Innate Immune Responses to TLR2 and TLR4 Agonists Differ between Baboons, Chimpanzees and Humans

Abstract

Background

African catarrhine primates differ in bacterial disease susceptibility.

Methods

Human, chimpanzee, and baboon blood was stimulated with TLR-detected bacterial agonists and cytokine/chemokine induction assessed by real-time pcr.

Results

Humans and chimpanzees shared similar cytokine/chemokine responses, while baboon cytokine/chemokine induction differed. Generally, responses were agonist-independent.

Conclusions

These primates tend to generate species rather than agonist–specific responses to bacterial agonists.

As African catarrhines, the common chimpanzee (Pan troglodytes) and baboon (Papio sp.) share 98.6% and 94% of their genomes, respectively, with humans and are considered important models of human infectious disease [4, 6, 20]. However, these species exhibit very different susceptibility to infectious bacterial pathogens that are associated, in humans, with marked dysregulation of early inflammatory responses [5, 7, 10, 12, 25]. For example, humans and chimpanzees require only small doses (i.e. 2-5 ng/kg) of Gram-negative bacteria or cell wall component lipopolysaccharide (LPS) to initiate severe bacterial sepsis, while baboons and other old world monkey species require much higher doses (0.1 mg/kg) [7, 18, 22, 24]. Similarly, humans and chimpanzees are very susceptible to Neisseria gonorrhea infections, while baboons and most other mammals are resistant [12]. Though less well understood, mycobacterial infections have been noted to rapidly progress in baboons and other old world monkeys [9, 16, 26]. The host factors responsible for disparate bacterial infection susceptibility in catarrhine primates [humans, apes, and old world monkeys (i.e. baboons, macaques)] are not well understood, though blood leukocyte reactivity to immune stimuli during early infection appears to differ between such species [2, 19, 24]. One possible explanation for disparate bacterial infection susceptibility between human, chimpanzees and baboons is inter-species differences in the initiation of the early innate immune responses.

The first two hours of infection in mammalian hosts is marked by an immediate induction of a core set of innate immune genes (i.e. cytokines and chemokines) that appear to exert control over the initial infection course and may affect disease susceptibility [8, 15]. Toll-like receptors (TLRs) are innate immune system receptors that assist in initiating this highly organized early innate immune response by recognizing pathogen-associated molecular patterns (PAMPs) and triggering immune gene induction. TLR2 recognizes lipoproteins and lipopeptides from Gram-positive bacteria, mycobacteria, fungi and parasites while TLR4 interacts with lipopolysaccharide LPS from Gram-negative bacteria [3, 13, 21]. Given the importance of chimpanzee and baboon models in understanding human disease course, comparative data on early TLR-mediated responses to bacterial PAMPs may contribute to a better understanding of the host factors responsible for inter-species differences in bacterial disease susceptibility. This study compares and contrasts the induction profile of chemokines and cytokines associated with the early innate immune response in humans, chimpanzees and baboons after stimulation with TLR2 and 4-detected PAMPs.

To investigate catarrhine early innate immune responses to TLR-detected bacterial PAMPs fresh blood from unrelated, healthy, adult humans (City College of New York IRB # 09-0073C), chimpanzees (Yerkes National Primate Research Center, Atlanta, Georgia) and baboons (Texas Biomedical Research Institute, San Antonio, Texas) was stimulated at 37°C for 90 minutes with ten fold serial dilutions of 10 ug/ml – 0.01 ug/ml of TLR2 and TLR4-detected PAMPs [Pam3CSK4, lipomannan from Mycobacterium smegmatis (LMMS), Ultrapure lipopolysaccharide from Escherichia coli 0111:B4 (LPS), Invivogen, San Diego, CA]. Chimpanzee and baboon blood samples were humanely collected in accordance with individual institutional IACUC requirements. After 90 minutes, red blood cells were lysed by hypotonic shock and total blood leukocyte total RNA isolated to synthesize cDNA (Qiagen RNEasy mini-kit, Quantitect Reverse Transcriptase kit, Qiagen San Diego, CA). Real-time pcr was performed using 0.1 uM of primers corresponding to conserved regions of cytokine/chemokine genes of all three species (Table 1). Reaction specificity was confirmed by DNA sequencing of the amplicons. Relative gene induction was calculated using the Pfaffl equation corrected for primer efficiency, and three reference genes (GAPDH, ACTB, B2M) [17] [23].

Table 1.

Genes, primer sequences and annealing sites

Symbol	Forward Primer	Reverse Primer	NCBI accession numbers	Gene Category
GAPDH Homo sapiens Pan troglodytes Papio anubis	5′-GAGTCAACGGATTTGGTCGT -3′ .......................................... ..........................................	5′- TTGATTTTGGAGGGATCTCG- 3′ .......................................... ..........................................	NM_002046.3 XM_001162023.1/XM_001162057.1/XM_001162096.1/XM_508955.2 AY179885.1	Reference
ACTB Homo sapiens Pan troglodytes Papio hamadryas	5′- GGCATCCACGAAACTACCTT -3′ .......................................... ..........................................	5′- CTTGCTGATCCACATCTGCT -3′ .......................................... ..........................................	NM_001101.3 NM_001009945.1 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Reference
B2M Homo sapiens Pan troglodytes Papio hamadryas	5′- GCTATCCAGCGTACTCCAAA- 3′ .......................................... ..........................................	5′- AAGACAAGTCTGAATGCTCC -3′ .......................................... ..........................................	NM_004048.2 NM_001009066.1 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Reference
IFNγ Homo sapiens Pan trogolodytes Papio anubis	5′- ACTGCCAGGACCCATATGTA - 3′ .......................................... ..........................................	5′- CCTTGATGGTCTCCACACTC -3′ .......................................... ..........................................	NM_000619.2 XM_001151968.1 AY234217.1	Interferon
IL-1RN Homo sapiens Pan troglodytes Papio hamadryas	5′- AAGATGTGCCTGTCCTGTGT -3′ .......................................... ..........................................	5′- GCTCAGGTCAGTGATGTTAA -3′ .......................................... ..........................................	NM_173842.1/NM_173841.1/ NM_000577.3/ NM_173843.1 XM_001147673.1/XM_001147825.1/ XM_001147954.1/ XM_515698.2 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Cytokine
TNFα Homo sapiens Pan troglodytes Papio ursinus	5′- CAGACCAAGGTCAACCTCCT-3′ .......................................... ..........................................	5′- AGACTCGGCAAAGTCGAGAT-3′ .......................................... ..........................................	NM_000594.2 XM_001152827.1 AF019963.1	Cytokine
IL-1β Homo sapiens Pan troglodytes Papio hamadryas	5′- GCTTGGTGATGTCTGGTCCA -3′ .......................................... ..........................................	5′- GAGGCCCAAGGCCACAGGTA-3′ ........................................... ...........................................	NM_000576.2 XM_001146864.1/XM_001146939.1/XM_001147075.1/ XM_515697.2 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Cytokine
IL-6 Homo sapiens Pan troglodytes Papio hamadryas	5′- CTGGCAGAAAACAACCTGAA - 3′ .......................................... ..........................................	5′- GCAGGAACTGGATCAGGACT – 3′ .......................................... ..........................................	NM_000600.3 XM_001154396.1/XM_001154511.1/XM_518992.2 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Cytokine
IL-10 Homo sapiens Pan troglodytes Papio hamadryas	5′- CCAAGCCTTGTCTGAGATGA - 3′ .......................................... ..........................................	5′- GCCTTGCTCTTGTTTTCACA- 3′ .......................................... ..........................................	NM_000572.2 XM_525040.2 AY796417.1	Cytokine
IL-12A Homo sapiens Pan trogolodytes Papio anubis	5′- GAGTTCAAGACCATGAATGC -3′ .......................................... ..........................................	5′- TGGCACAGTCTCACTGTTGA -3′ .......................................... ..........................................	NM_000882.2 XM_001156599.1/ XM_516846.2 NM_001112637.1	Cytokine
CCL2 Homo sapiens Pan troglodytes Papio hamadryas	5′- GCTCATAGCAGCCACCTTCA -3′ .......................................... ..........................................	5′ - GGAATCCTGAACCCACTTCT -3′ .......................................... ..........................................	NM_002982.3 XM_001174545.1/XM_001174551.1 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Chemokine
CCL3 Homo sapiens Pan troglodytes Papio hamadryas	5′-TTGCTGTCCTCCTCTGCACC -3′ .......................................... ..........................................	5′-GCTATGAAATTCTGTGGAAT -3′ .......................................... ..........................................	NM_002983.2 NM_001034082.1 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Chemokine
IL-8/CXCL8 Homo sapiens Pan troglodytes Papio hamadryas	5′- TGATAAATTTGGGGTGGAAA -3′ .......................................... ..........................................	5′- GTTTTGCCAAGGAGTGCTAA -3′ .......................................... ..........................................	NM_000584.2 XM_001156375.1/ XM_001156432.1/ XM_526587.2 Papio hamadryas genome Nov. 2008 Pham_1.0 *	Chemokine

Of 14 genes tested by this method eight showed at least two-fold induction and notable differences between species, even though there were no obvious differences in the proportions of neutrophils, lymphocytes, monocytes and basophils/eosinophils between the species (Wright-Giemsa method, data not shown). The most striking differences were among the three chemokines CXCL2, IL-8/CXCL8 and CCL3. Whereas baboons expressed high levels of CXCL2 and low levels of IL-8/CXCL8 and CCL3, this pattern was reversed for humans and chimpanzees where most humans and all chimpanzees expressed significantly higher levels of IL-8/CXCL8 and CCL3 than CXCL2 (A panels). This pattern of chemokine induction was observed for all three PAMPs and was seen even at low doses of PAMP (0.01 ug/ml, data not shown). Though a subset of chemokines, species-specific induction of these cellular chemoattractants suggests that baboon and hominoid cellular responses to bacterial infection may differ, as CXCL2 and IL-8 attract mainly neutrophils and CCL3 is a chemoattractant for a broader range of cell subtypes.

A comparison of the pro-inflammatory cytokine responses, IL-1β, TNFα and IL-6, revealed that humans expressed appreciably lower levels of IL-1β and TNFα than did chimpanzees and baboons with the exception of the TNFα response to LPS which was similar for all three species (B panels). The IL-6 response, which was strikingly high for all three species, tended to be lower for baboons than for humans and chimpanzees, especially in response to LPS. These relationships were observed even at low doses of PAMPs (0.01 ug/ml, data not shown).

An analysis of the anti-inflammatory cytokine responses, IL-10 and IL-1RN, also revealed striking differences between the three species. Baboons expressed very liitle IL-1RN compared to humans and chimpanzees, irrespective of the PAMPs employed (C panels). In contrast, the IL-10 response was similar for all three species with the baboon response being somewhat greater than the responses of humans and chimpanzees. Again, these relationships were conserved even at low doses of PAMPs (data not shown).

In summary, this study suggests that the early innate immune responses of humans, chimpanzees, and baboons to TLR2 and TLR4-detected PAMPs differ, with the patterns, in general, being species-specific rather than agonist-specific. These species differences in cytokine/chemokine induction may affect immune cell activation and trafficking. Interestingly, the disparate baboon and hominoid cytokine/chemokine responses noted here agree with observations that cercopithecoid (old world monkey) and hominoid diverge in susceptibility to bacterial infections. It is interesting, for example, that baboon IL-8/CXCL8 and IL-6 induction tends to be minimal, as high levels of these proteins during early severe sepsis have been correlated with negative clinical outcomes [11, 14].

These studies are an early step in improving our understanding of African catarrhine innate immune responses to bacteria. As these non-human primates are important biomedical models for human medicine, it is very important to highlight inter-species differences in early innate immune function. The results of this study may help to explain inter-species differences in susceptibility to major human bacterial-mediated diseases.

FIGURE 1.

African catarrrhine early cytokine and chemokine responses to stimulation with TLR2 and TLR4 PAMPs. Human (orange squares), chimpanzee (blue circles) and baboon (black diamonds) blood was stimulated with LPS from E. coli 0111:B4, LMMS and Pam3CSK4 for 90 minutes and chemokine/cytokine induction was quantified by real-time PCR. 10 ug dose shown as Log base 2 here. Colored bars represent standard error of the mean (SEM), while black bars represent the mean. Dots in the scatter represent different individuals. Pairwise comparisons of significant different in gene induction were completed by unpaired t-tests [<0.05, unless otherwise noted. P value pairwise by PAMP was non significant for CXCL2 – LPS: H-B, LMMS: H-C, Pam3CSK4: H-C; for IL-8/CXCL8 - Pam3CSK4: H-B; for CCL3 – LPS: H-C, LMMS: H-C, H-B, Pam3CSK4: H-C, C-B, H-B; for IL-1β - LPS: H-B, Pam3CSK4: C-B; for IL-6 – LPS: H-C, LMMS: H-C, Pam3CSK4: H-C, C-B, H-B; TNFα -LPS: H-B, LMMS: H-C, C-B, Pam3CSK4: C-B; for IL-1RN – LPS: H-C, Pam3CSK4: H-C; for IL-10 – LPS: C-B, LMMS: H-C, Pam3CSK4: H-C; where human (H), chimpanzee (C ) and baboon (B)]