Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Apr 1.
Published in final edited form as: J Microbiol Methods. 2013 Feb 11;93(1):58–67. doi: 10.1016/j.mimet.2013.01.019

A genetic approach for the identification of exosporium assembly determinants of Bacillus anthracis

Krista A Spreng 1, Brian M Thompson 1, George C Stewart 1,*
PMCID: PMC3602209  NIHMSID: NIHMS445403  PMID: 23411372

Abstract

The exosporium is the outermost layer of spores of the zoonotic pathogen Bacillus anthracis. The composition of the exosporium and its functions are only partly understood. Because this outer spore layer is refractive to traditional biochemical analysis, a genetic approach is needed in order to define the proteins which comprise this important spore layer and its assembly pathway. We have created a novel genetic screening system for the identification and isolation of mutants with defects in exosporium assembly during B. anthracis spore maturation. The system is based on the targeting sequence of the BclA exosporium nap layer glycoprotein and a fluorescent reporter. By utilizing this screening system and gene inactivation with Tn916, several novel putative exosporium-associated determinants were identified. A sampling of the mutants obtained was further characterized, confirming their exosporium defect and validating the utility of this screen to identify novel spore determinants in the genome of this pathogen.

Keywords: Bacillus anthracis, spore, exosporium, mutagenesis, transposon

1. Introduction

There are a number of endospore-forming bacteria that are of concern to public health, including Bacillus anthracis and Bacillus cereus. For these organisms, the spore is usually the infectious form. The spores from each of these pathogens contain an outer spore layer known as the exosporium, which provides the sites of initial interactions with the infected host. The exosporium is separated from the spore coat by a region known as the interspace (Beaman et al., 1971; Gerhardt, 1967; Gerhardt and Ribi, 1964; Giorno et al., 2007, 2009). The exosporium layer of B. anthracis consists of a basal layer surrounded by an external nap of hair-like projections (Hachisuka et al., 1966; Gerhardt, 1967; Sylvestre et al., 2002; 2003; 2005; Tan and Turnbough, 2010). The collagen-like glycoprotein BclA is the principal component of this hair-like nap, is an immunodominant antigen, and is involved in the uptake of spores by alveolar macrophages and dendritic cells through its interaction with the integrin Mac-I [CR3] (Steichen et al., 2003; Boydston et al., 2005; Bozue et al., 2005; Brahmbhatt et al., 2007; Oliva et al., 2008).

Additional protein constituents of the exosporium have been identified. These include the collagen-like proteins BclB (Waller et al., 2005; Thompson et al., 2007, 2012; Thompson and Stewart, 2008), and BetA (Thompson et al., 2011b), as well as the basal layer-associated BxpB protein (also called ExsFA) which is needed for assembly of the collagen-like proteins (Steichen et al., 2005; Sylvestre et al., 2005; Thompson and Stewart, 2008; Thompson et al., 2011b; 2012). CotY, ExsA, ExsB, ExsK, ExsFB, ExsM, and ExsY have also been implicated in exosporium formation (Bailey-Smith et al., 2005; Sylvestre et al., 2005, Boydston et al., 2006; Johnson et al., 2006; Steichen et al., 2007; Severson et al., 2009; Fazzini et al., 2010; McPherson et al., 2010; Thompson et al., 2011c). Enzymes associated with the exosporium, including alanine racemase, arginase, and superoxide dismutase, may be involved in preventing premature germination and providing protection against macrophage killing by detoxifying superoxide free radicals (Raines et al., 2006; Weaver et al., 2007; Chesnokova et al., 2008; Cybulski et al., 2009).

The overall assembly of the exosporium layer of the spore is still not well understood. The exosporium is the final layer of the spore to be assembled, and many of its proteins are deposited around the spore in a progressive engulfment process (Ohye and Murrell, 1973; Hilbert and Piggot, 2004; Thompson and Stewart, 2008; Giorno et al., 2009; Tan and Turnbough, 2010; Thompson et al., 2011c). The assembly of the nap closely follows the progressive assembly of the basal layer (Thompson and Stewart, 2008; Giorno et al., 2009; Thompson et al., 2011c). BclA is one of the major proteins comprising the hair-like nap found on the external surface of the exosporium. BclA assembly has been well studied, from its assembly process and timing, its N-terminal cleavage events and resulting covalent attachment to BxpB, and its association into large molecular weight complexes during exosporium assembly (Boydston et al., 2005; Steichen et al., 2005; Sylvestre et al., 2005; Thompson and Stewart, 2008; Tan and Turnbough, 2010; Tan et al., 2011; Thompson et al., 2011c, 2012).

Much of what we have learned about spore formation comes from genetic studies with Bacillus subtilis (reviewed in Stragier and Losick, 1996). Because this organism lacks a distinct exosporium layer and homologs of the known B. cereus family exosporium determinants, it provides no insight regarding the biosynthetic process for exosporium formation. Proteomic studies have been used to identify exosporium proteins of B. anthracis (Steichen et al., 2003; Todd et al., 2003; Liu et al., 2004; Redmond et al., 2004). However, these studies are limited to the identification of structural proteins present in sufficient quantities for identification. Trace components, or proteins required for the exosporium assembly process but which are not present in the mature spore, would not be identified by these approaches. To develop a genetic system to broadly identify exosporium-associated B. anthracis determinants, we took advantage of the BclA targeting domain and the fluorescent reporter protein DsRed, to create a method to identify mutants whose phenotype is a defect in incorporation of the exosporium surface protein BclA. Since BclA is a latecomer structural protein as far as exosporium assembly is concerned, this approach has the potential for identifying genes involved in many of the steps involved in exosporium synthesis and assembly. Mutants were generated using a Tn916 transposon mutagenesis system that has been shown to be useful for mutagenesis experiments with B. anthracis (Ivins et al., 1988). Representative mutants obtained with this system were evaluated for exosporium defects as a validation of the genetic system.

2. Methods

2.1. Strains and growth conditions

Strains are listed in Table 1. E. coli was grown at 37°C with shaking (225 rpm) in Luria-Bertani broth (LB). B. anthracis was grown at 37°C with shaking in brain heart infusion broth (BHIB; Difco). Solid media was prepared using 1.5% agar. When required, media were supplemented with ampicillin to 100 μg/ml ampicillin, tetracycline to 10 μg/ml, or chloramphenicol to 10 μg/ml. For relatively synchronous production of spores, B. anthracis was cultured in Tiger broth, a modified version of ModG medium (Bergman et al., 2006; Thompson et al., 2011c). The onset of sporulation (T0) is defined as the point at which the culture deviated from exponential growth.

Table 1.

Strains and plasmids used in this study

Strain or Plasmid Relevant Characteristicsa Source
Strains
Bacillus anthracis
Sterne pXO1 positive, pXO2 negative Lab stock
ΔSterne Plasmid-free Sterne strain Lab stock
MUS1691 ΔSterne bclB null; Kanr (Thompson et al., 2007)
MUS1694 ΔSterne pBT3777 (Thompson and Stewart, 2008)
MUS1751 ΔSterne bas1747::Tn916; pBT3777 This study
MUS1753 ΔSterne bas1726::Tn916; pBT3777 This study
MUS1754 ΔSterne bas0389::Tn916; pBT3777 This study
MUS1761 ΔSterne bas0605::Tn916; pBT3777 This study
MUS1776 ΔSterne bclA null; Kanr (Thompson and Stewart, 2008)
MUS1824 ΔSterne pKS1824 This study
MUS1834 ΔSterne bas0389::Tn916 This study
MUS1835 ΔSterne bas0605::Tn916 This study
MUS1836 ΔSterne bas1747::Tn916 This study
MUS8046 MUS1834; pKS4395 This study
MUS8047 MUS1836; pKS4426 This study
RG56 Sterne cotE null; Kanr (Giorno et al., 2007)
RG124 Sterne bxpB null; Kanr (Giorno et al., 2007)
Enterococcus faecalis
CG110 Tn916 Tetr (Gawron-Burke and Clewell, 1982)
Escherichia coli
DH5 endA1 hsdR17 (rK−mK+) glnV44 thi-1 Lab stock
recA1 gyrA (Nalr) relA1
Δ(lacIZYA argF)U169
deoR (ϕ80dlacΔ(lacZ)M15)
GM48 thr leu thi lacY galK galT ara fhuA tsx Lab stock
dam dcm glnV44
SCS110 rpsL thr leu endA thi-1 lacY galK galT ara Stratagene
tonA tsx dam dcm supE44 Δ(lac-proAB)
M15 lacZΔM15 Qiagen
MUS3845 M15 pRep4 + pBT3845; Ampr, Kanr This study
Plasmids
pBT3777 pMK4 + bclA-NTD-DsRed; Ampr, Cmr (Thompson and Stewart, 2008)
pKS1824 pMK4 bas0390-eGFP; Cmr This study
pKS4168 pHP13 bas0390; Cmr, Emr This study
pKS4395 pHP13 bas0389; Cmr, Emr This study
pKS4426 pHP13 bas1747; Cmr, Emr This study
pMK4 Shuttle plasmid; Ampr, Cmr (Sullivan et al., 1984)
pQE30 His-tag expression vector; Ampr Qiagen
a

Cmr, Tetr, Kanr, Emr, Lmr, and Ampr denote resistance to chloramphenicol, tetracycline, kanamycin, 0.5 μg erythromycin ml−1, 12.5 μg lincomycin ml−1, and ampicillin, respectively.

2.2 Production of spores

Overnight B. anthracis cultures in BHIB with appropriate antibiotic selection were swab inoculated onto nutrient agar (Difco) plates (with antibiotics) and incubated at 30°C. Microscopy was used to monitor progression of spore production. When sporulation exceeded 95%, the spores were harvested with sterile PBS. Spores were thrice washed in sterile PBS to remove residual vegetative cells. Purity of the spore samples were checked by phase contrast microscopy. Purified spores were stored in sterile PBS and concentration determined by counting on a hemocytometer.

2.3 Transposon mutagenesis

The recipient strain was MUS1694, ΔSterne bearing pBT3777 (Thompson and Stewart, 2008) while the Tn916 donor strain was Enterococcus faecalis CG110 (Gawron-Burke and Clewell, 1982). Overnight cultures (5 ml) were prepared with appropriate antibiotics (tetracycline for the selection of the donor and chloramphenicol for the recipient). The strains were combined and collected on 47 mm 0.45 μ nitrocellulose filters (Thermo Fisher cat. no. 09-740-30D) at two different ratios (2:1 or 3:1 recipient:donor). The filters were removed and placed culture side up on brain heart infusion agar plates, and incubated at 30°C for 18 hours. After incubation the filters were removed from the BHI plates, placed in 5 ml LB in a 50 ml conical tube, and the cells washed from the filter with BHIB. Serial dilutions (1:10, 1:100, 1:1000) of the harvested cells were plated on BHI plates containing 10 μg/μl chloramphenicol and 10 μg/μl tetracycline and incubated at 30°C. After 24–36 hours the colonies were replica plated onto nutrient agar plates containing 10 μg/μl chloramphenicol and 10 μg/μl tetracycline and incubated at 30°C. DsRed fluorescence was monitored daily using a Dark Reader Spot Lamp (Clare Chemical Research) which generates light output between 400–500 nm. The colonies which failed to become fluorescent, indicating that sporulation did not progress to the point of expressing the BclA NTD-DsRed fusion, were marked and not pursued further. Incubation was continued until the sporulation process was complete and the colonies reexamined for fluorescence. Those initially fluorescent colonies now exhibiting a reduction or complete loss of fluorescence were selected. A bank of 500 of these clones was stored at −80°C in BHIB + 20% glycerol.

2.4 Characterization of the Tn916 insertion sites

B. anthracis Tn916 insertion mutants displaying reduced BclA-DsRed spore-associated fluorescence were cultured in BHI broth containing tetracycline and chloramphenicol, and chromosomal DNA extracted with phenol and chloroform as described (Thompson et al., 2007). Genomic DNA was digested with Sau3a and the DNA fragments electrophoresed on a 1% agarose gel and Southern blotted onto a nylon membrane (Magnacharge, 0.45 μm). A Tn916-specific DNA probe was prepared by PCR (primers: Tn916 probe 5p, CTAATTTACTACTTATGAATGAGC and Tn916 probe 3p, CCTTTTACCACGCTGTTTCATGCG. The resultant 996 bp PCR DNA fragment was purified using a Qiaquick PCR Clean Up kit (Qiagen) and labeled using a commercial digoxigenin labeling and detection kit (Roche). Hybridization was conducted at 68°C in 5X SSC, 0.04% SDS, 0.1% N-lauroylsarcosine, and 10% blocking solution (Roche). Hybridized probe was identified using an anti-DIG alkaline phosphatase conjugate and 2% (v/v) NBT/BCIP (Thermo-Fisher Scientific).

Characterization of the Tn916 insertion sites was performed using inverse PCR as previously described (Smidt et al., 1999). Briefly, chromosomal DNA was digested with HindIII, purified and ligated at a concentration of 50 ng/μl. Five nanograms of self-ligated DNA was used as the template in a 50 μl PCR reaction mixture containing 37.5 ng of each primer (Tn916 62–38, TAGAATAAGGCTTTACGAGC and Tn916 12185–12190, CCTTGATAAAGTGTGATAAG); 2 mM MgCl2; 200 μM (each) dATP, dCTP, dGTP, and dTTP; and 1.25 U of ExTaq polymerase (Takara Bio). After the mixture was preheated to 94°C for 3 min, 35 amplification cycles were performed, consisting of denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and elongation at 72°C for 3 min. A final extension of 7 min at 68°C was performed. The PCR products were identified by electrophoresis on a 1% agarose gel, purified with a Qiaquick PCR Purification kit, and the nucleotide sequence determined at the University of Missouri DNA core using the individual inverse PCR primers. The site of each Tn916 insertion was identified from the sequences.

2.5 Transmission electron microscopy

Spores were fixed in 1 ml 2% glutaraldehyde-100 mM sodium cacodylate solution containing 0.1% ruthenium red (Waller et al., 2004; Sigma-Aldrich) for 1 hour at 37°C. Each spore pellet was then washed in 100 mM sodium cacodylate buffer, embedded in Histogel, and washed with 100 mM sodium cacodylate buffer containing 0.01 M 2-mercaptoethanol and 0.13 M sucrose (2-ME buffer). Samples underwent secondary fixation in 1% osmium tetroxide (Electron Microscopy Sciences). ΔSterne spores were used as a wild-type control and were treated identically to the mutant spores. Spores were washed in 2-ME buffer and dehydrated with sequential treatments of 20, 50, 75, 90, and 100% acetone. Polymerization occurred at 60°C in Epon/Spurrs resin after extended resin infiltration. Samples were cut into 85 nm thick sections and the sections mounted on 200 mesh nickel grids and stained with 2% uranyl acetate (Electron Microscopy Sciences) for 20 minutes at room temperature. The samples were treated with lead for 5 minutes at room temperature. Grids were washed in ultrapure water and observed by transmission electron microscopy (TEM) using a JEOL 1400 electron microscope.

2.6 Spore counts

The percentage of spores with the mutant phenotype spores were determined and compared to wild-type. A minimum of 350 spores were generally counted per strain from multiple grids, images, and different viewing fields representative of the samples. Percentages were then calculated.

2.7 Flow cytometric analyses

Wild-type and Tn916-bearing strains harboring the BclA NTD-DsRed plasmid were induced to sporulate in Tiger broth until >95% free spores (Thompson et al., 2011c). 1×108 PBS-washed spores were resuspended in 500 μl of 4% paraformaldehyde in PBS and incubated for 2 hours at room temperature. The spores were thrice washed in PBS and then sorted using a FACScan flow cytometer (Beckton Dickinson Biosciences) in the University of Missouri Cell and Immunobiology Core Laboratory. 75,000–100,000 spores were counted and the raw data analyzed and graphed using WinMDI 2.9 (Purdue University Cytometry Laboratories) software.

2.8 Western blot analysis

Proteins were extracted from 108 spores by boiling in SDS-urea sample buffer (50 mM Tris-HCl, pH 10, 10% glycerol, 4% SDS, 8 M urea, 2% β-mercaptoethanol, 0.02% bromophenol blue) for 10 minutes (Thompson et al., 2011a). Samples were then centrifuged to remove remaining spores, and the extracted protein was electrophoresed on 4–20% polyacrylamide gels (BioRad) and the proteins blotted to PVDF membranes. The blots were probed with rabbit polyclonal antibodies to rBclA, rBclB, or rBAS1747 respectively. Western blots were performed using goat anti rabbit immunoglobulin G conjugated to horseradish peroxidase as the secondary antibody. Immuno-reactive proteins were determined using the Pierce ECL Western Blotting Substrate kit (Thermo Scientific).

2.9 Preparation of anti-BAS1747 antiserum

The bas1747 open reading frame was PCR amplified using primers (1747USrec, GGATCCATGTTGGTTTCATCTATTAAAAGATTTTTAATTGG and 1747DSrec, GTCGACTTAGAAAGCTACAATTAAAATAATCGATGC) and cloned into the pQE30 plasmid (Qiagen) as a BamHI to SalI fragment. His-tagged protein was expressed in E. coli M15 (pREP4) by induction with 1 mM IPTG and purified using the His-Spin Protein purification kit (Zymo Research). Anti-rBAS1747 polyclonal antiserum was prepared in rabbits using Titermax Gold as adjuvant (CytRx Corp).

2.10 Immunolabeling of spores

Ten mg of paraformaldehyde-fixed spores were resuspended in 750 μl SuperBlock Blocking buffer (Thermo Scientific) and incubated for at least 20 minutes at room temperature. The samples were vortexed every 5 minutes to ensure the spores remained suspended. The spores were harvested by centrifugation and the spore pellet was resuspended in 250 μl SuperBlock blocking buffer with 1 μl primary antibody (rabbit polyclonal antibodies used were against BclA [34], BclB [16], and BAS1747) and incubated at room temperature for 20 minutes. The spores were harvested by centrifugation and washed with 750 μl of SuperBlock blocking buffer. The pellet was then resuspended in 250 μl of SuperBlock Blocking buffer with secondary antibody conjugate (Protein A conjugated goat anti-rabbit IgG-Alexa Fluor 568; Invitrogen). The spores were incubated at room temperature for 20 minutes, pelleted and washed with 750 μl SuperBlock blocking buffer followed by three washes with 750 μl PBS, and finally resuspended in 250 μl PBS. DABCO anti-fade reagent (Diazabicyclooctane, Acros Organics) at a final concentration of 0.4% was added and the spores examined by epi-fluorescence microscopy using a Nikon E1000 microscope.

3. Results

3.1 Creation of a mutagenesis system to identify novel exosporium determinants

To develop a method to screen for mutants defective in exosporium synthesis, we took advantage of the mechanism by which the collagen-like BclA glycoprotein is incorporated onto the exosporium surface as a component of the outer hair-like nap layer. Inclusion of an N-terminal domain (NTD) from BclA, C-terminally fused to the fluorescent reporter DsRed, results in covalent attachment of the DsRed reporter onto the spore surface (Thompson and Stewart, 2008). The BclA NTD-DsRed fusion is strongly expressed from the bclA promoter and appears in the cytoplasm of the cells approximately three hours into the sporulation process (Thompson and Stewart, 2008; Thompson et al., 2011c). The NTD sequence results in the localization of the reporter protein around the developing spore and subsequent covalent attachment of the fusion protein to the exosporium of the spore. When the sporulation process is complete, the mother cells lyse releasing the mature spore. Colonies of sporulating cells become fluorescent when the reporter is expressed in the mother cell and remain fluorescent when the sporulation process is complete because the BclA NTD-DsRed is abundantly and stably anchored to the spore surface. Mutants that are unable to incorporate the BclA surface protein reporter lose fluorescence when the mother cells lyse and the unincorporated BclA NTD-DsRed diffuses away from the colony or becomes inactive through protein turnover. Bound BclA NTD-DsRed is quite stable (Thompson and Stewart, 2008). Thus loss of colony fluorescence can be used to identify mutants potentially defective in exosporium maturation resulting in defective BclA fusion incorporation. To eliminate early sporulation gene mutants which fail to sporulate, colonies can be screened early in the sporulation process and any which fail to express the BclA NTD-DsRed reporter (blocked prior to BclA expression and do not develop fluorescence) can be identified and eliminated from consideration.

We utilized a Tn916 (Gawron-Burke and Clewell, 1982; Ivins et al., 1988; Flannagan et al., 1994) conjugative transposon mutagenesis system. The donor strain was Enterococcus faecalis CG110 and the recipient strain was MUS1694, ΔSterne bearing the bclA NTD-DsRed reporter plasmid pBT3777 (Thompson et al., 2011c, 2012). The transconjugant B. anthracis cells bearing Tn916 were identified by plating on media containing tetracycline (to select for Tn916 and chloramphenicol (to select for pBT3777). Plates were incubated at 30°C and examined using a Dark Reader lamp for fluorescence. Colonies which failed to express the BclA NTD-DsRed reporter were identified, marked, and not considered further. Colonies that expressed the reporter but which exhibited reduced fluorescence once sporulation was complete were identified and selected for further study (Fig. 1).

Figure 1.

Figure 1

The exosporium gene identification system. A) A BHIA plate containing tetracycline and chloramphenicol inoculated with the E. faecalis + B. anthracis conjugation mixture and following incubation at 30°C for 1 week to permit sporulation. Colonies were exposed to a Dark Reader lamp. White arrows denote locations of colonies exhibiting reduced fluorescence. B) Cells from putative reduced fluorescence colonies from the initial plating were toothpick inoculated onto a BHIA plate containing tetracycline and chloramphenicol incubated at 30°C for 1 week to permit sporulation. A control culture exhibiting wild-type BclA-NTD-DsRed fluorescence is positioned at the right side of the plate.

DNA was isolated from cells of representative colonies that exhibited reduced fluorescence at the end of the sporulation process. The genomic DNA was cleaved with Sau3a, electrophoresed in an agarose gel, Southern blotted onto a charged nylon membrane, and probed with a DIG-labeled Tn916 probe. Rare strains possessing more than one copy of Tn916 were not further characterized. Inverse PCR was performed and the PCR products sequenced to identify the insertion site of the Tn916 transposon. Representative putative exosporium development mutants identified are shown in Table 2. Most of the determinants are not annotated as genes expected to be associated with assembly of the outer spore layers. Therefore, studies were conducted to validate these determinants as being spore assembly-associated.

Table 2.

Sites of Tn916 Insertion

Sterne gene number Gene annotation
BAS0047 SpoVG
BAS0389 Conserved hypothetical protein
BAS0483 Hypothetical protein
BAS0547 Citrate cation symporter family protein
BAS0605 Sodium/alanine symporter family protein
BAS1291 Hypothetical protein
BAS1726 Acetyl CoA hydrolase/transferase family protein
BAS1747 Hypothetical protein
BAS1820 Aminoglycoside 6-adenylytransferase, putative
BAS3594 Sensory box/GGDEF family protein

To confirm that the mutants were defective in BclA-NTD-DsRed incorporation onto the spore surface, the mutant spores were compared to the wild-type parent by flow cytometry. Representative examples (Tn916 inactivated bas0389, bas0605, bas1726, and bas1747) are shown in Fig. 2. Each mutant exhibited a reduced level of DsRed fluorescence compared to wild-type levels. The results confirmed the fluorescence colony screen results that the mutant spore population exhibited a reduced BclA-NTD-DsRed expression on the spore surface.

Figure 2.

Figure 2

Flow cytometry quantification of overall fluorescence levels of BclA-NTD-DsRed in spores. Red line – wild-type (MUS1694) spores as a positive control, gray area – ΔSterne spores (as a negative control). Panel A) MUS1751 (bas1747::Tn916) mutant spores (blue); B) MUS1754 (bas0389::Tn916) mutant spores (green); C) MUS1761 (bas0605::Tn916) mutant spores (purple); and D) MUS1753 (bas1726::Tn916) mutant spores (black).

Three novel exosporium determinants were selected for further study. Two of these, BAS0389 and BAS1747, are of unknown function. BAS0605 was annotated as a sodium/alanine symporter family protein.

3.2 bas0389

The bas0389 determinant harbored the Tn916 element 501 bp into the open reading frame. This determinant is the penultimate determinant in an apparent seven gene operon (bas0384-bas0390). These genes are annotated as a ROK family protein (BAS0384), tellurium resistance protein, putative (BAS0385), tellurium resistance protein (BAS0386), tellurium resistance protein (BAS0387), tellurium resistance protein, putative (BAS0388), conserved hypothetical protein (BAS0389), and tellurite resistance protein, putative (BAS0390) respectively. The Sterne strain is not, however, resistant to tellurite (Spreng and Stewart, unpublished).

Flow cytometry analysis of spore fluorescence revealed that the bas0389::Tn916 mutant exhibited an intermediate level of fluorescence when compared to the positive control (Fig. 2B). To examine the native BclA content of the bas0389::Tn916 spores, a derivative of MUS1754 lacking the reporter plasmid was identified and designated MUS1834. Proteins were extracted from MUS1834 spores by boiling in SDS and urea, the resulting proteins and complexes were resolved by SDS-PAGE, transferred to PVDF, and probed with rabbit polyclonal antibodies to rBclA. The amount of extract loaded into each lane corresponded to an equivalent number of spores. The western blot results showed a modest reduction in the amount of BclA extracted from the bas0389::Tn916 mutant spores relative to that from the wild-type Sterne strain (Fig. 3A). In addition, the mutant strain exhibited a more prominent lower molecular weight BclA-containing complex (slightly below the position of the 220 kDa molecular weight standard) than the wild-type spores. The wild-type spores gave the expected heterogeneous high molecular weight BclA-containing complexes.

Figure 3.

Figure 3

Western blot probing for BclA content in spore extracts. A) 1 × 108 spores were extracted with SDS + urea and the extract resolved on 4–20% SDS-polyacrylamide gradient gels. Proteins were transferred to PVDF membranes and probed for BclA using rabbit polyclonal anti-rBclA serum. Lane 1, Invitrogen MagicMark XP western size standard (220, 120, 100, 80, 60, 50, 40, 30 and 20 kDa); 2, Sterne; 3, MUS1776 (bclA null mutant); and 4, MUS1834 (bas0389::Tn916). B) Western blot with the anti-rBclA antiserum and reduced amounts of spore extract to better show differences in BclA levels. Lane 1, ΔSterne; 2, MUS1776 (bclA null mutant); 3, MUS1834 (bas0389::Tn916); and 4, MUS8046 (bas0389::Tn916 complemented strain).

Because bas0389 is the penultimate gene in a possible multigene operon, the phenotype resulting from the Tn916 insertion may have been due to a polar effect on bas0390. To determine if the defect in BclA incorporation into the spores of the bas0389::Tn916 mutant was due to the inactivation of the bas0389 determinant, a complementation study was conducted. Spores were produced from the bas0389::Tn916 mutant strain bearing the bas0389-complementing plasmid, pKS4395. The spores from the wild-type, mutant, and complemented strains were harvested, purified, and then examined via western blot with rabbit polyclonal antiserum against BclA (Fig. 3B). Spores from cells harboring the complementation plasmid regained both wild-type levels of BclA and the wild-type pattern of BclA-containing complexes which are stable to boiling in the presence of SDS and urea. Thus the decrease in BclA incorporation in the mutant spores was the result of the inactivation of the bas0389 determinant by Tn916 and not due to expression defects on the downstream determinant. This experiment also indicated the defect was not due to a spontaneous mutation elsewhere in the B. anthracis genome.

To determine if inactivation of the bas0389 determinant resulted in alterations in the morphology of the B. anthracis spore, MUS1834 and wild-type parent spores were examined by transmission electron microscopy. The MUS1834 spores exhibited an intact exosporium and possessed a distinct hair-like nap layer, similar to that of wild-type spores (Fig. 4A, B). A structural abnormality, however, was evident in the mutant spores. With the MUS1834 mutant spores, the predominant distinction from wild-type spores was the presence of putative spore coat or exosporium fragments in the interspace (Fig. 4B, C) and what appears to be nap-containing shed exosporium debris in the sample (Fig. 4C). The nature of the interspace-localized fragments has not yet been defined. A small subpopulation of spores also presented with a structural defect in the exosporium with an apparent loss of structural integrity (Fig. 4B, C). These defects were rarely observed in TEM images of wild-type spores. Enumeration of the defects observed is presented in Table 3.

Figure 4.

Figure 4

Transmission electron microscopy of bas0389::Tn916 spores. A, B) Higher magnification and C) lower magnification TEM micrographs of spores from MUS1834. Bars represent 1 μm. Green arrows denote positions of the exosporium or spore coat fragments and the black arrows indicate sites of apparent loss of exosporium integrity. The presence of what appears to be free exosporia is evident in the background debris in panel C.

Table 3.

Morphology of BAS0389-deficient spores

Strain Number of spores with normal spore coat/exosporium Number of spores with interspace fragments evident
ΔSterne (wild-type) 342 (99.1%) 3 (0.9%)
MUS1834 233 (87.9%) 32 (12.1%)

3.3 bas0390

BAS0389 is encoded in an apparent operon. It is possible, therefore, that other genes in the operon may encode exosporium-associated proteins. To test this, the bas0390 open reading frame was fused to the eGFP reporter gene. The fusion construct was then subcloned into the pMK4 shuttle plasmid (Sullivan et al., 1984) to produce pKS1824 and introduced to the ΔSterne strain of B. anthracis by electroporation. Expression of the fusion protein was monitored in relatively synchronous cells cultured in Tiger broth. At T3 (3 hours after onset of the sporulation process) the BAS0390-eGFP fusion protein is present in the mother cell cytoplasm (Fig. 5A). At T5, the fusion protein localized to the developing spore (Fig. 5B). The localization pattern of fluorescence was not uniform; there was a higher concentration at one pole of the developing spore, similar to that seen with BclA fusions (Thompson and Stewart, 2008). At T7, a decrease in fluorescence was seen in the mother cell cytoplasm as the fusion protein had localized to the developing spore, which was uniform around two-thirds of the spore. Lesser incorporation of the BAS0390-eGFP fusion protein was observed at one spore pole in a subpopulation of the spores (Fig. 5C, D). Upon release from the mother cells, the free spores retained fluorescence. However, the fluorescence of the released spores was reduced relative to that observed prior to mother cell lysis. The fusion protein studies indicate that BAS0390 is a spore surface-associated protein, and the timing of its incorporation into the spore is consistent with it being an exosporium protein of B. anthracis.

Figure 5.

Figure 5

Spore incorporation of BAS0390-eGFP. A–D) Fluorescence micrographs of sporulating cells and spores of B. anthracis strain MUS1824. Samples were harvested at T3 (panel A), T5 (B), T7 (C), and released spores (D). Yellow arrows denote the spore pole exhibiting decreased BAS0390-eGFP fluorescence.

3.4 bas1747

Reduced BclA-DsRed incorporation into the exosporium was identified in a strain that harbored a Tn916 insertion in the bas1747 365 codon open reading frame. The insertion site was located 41 nucleotides into the ORF. BAS1747 is encoded by an apparent two gene operon, and is annotated as a hypothetical protein, as is BAS1748. Both show sequence similarity to amino acid transporters. Analysis of spore fluorescence by flow cytometry revealed the bas1747::Tn916 mutant spores presented with a reduced level of BclA NTD-DsRed fluorescence (Fig. 2B). SDS + urea extracts of the plasmid-cured bas01747::Tn916 mutant spores revealed reduced levels of BclA present (Fig. 6A) relative to that obtained from the wild-type spores.

Figure 6.

Figure 6

Western blot probing for BclA and BclB content in spore extracts. Purified spores were extracted with SDS + urea and the extract resolved on 4–20% SDS-polyacrylamide gradient gels. Proteins were transferred to PVDF membranes and probed for BclA (panel A) or BclB (panel B) using rabbit polyclonal sera. A) Lane 1, ΔSterne extract; 2, MUS1776, bclA null mutant extract; 3, MUS1836 (bas1747::Tn916); and 4, MUS8047 (bas1747 complemented strain). B) Lane 1, ΔSterne extract; 2, MUS1691, bclB null mutant; 3, MUS1836 (bas1747::Tn916).

Because BAS1747 appears to be encoded in a bicistronic operon, the phenotype resulting from the Tn916 insertion may have resulted from polar effects on bas1748. To prove that the defect in BclA incorporation into the spores of the bas1747::Tn916 mutant was due to the inactivation of the bas1747 determinant, complementation studies were conducted. Spores were prepared from the bas1747:Tn916 mutant strain bearing pKS4427, a bas1747 complementing plasmid which carries the bas1747 determinant expressed from its native promoter. Spores from cells harboring the complementation plasmid regained wild-type levels of BclA (Fig. 6A), indicating the reduction of BclA seen in the western blot was due to inactivation of bas1747.

An additional characterized exosporium collagen-like protein is BclB (Thompson et al., 2007, 2012). Loss of BclB contributes to decreased structural integrity of the exosporium and an alteration in exosporium construction (Thompson et al., 2007, 2012). Western blots were performed with rabbit polyclonal antibodies against rBclB to determine if BclB incorporation was affected by inactivation of bas1747. Extracts from the bas1747::Tn916 mutant spores displayed increased levels of BclB (Fig. 6B). In addition, a broader size range of BclB-containing complexes was observed.

To gain a better insight into the BAS1747 content of spores, a rabbit polyclonal antiserum was raised against rBAS1747. Western blot studies using this serum showed that BAS1747 is not present in detectable amounts in SDS + urea extracts from wild-type ΔSterne spores. However, proteins extracted from bclA-null spores yielded three reactive species, which migrated at positions of 20, 38, and 55 kDa (Fig. 7). Proteins extracted from the exosporium basal layer protein BxpB-deficient spores failed to react with the r1747 antibodies. Because these spores possess greatly reduced levels of BclA (Steichen et al., 2005; Sylvestre et al., 2005; Thompson et al., 2011c), the elevated BAS1747 content of BclA-negative spores is not solely the consequence of a reduction in BclA spore content. BAS1747 may be directly or indirectly dependent upon BxpB for its incorporation into the spore. Dramatically increased levels of BAS1747 were evident in extracts of bclB-null spores, indicating an inverse relationship between BclB and BAS1747 protein levels in the spore. Three distinct species of approximately 30 kDa, 40 kDa, and 70 kDa, were identified with the anti-rBAS1747 serum in the BclB-negative extracts (Fig. 7). The predicted molecular mass of BAS1747 is 38.2 kDa and thus BAS1747 is likely present in spores in the form of SDS + urea-resistant complexes. The 20 and 30 kDa species detected with the anti-BAS1747 serum may represent processed forms of the protein. In addition, the content of BAS1747 in CotE-deficient spores was examined.

Figure 7.

Figure 7

Western blot showing reactivity to polyclonal r1747 antibodies. Proteins were extracted from different spore types and electrophoresed on a 4–20% polyacrylamide gel. Proteins were transferred to PVDF membranes and probed for BAS1747. Lane 1, Invitrogen MagicMark XP western standard (220, 120, 100, 80, 60, 50, 40, 30 and 20 kDa); 2, ΔSterne extract; 3, MUS1776, bclA null mutant extract; 4, RG124, bxpB null mutant extract; 5, MUS1691, bclB null mutant extract; 6, RG56, cotE null mutant extract; 7, bas1747::Tn916 spore protein extract.

In the absence of CotE, the exosporium is made, but it fails to attach to the developing spores and consequently is found in long strips in sporulating cells and only small fragments of exosporium are spore-associated (Giorno et al., 2007, 2009). A single faintly reactive species at about 38 kDa was observed (Fig. 7). The increased reactivity observed with CotE-deficient spores, relative to wild-type spores, suggests this BAS1747 species may be present in the outer spore coat or interspace regions of the spore and thus more efficiently extracted when the exosporium layer is largely absent.

To determine if inactivation of the bas1747 determinant results in phenotypic changes in the appearance of the B. anthracis spore, bas1747::Tn916 and ΔSterne parent spores were examined by transmission electron microscopy. The bas1747::Tn916 spores possessed an intact exosporium and a distinct hair-like nap layer (Fig. 8). The appearance of the BclA-containing exosporium nap layer was altered in the bas1747::Tn916 mutant as the nap appeared less dense (Fig. 8B and D) relative to that of the wild-type spore nap but the individual fibrils appear in a more extended conformation (Fig. 8A and C). A small subpopulation of mutant spores, approximately 6%, had an exosporium wrapped twice or thrice around the spore (Fig. 9 and Table 4). These extra layers appeared to be exosporium layers as the nap layer was evident on both layers. Debris was also apparent in the bas1747::Tn916 mutant spore samples, which also had the appearance of exosporium fragments (Fig. 8F) as compared with a representative field of ΔSterne wild- type (Fig. 8E). Spores lacking an intact exosporium and several shed exosporia were present. Twelve per cent of the mutant spores lacked an exosporium and an additional 19% of spores appeared to have structural defects in the exosporium layer (Table 4).

Figure 8.

Figure 8

Transmission electron micrographs of ΔSterne and 1747::Tn916 mutant spores. A) ΔSterne wild-type spore with the BclA-nap layer. B) 1747::Tn916 mutant spore. The nap layer has an altered appearance relative to that of the wild-type spore, and the individual fibrils appear in a more extended form. C) Higher magnification of a ΔSterne wild-type spore nap layer; D) Higher magnification of a 1747::Tn916 mutant spore nap layer. The red arrows denote the nap layers. E) Representative field of ΔSterne wild-type spores. F) Representative field of bas1747::Tn916 mutant spores. The black arrows denote spores lacking an exosporium and the blue arrows indicate some of the exosporium appearing debris.

Figure 9.

Figure 9

Transmission electron micrographs of 1747::Tn916 mutant spores with additional exosporium layers. Two examples of a small subpopulation of bas1747::Tn916 mutant spores that exhibited multiple exosporium layers are shown. The arrows denote the additional layers of the exosporium, complete with their associated nap, wrapped twice (left panel) or thrice (right panel) around the spore.

Table 4.

Percentage of the bas1747 mutant spores with a loss of structural integrity

Strain Number of spores Normal appearing exosporium Exosporium- damaged spores Spores without exosporium Multiple exosporium layers
ΔSterne 587 570 (97.1%) 6 (1%) 11 (1.9%) 0
MUS1836 590 382 (64.7%) 104 (17.6%) 69 (11.8%) 35 (5.9%)

4. Discussion

Much of what we know regarding the process of sporulation in the genus Bacillus comes from genetic studies with Bacillus subtilis, an organism whose spores lack a distinct exosporium layer. Although B. subtilis spore surfaces possess certain similarities to the surface of exosporium-containing spores (Sousa et al., 1976; Waller et al., 2004), they are not analogous structures. Known B. anthracis exosporium genes often have homologs present in the exosporium-containing B. cereus family of bacteria, but determinants with significant sequence similarity are usually absent in spore forming bacteria lacking a visible exosporium, including B. subtilis.

Our genetic system to identify genes involved in exosporium identification makes use of our understanding of the BclA nap protein on the surface of the exosporium. The system possesses sufficient sensitivity to identify mutants with quantitative defects in BclA incorporation onto the spore surface. An advantage of this genetic approach is that it can identify genes whose products affect exosporium development and which are not necessarily present in the spore (biosynthetic rather than structural roles). This genetic system can additionally be modified to use reporter fusions to other identified exosporium determinants to identify genes affecting the incorporation of these proteins, and thus identify exosporium biosynthetic pathways which may not show up in a BclA-based reporter system. Although we were successful in identifying mutants using the Tn916 transposon, the system can be improved using the more promiscuous mariner transposon element which has been adapted for use with B. anthracis (Tam et al., 2006; Wilson et al., 2007).

Most of the genes identified to date using this system have gene annotations that are not helpful in assigning an exosporium biosynthetic role. Thus it was important to validate their involvement in the sporulation process. The genes characterized were found to be important for incorporation of BclA onto the exosporium at wild-type levels. Based on the microarray studies by Hanna and coworkers (Liu et al., 2004; Bergman et al., 2006), the genes identified in Table 2 show some degree of expression at time points consistent with exosporium maturation. However, many do not show peak expression at late sporulation times. For example, peak expression of the bas0389/bas0390 determinants occurs broadly over the logarithmic and stationary growth phases and yet the BAS0390 protein is incorporated into the spore five hours into the sporulation process.

Spore formation is a highly ordered process. Loss of one protein, whether it be a structural or a nonstructural protein involved in the assembly process, potentially impacts incorporation of downstream proteins. Assembly of the exosporium is likely to involve the same degree of hierarchical protein interdependency. Evidence for this was seen with BAS1747 and the inverse relationship with BclB. Loss of BAS1747 resulted in elevated spore levels of BclB. Similarly, lack of BclB resulted in elevated expression of BAS1747 n the spores. The presence of BAS1747 in different molecular weight complexes that are stable to boiling in SDS and urea, provides a means to biochemically identify the interactive partner or partners of this spore protein.

Inactivation of the bas1747 determinant produced a subpopulation of spores exhibiting an exosporium assembly defect with multiple exosporium layers present. Assembly defects resulting in a double exosporium layer have been noted in exsM mutants of both B. cereus and B. anthracis (Fazzini et al., 2010). The multiple exosporium layers in both the exsM and bas1747 mutant spores retain the BclA nap. Thus the exosporium maturation process leading to nap formation occurs in an apparently normal fashion in these mutants. The similarity in phenotypes raises the possibility that ExsM and BAS1747 may function at the same stage in the exosporium assembly process.

The timing of expression, pattern of assembly, and effects on BclA all suggest that the products of the genes identified in this study are involved in exosporium assembly. The known exosporium proteins have expression patterns similar to BclA, driven off of σK promoter elements. Expansion of this genetic system should permit the identification of additional spore surface proteins which could serve as vaccine or diagnostic targets for exosporium-containing pathogens, as well as enhance the general understanding of the construction of this novel spore layer.

5. Conclusions

We have utilized the exosporium protein BclA as a target for a genetic screen to identify mutants of B. anthracis which exhibit defects in production of this outer spore nap layer. The system identifies mutants which affect the sporulation process after the expression of the bclA determinant and as such is enriched for mutants affecting maturation of the exosporium. Although many of the genes identified were not annotated as genes likely to be spore-associated, the mutated determinants characterized were found to affect BclA incorporation into the spore. In addition, the BAS1747 and BAS0390 proteins were found to be present in B. anthracis spores.

Highlights.

  • We describe a novel screen for identification of exosporium gene mutants of Bacillus anthracis

  • Mutants were generated by transposon mutagenesis

  • Mutants in specific genes were identified

  • Mutants were characterized to confirm their exosporium defect

Acknowledgments

We thank Chris Lorson for use of his microscopy facility, the University of Missouri EM Core for their assistance with the electron microscopy, and Dr. Linda Randall and her lab for their assistance with the BAS1747 protein purification. Supported in part by NIH grant AI101093 to GS.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Bailey-Smith K, Todd SJ, Southworth TW, Proctor J, Moir A. The ExsA protein of Bacillus cereus is required for assembly of coat and exosporium onto the spore surface. J Bacteriol. 2005;187 (11):3800–3806. doi: 10.1128/JB.187.11.3800-3806.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Beaman TC, Pankratz HS, Gerhardt P. Para-crystalline sheets re-aggregated from solubilized exosporium of Bacillus cereus. J Bacteriol. 1971;107 (1):320–324. doi: 10.1128/jb.107.1.320-324.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bergman NH, Anderson EC, Swenson EE, Niemeyer MM, Miyoshi AD, Hanna PC. Transcriptional profiling of the Bacillus anthracis life cycle in vitro and an implied model for regulation of spore formation. J Bacteriol. 2006;188 (17):6092–6100. doi: 10.1128/JB.00723-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boydston JA, Chen P, Steichen CT, Turnbough CL., Jr Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. J Bacteriol. 2005;187 (15):5310–5317. doi: 10.1128/JB.187.15.5310-5317.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Boydston JA, Yue L, Kearney JF, Turnbough CL., Jr The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. J Bacteriol. 2006;188 (21):7440–7448. doi: 10.1128/JB.00639-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bozue JA, Parthasarathy N, Phillips LR, Cote CK, Fellows PF, Mendelson I, Shafferman A, Friedlander AM. Construction of a rhamnose mutation in Bacillus anthracis affects adherence to macrophages but not virulence in guinea pigs. Microb Path. 2005;38 (1):1–12. doi: 10.1016/j.micpath.2004.10.001. [DOI] [PubMed] [Google Scholar]
  7. Brahmbhatt TN, Janes BK, Stibitz ES, Darnell SC, Sanz P, Rasmussen SB, O’Brien AD. Bacillus anthracis exosporium protein BclA affects spore germination, interaction with extracellular matrix proteins, and hydrophobicity. Infect Immun. 2007;75 (11):5233–5239. doi: 10.1128/IAI.00660-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chesnokova ON, McPherson SA, Steichen CT, Turnbough CL., Jr The spore-specific alanine racemase of Bacillus anthracis and its role in suppressing germination during spore development. J Bacteriol. 2008;191 (4):1303–1310. doi: 10.1128/JB.01098-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cybulski RJ, Jr, Sanz P, Alem F, Stibitz S, Bull RL, O’Brien AD. Four superoxide dismutases contribute to Bacillus anthracis virulence and provide spores with redundant protection from oxidative stress. Infect Immun. 2009;77 (1):274–285. doi: 10.1128/IAI.00515-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fazzini MM, Schuch R, Fischetti VA. A novel spore protein, ExsM, regulates formation of the exosporium in Bacillus cereus and Bacillus anthracis and affects spore size and shape. J Bacteriol. 2010;192 (15):4012–4021. doi: 10.1128/JB.00197-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Flannagan SE, Zitzow LA, Su YA, Clewell DB. Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid. 1994;32 (3):350–354. doi: 10.1006/plas.1994.1077. [DOI] [PubMed] [Google Scholar]
  12. Gawron-Burke C, Clewell DB. A transposon in Streptococcus faecalis with fertility properties. Nature. 1982;300 (5889):281–284. doi: 10.1038/300281a0. [DOI] [PubMed] [Google Scholar]
  13. Gerhardt P. Cytology of Bacillus anthracis. Fed Proc. 1967;26 (5):1504–1517. [PubMed] [Google Scholar]
  14. Gerhardt P, Ribi E. Ultra-structure of the exosporium enveloping spores of Bacillus cereus. J Bacteriol. 1964;88 (6):1774–1789. doi: 10.1128/jb.88.6.1774-1789.1964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Giorno R, Bozue J, Cote C, Wenzel T, Moody KS, Mallozzi M, Ryan M, Wang R, Zielke R, Maddock JR, Friedlander A, Welkos S, Driks A. Morphogenesis of the Bacillus anthracis spore. J Bacteriol. 2007;189 (3):691–705. doi: 10.1128/JB.00921-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Giorno R, Mallozzi M, Bozue J, Moody K, Slack A, Qui D, Wang R, Friedlander A, Welkos S, Driks A. Localization and assembly of proteins comprising the outer structures of the Bacillus anthracis spore. Microbiology. 2009;155 (4):1133–1145. doi: 10.1099/mic.0.023333-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hachisuka Y, Kojima K, Sato T. Fine filaments on the outside of the exosporium of Bacillus anthracis spores. J Bacteriol. 1966;91 (6):2382–2384. doi: 10.1128/jb.91.6.2382-2384.1966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ivins BE, Welkos SL, Knudson GB, LeBlanc DJ. Transposon Tn916 mutagenesis in Bacillus anthracis. Infect Immun. 1988;56 (1):176–181. doi: 10.1128/iai.56.1.176-181.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hilbert DW, Piggot PJ. Compartmentalization of gene expression during Bacillus subtilis spore formation. Microb Mol Biol Rev. 2004;68 (2):234–262. doi: 10.1128/MMBR.68.2.234-262.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Johnson MJ, Todd SJ, Ball DA, Shepherd AM, Sylvestre P, Moir A. ExsY and CotY are required for the correct assembly of the exosporium and spore coat of Bacillus cereus. J Bacteriol. 2006;188 (22):7905–7913. doi: 10.1128/JB.00997-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu H, Bergman NH, Thomason B, Shallom S, Hazen A, Crossno J, Rasko DA, Ravel J, Read TD, Peterson SN, Yates J, 3rd, Hanna PC. Formation and composition of the Bacillus anthracis endospore. J Bacteriol. 2004;186 (1):164–178. doi: 10.1128/JB.186.1.164-178.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. McPherson SA, Li M, Kearney JF, Turnbough CL., Jr ExsB, an unusually highly phosphorylated protein required for the stable attachment of the exosporium of Bacillus anthracis. Mol Microbiol. 2010;76 (6):1527–1538. doi: 10.1111/j.1365-2958.2010.07182.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ohye DF, Murrell WG. Exosporium and coat formation in Bacillus cereus. T J Bacteriol. 1973;115(3):1179–1190. doi: 10.1128/jb.115.3.1179-1190.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Oliva CR, Swiecki MK, Griguer CE, Lisanby MW, Bullard DC, Turnbough CL, Jr, Kearney JF. The integrin Mac-1 mediates internalization and directs Bacillus anthracis spores into professional phagocytes. Proc Natl Acad Sci USA. 2008;105 (4):1261–1266. doi: 10.1073/pnas.0709321105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Raines KW, Kang TJ, Hibbs S, Cao GL, Weaver J, Tsai P, Baillie L, Cross AS, Rosen GM. Importance of nitric oxide synthase in the control of infection by B. anthracis. Infect Immun. 2006;74 (4):2268–2276. doi: 10.1128/IAI.74.4.2268-2276.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Redmond C, Baillie LW, Hibbs S, Moir AJ, Moir A. Identification of proteins in the exosporium of Bacillus anthracis. Microbiology. 2004;150 (2):355–363. doi: 10.1099/mic.0.26681-0. [DOI] [PubMed] [Google Scholar]
  27. Severson KM, Mallozzi M, Bozue J, Welkos SL, Cote CK, Knight KL, Driks A. Roles of the Bacillus anthracis spore protein ExsK in exosporium maturation and germination. J Bacteriol. 2009;191(24):7587–7596. doi: 10.1128/JB.01110-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Smidt H, Song D, van Der Oost J, de Vos WM. Random transposition by Tn916 in Desulfitobacterium dehalogenans allows for isolation and characterization of halorespiration-deficient mutants. J Bacteriol. 1999;181 (22):6882–6888. doi: 10.1128/jb.181.22.6882-6888.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sousa JC, Silva MT, Balassa G. An exosporium-like outer layer in Bacillus subtilis spores. Nature. 1976;263 (5572):53–54. doi: 10.1038/263053a0. [DOI] [PubMed] [Google Scholar]
  30. Steichen C, Chen P, Kearney JF, Turnbough CL., Jr Identification of the immunodominant protein and other proteins of the Bacillus anthracis exosporium. J Bacteriol. 2003;185 (6):1903–1910. doi: 10.1128/JB.185.6.1903-1910.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Steichen CT, Kearney JF, Turnbough CL., Jr Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. J Bacteriol. 2005;187 (17):5868–5876. doi: 10.1128/JB.187.17.5868-5876.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Steichen C, Kearney JF, Turnbough CL., Jr Non-uniform assembly of the Bacillus anthracis exosporium and a bottle cap model for spore germination and outgrowth. Mol Microbiol. 2007;64 (2):359–367. doi: 10.1111/j.1365-2958.2007.05658.x. [DOI] [PubMed] [Google Scholar]
  33. Stragier P, Losick R. Molecular genetics of sporulation in Bacillus subtilis. Annu Rev Genet. 1996;30:297–341. doi: 10.1146/annurev.genet.30.1.297. [DOI] [PubMed] [Google Scholar]
  34. Sullivan MA, Yasbin RE, Young FE. New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene. 1984;29 (1–2):21–26. doi: 10.1016/0378-1119(84)90161-6. [DOI] [PubMed] [Google Scholar]
  35. Sylvestre P, Couture-Tosi E, Mock M. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol Microbiol. 2002;45 (1):169–178. doi: 10.1046/j.1365-2958.2000.03000.x. [DOI] [PubMed] [Google Scholar]
  36. Sylvestre P, Couture-Tosi E, Mock M. Polymorphism in the collagen-like region of the Bacillus anthracis BclA protein leads to variation in exosporium filament length. J Bacteriol. 2003;185 (5):1555–1563. doi: 10.1128/JB.185.5.1555-1563.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sylvestre P, Couture-Tosi E, Mock M. Contribution of ExsFA and ExsFB proteins to the localization of BclA on the spore surface and to the stability of the Bacillus anthracis exosporium. J Bacteriol. 2005;187 (15):5122–5128. doi: 10.1128/JB.187.15.5122-5128.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tam C, Glass EM, Anderson DM, Missiakas D. Transposon mutagenesis of Bacillus anthracis strain Sterne using Bursa aurealis. Plasmid. 2006;56 (1):74–77. doi: 10.1016/j.plasmid.2006.01.002. [DOI] [PubMed] [Google Scholar]
  39. Tan L, Turnbough CL., Jr Sequence motifs and proteolytic cleavage of the collagen-like glycoprotein BclA required for its attachment to the exosporium of Bacillus anthracis. J Bacteriol. 2010;192 (5):1259–1268. doi: 10.1128/JB.01003-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tan L, Li M, Turnbough CL., Jr An unusual mechanism of isopeptide bond formation attaches the collagenlike glycoprotein BclA to the exosporium of Bacillus anthracis. mBio. 2011;2 (3):e00084–11. doi: 10.1128/mBio.00084-11. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  41. Thompson BM, Binkley JM, Stewart GC. Current physical and SDS extraction methods do not efficiently remove exosporium proteins from Bacillus anthracis spores. J Microbiol Meth. 2011a;85:143–148. doi: 10.1016/j.mimet.2011.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Thompson BM, Hoelscher BC, Driks A, Stewart GC. Localization and assembly of the novel exosporium protein BetA of Bacillus anthracis. J Bacteriol. 2011b;193 (19):5098–5104. doi: 10.1128/JB.05658-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Thompson BM, Hoelscher BC, Driks A, Stewart GC. Assembly of the BclB glycoprotein into the exosporium and evidence for its role in the formation of the exosporium “cap” structure in Bacillus anthracis. Mol Microbiol. 2012;86 (5):1073–1084. doi: 10.1111/mmi.12042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Thompson BM, Hsieh HY, Spreng K, Stewart GC. Co-dependency of BxpB/ExsFA and BclA for proper incorporation into the exosporium of Bacillus anthracis. Mol Microbiol. 2011c;79 (3):799–813. doi: 10.1111/j.1365-2958.2010.07488.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Thompson BM, Stewart GC. Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface. Mol Microbiol. 2008;70 (2):421–434. doi: 10.1111/j.1365-2958.2008.06420.x. [DOI] [PubMed] [Google Scholar]
  46. Thompson BM, Waller LN, Fox KF, Fox A, Stewart GC. The BclB glycoprotein of Bacillus anthracis is involved in exosporium integrity. J Bacteriol. 2007;189 (18):6704–6713. doi: 10.1128/JB.00762-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Todd SJ, Moir AJ, Johnson MJ, Moir A. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J Bacteriol. 2003;185 (11):3373–3378. doi: 10.1128/JB.185.11.3373-3378.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Waller L, Fox N, Fox KF, Fox A, Price RL. Ruthenium red staining for ultrastructural visualization of a glycoprotein layer surrounding the spore of Bacillus anthracis and Bacillus subtilis. J Microbiol Meth. 2004;58 (1):23–30. doi: 10.1016/j.mimet.2004.02.012. [DOI] [PubMed] [Google Scholar]
  49. Waller LN, Stump MJ, Fox KF, Harley WM, Fox A, Stewart GC, Shahgholi M. Identification of a second collagen-like glycoprotein produced by Bacillus anthracis and demonstration of associated spore-specific sugars. J Bacteriol. 2005;187(13):4592–4597. doi: 10.1128/JB.187.13.4592-4597.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Weaver J, Kang TJ, Raines KW, Cao GL, Hibbs S, Tsai P, Baillie L, Rosen GM, Cross AS. Protective role of Bacillus anthracis exosporium in macrophage-mediated killing by nitric oxide. Infect Immun. 2007;75(8):3894–3901. doi: 10.1128/IAI.00283-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wilson AC, Perego M, Hoch JA. New transposon delivery plasmids for insertional mutagenesis in Bacillus anthracis. J Microbiol Methods. 2007;71(3):332–335. doi: 10.1016/j.mimet.2007.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES