Hispanics, have suggested otherwise. For example, the large analyses conducted by Rollison et al [19] and Tang et al [10] have confirmed that there is no significant association between VDR-BsmI and breast cancer. Furthermore, data from our current study shows no associations between the two other VDR variants (TaqI and ApaI) and breast cancer, consistent with most studies to date on Caucasian populations (Table 7). The VDR-TaqI (tt genotype) and VDR-ApaI (a allele) were significantly associated with breast cancer in only two hospital-based studies [15], [16]. However, these polymorphisms were found to be non-significant in recent large population meta-analyses [10]. Linkage-disequilibrium analysis of the polymorphisms in our study is also consistent with findings from previous studies, confirming linkage between VDR-TaqI and VDR-ApaI in Hispanic/Latina women, and absence of LD between the VDR-FokI and other SNPs [6].

Table 7. Summary of Studies on Breast Cancer and VDR polymorphisms.

Reference Study design Ethnicity No. of Cases No. of Controls Association between VDR polymorphism and breast cancer
FokI BsmI TaqI ApaI
Curran, 1999 [16] Hospital Caucasian 135 110 n.s. n.s. a allele
Dunning, 1999 [27] Hospital/Population Caucasian 951 627 n.s.
Ingles, 2000 [14] Population Latinas 143 300 n.s. B allele
Bretherton-Watt, 2001 [28] Hospital Caucasian 181 241 n.s. bb type
Guy, 2004 [17] Hospital Caucasian 398 427 n.s. bb type
Hefler, 2004 [29] Hospital/Population Caucasian 390 1,699 n.s
Chen, 2005 [30] Population Caucasian 1,234 1,676 ff type n.s.
Vande Vord, 2006 [31] Hospital Mixed 220 192 n.s.
Caucasian (50.3%)
AA(49.7%)
John, 2007 [32] Population Mixed 1,786 2,127 n.s. n.s. n.s.
Caucasian 596 646
AA 543 598
Hispanic 647 883
McCullough, 2007 [15] Population Caucasian 500 500 n.s. n.s. n.s. n.s.
Trabert, 2007 [21] Population Caucasian 1,143 987 bb type *
AA 488 448 n.s.
Abbas, 2008 [26] Population Caucasian 1,403 2,609 n.s. n.s.
Gapska, 2008 [33] Population Caucasian 800∧ 550 f allele n.s. n.s.
Sinotte, 2008 [34] Hospital/Population Caucasian 859 1,381 ff type n.s.
Barroso, 2008 [35] Hospital Caucasian 549 556 ff type # tt type a
McKay, 2009 [25] Population Caucasian 378 421 n.s. n.s.
AA 325 419 n.s. n.s.
Hispanic 318 378 n.s. n.s.
Asian 401 405 ff type Bb typea
Hawaiian 104 278 n.s. n.s.
Tang, 2009 [10] Meta-Analysis All ethnicities >5,000 >7,000 ff type n.s. n.s. n.s.
Raimondi, 2009 [9] Review All ethnicities 14,863 21,318 ff type n.s.
Rollinson, 2012 [19] Population Non-Hispanic White 1,527 1,599 n.s n.s.
Hispanic 791 922
Vadgama, 2012 Hospital AA 115 73 f vs. F, OR = 1.9, p = 0.07 n.s. n.s. n.s.
Latina 117 267 n.s. n.s. n.s. n.s.

AA: African-American.

*

for postmenopausal women.

∧

for early-onset breast cancer (age<50).

#

OR adjusted for age at diagnosis, number of live births, age at menarche and menopause.

a

associated with low risk of breast cancer.

Additional studies on VDR SNPs [26]–[35] are presented in Table 7. Abbas et al [26], suggested that VDR polymorphisms may affect postmenopausal breast cancer risk, and be associated with receptor status. Our study shows no receptor-specific association (ER/PR/HER +/−) with any of the VDR polymorphic variants; however, the VDR-ApaI aa genotype is significantly associated with poorly differentiated tumors (p = 0.04). Since the VDR-ApaI a allele is most common in Hispanic/Latinas, and the Latinas in the present study were slightly younger than the African-American subjects, these findings may potentially implicate VDR-ApaI in the progression of cancer among younger breast cancer patients. Further investigation among larger numbers of younger women with breast cancer is necessary in order to discern a definite association.

Lastly, recent reviews have concluded that the scientific evidence between vitamin D status and breast cancer risk and outcome are fairly strong, and improving vitamin D levels could improve health status [36]. Unfortunately, studies to date which have utilized vitamin D supplementation to overcome vitamin D insufficiency have not yielded conclusive improvements in cancer health risks and outcomes [37], [38]. Hence examination of the Vitamin D receptor (VDR), and genetic changes such as polymorphisms potentially impacting VDR protein function may be central in identifying confounding factors that play a role in Vitamin D activity and ultimately patient outcome. Our study identifies that the 5-year disease-free-survival from breast cancer is significantly reduced among breast cancer patients with the VDR-FokI FF genotype (Log rank = 6.06 and p = 0.05). Cox regression with multivariate analysis demonstrates the independently predictive value of VDR-FokI on DFS. Hence, findings from our study suggest that while the VDR-FokI f allele may play a role in early association with breast cancer development, the F allele may play a role on tumor progression and patient outcome. The findings on these VDR variants, together with significant differences in haplotypes between Cases and Controls suggest the potential need to screen for VDR polymorphisms in the context of breast cancer, particularly before considering Vitamin D supplementation.

Acknowledgments

The authors would like to thank all of the women who participate in the studies conducted by the Division of Cancer Research and Training at CDU.

Funding Statement

This work was supported by National Institutes of Health(NIH)/NCI (Grant numbers U56CA101599-01; CA15083-25S3; U54CA14393); NIH/NIDDK (Grant number R25DK067015-01); Department of Defense (BCRP) (Grant number BC043180) – to JVV. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Lopes N, Sousa B, Martins D, Gomes M, Vieira D (2012) Alterations in Vitamin D signaling and metabolic pathways in breast cancer progression: a study of VDR, CYP27B1 and CYP24A1 expression in benign and malignant breast lesions. BMC Cancer 10: 483 doi:10.1186/1471-2407-10-483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Engel LS, Orlow I, Sima CS, Satagopan JM, Mujumdar UJ, et al. (2012) Vitamin D receptor gene haplotypes and polymorphisms and risk of breast cancer: A nested case-control study. Cancer Epidemiol Biomarkers Prev 21 10: 1856–67 PMID:22892281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Marik R, Fackler M, Gabrielson E, Zeiger MA, Sukumar S, et al. (2010) DNA methylation-related vitamin D receptor insensitivity in breast cancer. Cancer Biol Ther 10 1: 44–53 PMID: 20431345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Abedin SA, Banwell CM, Colston KW, Carlberg C, Campbell MJ (2006) Epigenetic corruption of VDR signaling in malignancy. Anticancer Res 26 4A: 2557–66 PMID: 16886664. [PubMed] [Google Scholar]
  • 5. Banwell CM, O'Neill LP, Uskokovic MR, Campbell MJ (2004) Targeting 1alpha,25-dihydroxyvitamin D3 antiproliferative insensitivity in breast cancer cells by co-treatment with histone deacetylation inhibitors. J Steroid Biochem Mol Biol 90: 245–249 PMID: 15225779. [DOI] [PubMed] [Google Scholar]
  • 6. Nejentsev S, Godfrey L, Snook H, Rance H, Nutland S, et al. (2004) Comparative high-resolution analysis of linkage disequilibrium and tag single nucleotide polymorphisms between populations in the vitamin D receptor gene. Hum Mol Genet 13: 1633–9 PMID: 15175274. [DOI] [PubMed] [Google Scholar]
  • 7. Alimirah F, Peng X, Murillo G, Mehta RG (2011) Functional significance of vitamin D receptor FokI polymorphism in human breast cancer cells. PLoS One 6 1: e16024 PMID: 21283672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Jurutka PW, Remus LS, Whitfield GK, Thompson PD, Hsieh JC, et al. (2000) The polymorphic N terminus in human vitamin D receptor isoforms influences transcriptional activity by modulating interaction with transcription factor IIB. Mol Endocrinol 14: 401–20 PMID: 10707958. [DOI] [PubMed] [Google Scholar]
  • 9. Raimondi S, Johansson H, Maisonneuve P, Gandini S (2009) Review and meta-analysis on vitamin D receptor polymorphisms and cancer risk. Carcinogenesis 30: 1170–1180 PMID: 19403841. [DOI] [PubMed] [Google Scholar]
  • 10. Tang C, Chen N, Wu M, Yuan H, Du Y (2009) FokI polymorphism of vitamin D receptor gene contributes to breast cancer susceptibility: a meta-analysis. Breast Cancer Res Treat 117: 391–399 doi:10.1007/s10549-008-0262-4 PMID: 19145484 [DOI] [PubMed] [Google Scholar]
  • 11. Mishra DK, Bid HK, Srivastava DS, Mandhani A, Mittal RD (2005) Association of vitamin D receptor gene polymorphism and risk of prostate cancer in India. Urol Int 74: 315–8 PMID:15897695. [DOI] [PubMed] [Google Scholar]
  • 12. Xu Y, Shibata A, Mcneal JE, Stamey TA, Feldman D, et al. (2003) Vitamin D receptor start codon polymorphism (FokI) and prostate cancer progression. Cancer Epidemiol Biomark Prev 12: 23–7 PMID:12540499. [PubMed] [Google Scholar]
  • 13. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP (2004) Genetics and biology of vitamin D receptor polymorphisms. Gene 338 2: 143–56 PMID:15315818. [DOI] [PubMed] [Google Scholar]
  • 14. Ingles SA, Garcia DG, Wang W, Nieters A, Henderson BE, et al. (2000) Vitamin D receptor genotype and breast cancer in Latinas (United States). Cancer Causes Control 11: 25–30 PMID:10680726. [DOI] [PubMed] [Google Scholar]
  • 15. McCullough ML, Stevens VL, Diver WR, Feigelson HS, Rodriguez C, et al. (2007) Vitamin D pathway gene polymorphisms, diet, and risk of postmenopausal breast cancer: a nested case-control study. Breast Cancer Res 9: R9 (doi:10.1186/bcr1642). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Curran JE, Vaughan T, Lea RA, Weinstein SR, Morrison NA, et al. (1999) Association of A vitamin D receptor polymorphism with sporadic breast cancer development. Int J Cancer 83: 723–6 PMID:10597185. [DOI] [PubMed] [Google Scholar]
  • 17. Guy M, Lowe LC, Bretherton-Watt D, Mansi JL, Peckitt C, et al. (2004) Vitamin D receptor gene polymorphisms and breast cancer risk. Clin Cancer Res 10: 5472–81 PMID:15328186. [DOI] [PubMed] [Google Scholar]
  • 18. Yao S, Zirpoli G, Bovbjerg DH, Jandorf L, Hong CC, et al. (2012) Variants in the vitamin D pathway, serum levels of vitamin D, and estrogen receptor negative breast cancer among African-American women: a case-control study. Breast Cancer Res 14 2: R58 PMID:22480149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Rollison DE, Cole AL, Tung KH, Slattery ML, Baumgartner KB, et al. (2012) Vitamin D intake, vitamin D receptor polymorphisms, and breast cancer risk among women living in the southwestern U.S. Breast Cancer Res Treat 132 2: 683–91 PMID:22130867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Buyru N, Tezol A, Yosunkaya-Fenerci E, Dalay N (2003) Vitamin D receptor gene polymorphisms in breast cancer. Exp Mol Med 35: 550–5 PMID:14749534. [DOI] [PubMed] [Google Scholar]
  • 21. Trabert B, Malone KE, Daling JR, Doody DR, Bernstein L, et al. (2007) Vitamin D receptor polymorphisms and breast cancer risk in a large population-based case control study of Caucasian and African-American women. Breast Cancer Res 9: R84 PMID:18067661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Rodriquez S, Gaunt TR, Day INM (2012) Hardy-Weinberg Equilibrium Testing of Biological Ascertainment for Mendelian Randomization Studies. Available: http://www.oege.org/software/hwe-mr-calc.html. Accessed 2012 Jun 30. [DOI] [PMC free article] [PubMed]
  • 23. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21 2: 263–5 PMID:15297300. [DOI] [PubMed] [Google Scholar]
  • 24.Broad Institute Website. Available: http://www.broad.mit.edu/mpg/haploview. Accessed 2012 Sep 15.
  • 25. McKay JD, McCullough ML, Ziegler RG, Kraft P, Saltzman BS, et al. (2009) Vitamin D receptor polymorphisms and breast cancer risk: results from the national cancer institute breast and prostate cancer cohort consortium. Cancer Epidemiol Biomarkers Prev 18: 297–305 PMID:19124512. [DOI] [PubMed] [Google Scholar]
  • 26. Abbas S, Nieters A, Linseisen J, Slanger T, Kropp S, et al. (2008) Vitamin D receptor gene polymorphisms and haplotypes and postmenopausal breast cancer risk. Breast Cancer Res 10: R31 PMID:18419802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Dunning AM, McBride S, Gregory J (1999) No association between androgen or vitamin D receptor gene polymorphisms and risk of breast cancer. Carcinogenesis 20: 2131–5 PMID:10545416. [DOI] [PubMed] [Google Scholar]
  • 28. Bretherton-Watt D, Given-Wilson R, Mansi JL, Thomas V, Carter N, et al. (2001) Vitamin D receptor gene polymorphisms are associated with breast cancer risk in a UK Caucasian population. Br J Cancer 85: 171–5 PMID:11461072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Hefler LA, Tempfer CB, Grimm C, Lebrecht A, Ulbrich E, et al. (2004) Estrogen-metabolizing gene polymorphisms in the assessment of breast carcinoma risk and fibrodenoma risk in Caucasian women. Cancer 101: 264–9 PMID:15241822. [DOI] [PubMed] [Google Scholar]
  • 30. Chen WY, Bertone-Juhnson ER, Hunter DJ, Willett WC, Hankinson SE (2005) Associations between polymorphisms in the Vitamin D receptor and breast cancer risk. Cancer Epidemiol Biomarkers Prev 14: 2335–9 PMID:16214913. [DOI] [PubMed] [Google Scholar]
  • 31. VandeVord PJ, Wooley PH, Darga LL, Severson RK, Wu Bin, et al. (2006) Genetic determinants of bone mass do not relate with breast cancer risk in US white and African-American women. Breast Cancer Res Treat 100: 103–7 PMID:16791482. [DOI] [PubMed] [Google Scholar]
  • 32. John EM, Schwartz GG, Koo J, Wang W, Ingles SA (2007) Sun exposure, Vitamin D receptor gene polymorphisms, and breast cancer risk in a multiethnic population. American J Epidemiology 166: 1409–19 PMID:17934201. [DOI] [PubMed] [Google Scholar]
  • 33. Gapska P, Scott RJ, Serrano-Fernandez P, Huzarski T, Byrski T, et al. (2009) Vitamin D receptor variants and breast cancer risk in the Polish population. Breast Cancer Res Treat 115: 629–33 PMID:18587672. [DOI] [PubMed] [Google Scholar]
  • 34. Sinotte M, Rousseau F, Ayotte P, Dewailly E, Diorio C, et al. (2008) Vitamin D receptor polymorphisms (FokI, BsmI) and breast cancer risk: association replication in two case-control studies within French Canadian population. Endocrine-Related Cancer 15: 975–983 PMID:18719092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Barroso E, Fernandez LP, Milne RL, Pita G, Sendagorta E, et al. (2008) Genetic analysis of the vitamin D receptor gene in two epithelial cancers: melanoma and breast cancer case-control studies. BMC Cancer 8: 385 doi:10.1186/1471-2407-8-385. PMID:19105801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Mohr SB, Gorham ED, Alcaraz JE, Kane CI, Macera CA, et al. (2012) Does the evidence for an inverse relationship between serum vitamin D status and breast cancer risk satisfy the Hill criteria? Dermatoendocrinol 4 2: 152–7 PMID: 22928071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Chlebowski RT, Johnson KC, Kooperberg C, Pettinger M, Wactawski-Wende J, et al. (2008) Calcium plus vitamin D supplementation and the risk of breast cancer. J Natl Cancer Inst 100: 1581–1591 PMID: 19001601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Buttigliero C, Monagheddu C, Petroni P, Saini A, Dogliotti L, et al. (2011) Prognostic role of vitamin d status and efficacy of vitamin D supplementation in cancer patients: a systematic review. Oncologist 16 9: 1215–27 Epub 2011 Aug 11. PMID: 21835895. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES