Abstract
Creutzfeldt-Jakob disease (CJD), included in the human transmissible spongiform encephalopathies (TSE), is widely known to be caused by an abnormal accumulation of misfolding prion protein in the brain. Human prion protein gene (PRNP) is mapped in chromosome 20p13 and many single nucleotide polymorphisms (SNPs) in PRNP have been discovered. However, the functionality of SNPs in PRNP is yet unclear, though several SNPs have been known as important mutation related with susceptibility human prion diseases. Our aim is to identify specific genotype patterns and characteristics in the PRNP genomic region and to understand susceptibility among Korean discriminated prion disease patients, suspected CJD patients and the KARE data group. Here, we have researched genotypes and SNPs allele frequencies in PRNP in discriminated prion disease patients group (n = 22), suspected prion diseases patients group (n = 163) and the Korea Association REsource (KARE) data group (n = 296) in Korea. The sequencing regions were promoter region, exon1 and exon2 with their junction parts among 481 samples. A total of 25 SNPs were shown in this study. Nucleotide frequencies of all SNPs are exceedingly tended to bias toward dominant homozygote types except in rs2756271. Genotype frequencies at codon 129 and 219 coding region were similar with previous studies in Korea and Japan. Pathogenic mutations such as 102P/L, 200E/K and 203V/I were observed in discriminated CJD patients group, and 180V/I and 232M/R were shown in suspected prion disease patients group and the KARE data group. A total of 10 SNPs were newly identified, six in the promoter region, one in exon 2 and three in the 3′ UTR. The strong and unique linkage disequilibrium (D' = 0.94, r2 = 0.89) was observed between rs57633656 and rs1800014 which is located in codon 219 coding region. We expect that these data can be provided to determine specific susceptibility and a protective factor of prion diseases not only in Koreans but also in East Asians.
Keywords: Creutzfeldt-Jakob disease, PRNP, human transmissible spongiform encephalopathies, linkage disequilibrium, single nucleotide polymorphisms
Introduction
The human prion diseases are caused by an abnormal accumulation of misfolding prion protein in the brain. Creutzfeldt–Jakob disease (CJD), kuru, Gerstmann–Sträussler–Scheinker disease (GSS) and fatal familial insomnia (FFI) are included in the human prion diseases. Human prion protein contains 253 amino acids and is coded in exon 2 of the prion protein gene (PRNP), which is located on chromosome 20p13. A large number of mutations and polymorphisms in PRNP have been observed in genetic prion diseases cases, and some of them have been reported to susceptible factors in sporadic CJD (sCJD) cases.
Polymorphisms at codon 129 have been reported to be associated with susceptibility to human prion diseases.1 All of patients with variant CJD (vCJD) have 129M/M, and the frequency of the 129M/M genotype is higher in patients with sCJD than in healthy controls.2,3 Most patients with early-onset kuru are also 129 M/M homozygotes, but most late-onset kuru patients are 129 M/V heterozygotes. Thus, 129 codon polymorphisms are associated with the susceptibility to and the incubation period of human prion diseases.4,5
A polymorphism at codon 219 (219E/K) in PRNP has been reported as protective against sporadic CJD in East Asians. Non-sCJD patients tend to be E/K heterozygous at codon 219, whereas sCJD patients tend not to be heterozygous for 219E/K.6-8
102E/K heterozygosity have been known as a pathogenic mutation of GSS, one genetic form of prion diseases, and 117A/V and 131G/V have also have been reported to GSS-associated pathogenic mutations.9-12 Codon 178D/N mutation of the prion protein has been reported as pathogenic mutation not only in FFI but also in a subtype of fCJD.13-16 However, these two diseases can be segregated with polymorphism at codon 129 of the prion protein gene. FFI was associated with methoinine at codon 129, whereas fCJD with 178D/N of prion protein was related to valine at codon 129 of prion protein. 200E/K heterozygosity is also significantly linked with familial CJD.17
Promoter regions are binding sites of transcriptional regulatory proteins and play a key role in regulating gene expression. A survey of the patterns of SNPs in the PRNP promoter region is important for understanding human prion diseases. Many SNPs, such as rs2756271, have been identified in the PRNP promoter region, and some of these SNPs had strong linkage disequilibrium (LD) with codon 129 or were associated with sCJD in a case–control study.18
In Korea, several polymorphisms and mutations in the coding region of PRNP have been found in prion diseases patients. In these studies, all Korean sCJD patients were homozygotes for codon 129 M/M and 219 E/E, and their polymorphisms frequencies were similar to those of a previous study of the Japanese population.19 178D/N, 200E/K, and 232M/R were found in probable sCJD patients,20 and 102P/L was found in one definite GSS patient in Korea.21 The promoter region SNPs have been identified and studied, but the SNPs in the promoter region associated with prion diseases have not been found in Korea.22,23
Susceptibility to human prion diseases is related to polymorphisms and mutations in PRNP, and the genotype frequencies vary by geographic region. Our aim in the present study was to identify specific genotype patterns and characteristics in the promoter region and exons 1 and 2, and to compare these among discriminated prion disease patients group, suspected CJD patients group and KARE data group in Korea.
Results
Most of the PRNP sequences were highly conserved, but 25 SNPs were found in this study, and 11 were found in the promoter region, 10 were found in the protein coding region, and four were found in the 3′ untranslated region (UTR) in the human PRNP (Tables 1 and 2). The nucleotide sequences in exon 1 were completely conserved, and none of the SNPs in exon 1 were detected among 481 individuals in our study. All SNPs were in HWE and the MAF less than 5% except for rs2756271. The nucleotide frequencies of the other 24 SNPs showed a tendency toward dominant homozygote types. A total of 10 newly identified SNPs (six in the promoter region, one in exon 2, and three in the 3′ UTR) were detected in this study; these are marked by asterisks in Table 2. The minor allele frequencies of all of these SNPs were less than 5%.
Table 1. Relevant information of 25 SNPs.
| SNP ID | Chr | Chr. Position | rs number |
|---|---|---|---|
| -14914A/G |
20 |
4,664,953 |
|
| -14900C/T |
20 |
4,664,967 |
|
| -14861T/C |
20 |
4,665,006 |
|
| -14807C/T |
20 |
4,665,060 |
rs77420351 |
| -14801C/A |
20 |
4,665,066 |
|
| -14605A/G |
20 |
4,665,262 |
rs2756271 |
| -14409C/T |
20 |
4,665,458 |
|
| -13758G/T |
20 |
4,666,109 |
rs57633656 |
| -13537A/T |
20 |
4,666,330 |
rs73612131 |
| -13464A/G |
20 |
4,666,403 |
|
| -13211G/A |
20 |
4,666,656 |
rs141381997 |
| P68P |
20 |
4,680,070 |
rs140330579 |
| N97S |
20 |
4,680,156 |
rs56362942 |
| P102L |
20 |
4,680,171 |
rs74315401 |
| M129V |
20 |
4,680,251 |
rs1799990 |
| V180I |
20 |
4,680,404 |
rs74315408 |
| N197N |
20 |
4,680,457 |
|
| E200K |
20 |
4,680,464 |
rs28933385 |
| V203I |
20 |
4,680,473 |
|
| E219K |
20 |
4,680,521 |
rs1800014 |
| M232R |
20 |
4,680,561 |
rs74315409 |
| 848T/C |
20 |
4,680,714 |
|
| 1896A/T |
20 |
4,681,762 |
|
| 1898A/T |
20 |
4,681,764 |
|
| 2174A/T | 20 | 4,682,040 | rs150850205 |
Table 2. SNPs positions and allele frequencies in PRNP.
| SNP ID |
Region |
Variant |
Group |
Allele frequency |
HW P |
MAF |
||
|---|---|---|---|---|---|---|---|---|
| (n) |
value |
|||||||
| X/Y | XX | XY | YY | |||||
| -14914A/G* |
Promoter |
A/G |
Patients groupa |
22 |
0 |
0 |
1 |
0 |
| Suspected patientsb |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data groupc |
294 |
1 |
0 |
1 |
0.002 |
|||
| -14900C/T* |
Promoter |
C/T |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
294 |
1 |
0 |
1 |
0.002 |
|||
| -14861T/C* |
Promoter |
T/C |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
294 |
1 |
0 |
1 |
0.002 |
|||
| -14807C/T |
Promoter |
C/T |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs77420351) |
Suspected patients |
158 |
4 |
0 |
1 |
0.012 |
||
| |
KARE data group |
292 |
3 |
0 |
1 |
0.005 |
||
| -14801C/A* |
Promoter |
C/A |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
161 |
1 |
0 |
1 |
0.003 |
|||
| KARE data group |
296 |
0 |
0 |
1 |
0 |
|||
| -14605A/G |
Promoter |
A/G |
Patients group |
11 |
7 |
4 |
0.308 |
0.341 |
| (rs2756271) |
Suspected patients |
73 |
66 |
24 |
0.2 |
0.35 |
||
| |
KARE data group |
102 |
144 |
42 |
0.538 |
0.396 |
||
| -14409C/T* |
Promoter |
C/T |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
294 |
1 |
0 |
1 |
0.002 |
|||
| -13758G/T |
Promoter |
T/G |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs57633656) |
Suspected patients |
153 |
10 |
0 |
1 |
0.031 |
||
| |
KARE data group |
269 |
24 |
1 |
0.888 |
0.044 |
||
| -13537A/T |
Promoter |
A/T |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs73612131) |
Suspected patients |
152 |
9 |
1 |
0.32 |
0.034 |
||
| |
KARE data group |
276 |
19 |
0 |
1 |
0.032 |
||
| -13464A/G* |
Promoter |
A/G |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
294 |
1 |
0 |
1 |
0.002 |
|||
| -13211G/A |
Promoter |
G/A |
Patients group |
19 |
2 |
0 |
1 |
0.048 |
| (rs141381997) |
Suspected patients |
160 |
2 |
0 |
1 |
0.006 |
||
| |
KARE data group |
282 |
11 |
0 |
0.253 |
0.022 |
||
| P68P |
Coding |
T/C |
Patients group |
22 |
0 |
0 |
1 |
0 |
| (rs140330579) |
Suspected patients |
161 |
2 |
0 |
1 |
0.006 |
||
| |
KARE data group |
290 |
3 |
0 |
1 |
0.005 |
||
| N97S |
Coding |
G/A |
Patients group |
22 |
0 |
0 |
1 |
0 |
| (rs56362942) |
Suspected patients |
163 |
0 |
0 |
1 |
0 |
||
| |
KARE data group |
292 |
1 |
0 |
1 |
0.002 |
||
| P102L |
Coding |
C/T |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs74315401) |
Suspected patients |
163 |
0 |
0 |
1 |
0 |
||
| |
KARE data group |
293 |
0 |
0 |
1 |
0 |
||
| M129 V |
Coding |
A/G |
Patients group |
20 |
2 |
0 |
1 |
0.045 |
| (rs1799990) |
Suspected patients |
155 |
8 |
0 |
1 |
0.025 |
||
| |
KARE data group |
276 |
17 |
0 |
1 |
0.029 |
||
| V180I |
Coding |
G/A |
Patients group |
22 |
0 |
0 |
1 |
0 |
| (rs74315408) |
Suspected patients |
160 |
3 |
0 |
1 |
0.009 |
||
| |
KARE data group |
292 |
2 |
0 |
1 |
0.003 |
||
| N197N* |
Coding |
C/T |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
293 |
1 |
0 |
1 |
0.002 |
|||
| E200K |
Coding |
G/A |
Patients group |
20 |
2 |
0 |
1 |
0.045 |
| (rs28933385) |
Suspected patients |
161 |
0 |
0 |
1 |
0 |
||
| |
KARE data group |
294 |
0 |
0 |
1 |
0 |
||
| V203I |
Coding |
G/A |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| Suspected patients |
162 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
294 |
0 |
0 |
1 |
0 |
|||
| E219K |
Coding |
G/A |
Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs1800014) |
Suspected patients |
151 |
11 |
0 |
1 |
0.034 |
||
| |
KARE data group |
270 |
23 |
1 |
0.826 |
0.043 |
||
| M232R |
Coding |
T/G |
Patients group |
22 |
0 |
0 |
1 |
0 |
| (rs74315409) |
Suspected patients |
160 |
1 |
0 |
1 |
0.003 |
||
| |
KARE data group |
291 |
3 |
0 |
1 |
0.005 |
||
| 848T/C* |
3`UTR |
T/C |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
163 |
0 |
0 |
1 |
0 |
|||
| KARE data group |
293 |
1 |
0 |
1 |
0.002 |
|||
| 1896A/T* |
3`UTR |
T/A |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
162 |
1 |
0 |
1 |
0.003 |
|||
| KARE data group |
295 |
0 |
0 |
1 |
0 |
|||
| 1898A/T* |
3`UTR |
T/A |
Patients group |
22 |
0 |
0 |
1 |
0 |
| Suspected patients |
160 |
1 |
0 |
1 |
0.003 |
|||
| KARE data group |
295 |
0 |
0 |
1 |
0 |
|||
| 2174A/T |
3`UTR | T/A | Patients group |
21 |
1 |
0 |
1 |
0.023 |
| (rs150850205) |
Suspected patients |
151 |
9 |
0 |
1 |
0.028 |
||
| KARE data group | 280 | 14 | 0 | 1 | 0.024 | |||
a Four definite prion disease patients and 18 probable sCJD patients were discriminated included in this group; bFour possible sporadic CJD patients and 159 suspected patients were sorted as suspected patients group; c296 individuals were randomly selected from 10,038 participants from the Korea Association Resource (KARE) project.
The allele frequencies of codon 129, which is thought to be related with susceptibility in several different prion diseases, were as follows: in the discriminated prion disease patients group, 90.91% were M/M, 9.09% were M/V; in the suspected CJD patients group, 95.09% were M/M, 4.91% were M/V; in the KARE data group, 94.20% were M/M, 5.8% were M/V. The allele frequencies of codon 219E/K (GAG > AAG) non-synonymous polymorphism, were as follows: in the discriminated prion disease patients group, 95.45% were E/E, 4.55% were E/K; in the suspected CJD patients groups, 93.21% were M/M, 6.79% were E/K; in the KARE data group, 91.84% were E/E, 7.82% were E/K, and one individual (0.34%) were quite rare codon 219K/K homozygotes.
The codon 102P/L known as pathogenic mutation of GSS of genetic prion diseases was found in one definite GSS patient. The codon 200E/K (GAG > AAG) pathogenic mutation was found in two probable CJD patients, and one probable sCJD patient also were 129M/V (ATG > GTG) polymorphism. The codon 203V/I (GTT > ATT) mutation was found only in one probable CJD patient. Codon 180V/I and 232M/R were not only found in suspected CJD patients but also found in KARE data group. A total of three suspected CJD patients with 180V/I and one suspected CJD patient with 232M/R were found in this study, whereas two individuals were 180V/I and three individuals were 232M/R in KARE data group.
Of two synonymous changes, 68P/P and novel 197N/N, the former was found in two suspected CJD patients and three individuals in KARE data group and the latter was found in one individual in KARE data group in this study.
Five novel SNPs such as -14914A/G, -14900C/T, -14861T/C, -14409C/T and -13464A/G were found only in KARE date group and one novel SNP, -14801C/A was found only in one suspected CJD patient. Four SNPs were found in 3`UTR. 848T/C was found in one of KARE data group, 1896A/T and 1898A/T were found in suspected CJD patients only. 2174A/T was observed in all three groups
The LDs were estimated for all pairs of SNP markers identified in this study. A strong LD was observed between rs57633656 and rs1800014 (D´ = 0.94, r2 = 0.89) (Fig. 1). A nucleotide change (G > A) at the position on rs1800014 located in the 219 codon-coding region leads to an amino acid change (GAG > AAG, E to K). The distance between the sites is 14,142 bp. Other LD blocks were not significant (r2 = 0.0–0.065).
Figure 1. Thin black line stands for promoter region and intronic regions. The two bold black squares mean exons. Two slim red bars on the black line represent sequencing regions in the study. Each SNP positions are shown at above of figure. r2 value between all 25 single nucleotide polymorphisms (SNPs) in PRNP is displayed in each diamond of the triangle LD plot. Each diamond block number means r2 value which is multiplied by 100. Color of each diamond block also stands for r2 value. Their colors have gradient from white (r2 = 0) to black (r2 = 1).
Discussion
Our study is the first investigation of SNPs in the human PRNP genomic region (promoter, exons 1 and 2) that compares in Korean. There have been several studies in Korea that mainly analyzed the human prion protein coding region in PRNP. We analyzed the genotype patterns in the discriminated prion disease patients, suspected CJD patients group and the KARE data group, and reported the non-pathogenic polymorphisms and pathogenic mutations in prion diseases.
129M/V and 219E/K have been known as non-pathogenic polymorphisms at prion diseases, and most of the prion diseases patients have been reported to be codon 129M/M and 219E/E homozygous.1-3 These SNPs allele frequencies in 296 individuals in KARE data group in this study were almost same as previous studies in Korea and Japan.19,24-26 In sporadic CJD (sCJD) patients, methionine homozygosity at codon 129 was 100% in Korea19 and 96.84% in Japan.27
In our study, the allele frequency of methionine homozygosity at codon 129 in discriminated sCJD patients (90.48%) was lower than that of previous studies mentioned above. However, discriminated CJD cases are too small (only 21 cases) to know precise allele frequencies at codon 129 in sCJD patients in this study. It is hard to diagnose definitely because brain autopsies are rarely performed in Korea for a traditional funeral, although brain autopsy is the only way to definitively confirm human prion diseases. Whereas, the reports of discriminated cases keep increasing year after year, we expect that susceptibility related genotype patterns and characteristics in Korean prion diseases patients will be revealed from five to ten years from now.
Codon 180V/I and 232M/R are known as pathogenic mutations in prion diseases.9,17,28 Especially in Japan, 180V/I and 232M/R were found in regarding genetic form CJD patients.27 Although 180V/I and 232M/R were also observed in suspected CJD patients in our study, we couldn’t get family history for neurodegenerative disorder due to hesitating to open their potential medical history. Rapid cognitive decline was commonly observed in suspected CJD patients with 180V/I. Dementia, ataxia, myoclonus and mutism were observed in one suspected CJD patient with 232M/R. The EEG and 14–3-3 data are similar to sCJD patients.
Interestingly, these were also found in KARE data group. One individual with 180V/I in KARE data group have family history related with dementia. However, all two individuals with 180V/I have not been displayed characteristics or symptoms of neurodegenerative disorder. Two individuals with 232M/R in KARE data group have been suffering from insomnia, but no have family histories related with neurodegenerative disorder. We also suggest that 180V/I and 232M/R heterozygosity are not pathogenic factors but rarely observed polymorphisms as previous study.29 Therefore, we consider that further follow-up studies are needed to between CJD patient and healthy individuals with these factors to clarify their ethnic epidemiological characteristics.
Sporadic CJD patients with 68P/P have been reported rarely,30 and 197N/N synonymous change has not been reported. Dementia and hyponatremia were observed in one suspected CJD patient with 68P/P synonymous change. However 14-3-3 data was negative in two suspected CJD patients with 68P/P synonymous change, thus they can be classified with another form of degenerative brain diseases. One individual in KARE data group with 68P/P synonymous change had family history related with stroke, but characteristics or symptoms of neurodegenerative disorder were not observed. These synonymous changes cannot make structural change to the prion protein itself subsequently this polymorphisms change would not directly affect prion protein misfolding, and we speculate possibility that these synonymous changes can be linked with prion protein misfolding indirectly.
A significant association between SNPs such as designated 1368, 28878 and 34296 in outside the coding region of the PRNP and sCJD was reported, but not significantly in Korean population.22,31,32 In our study, -14801C/A, 1896A/T and 1898A/T were only detected in only three suspected CJD patients, cognitive impairment and/or ataxia were detected, and positive 14–3-3 was shown in two of them. Family history and/or symptoms of neurodegenerative disorder have not displayed characteristics in individuals in KARE data group who were: 14914A/G, -14900C/T, -14861T/C, -14409C/T -13464A/G, and 848T/C. We could not confirm a significant association between these SNPs and gene regulation because of not enough epidemiological data and clinical data of individuals who have these polymorphisms. We consider that these data can be provide as the information playing a key role in further studies to understand functions in PRNP gene regulation of SNPs of promoter region.
A strong LD block was found only between rs57633656 and rs1800014 in our study, even though the distance between these SNPs is about 14 kb. The other LD had non-significant r2 values (0–0.065), and the distance between these was less than that between rs57633656 and rs1800014. 219E/K heterozygosity caused by a G to A transition at rs1800014 occurs mainly in East Asians, and rarely in Caucasians, and this result may indicate differences in the susceptibility to prion diseases between Caucasians and East Asians. However, we did not study the intron region of human PRNP, so more precise identification of the LD patterns of PRNP in Koreans requires further studies of the intron sequences.
This study was a fundamental research to find out characteristics of PRNP of Korean population, epidemiological potential genetic risk factor, and to carry out a significant case-control study. We confirmed the unique LD structure and genotype frequencies in the Korean population and made several interesting findings. We expect that these data will advance our understanding of the genotypes of PRNP in the Korean population and will be helpful to identify susceptibility to and protective factors against prion diseases in East Asian populations.
Materials and Methods
Study population and DNA extraction
DNA was extracted from whole blood from 22 discriminated prion disease patients group (three definite sporadic CJD patients, one definite GSS patient and 18 cases of probable sCJD patients) and 163 cases of suspected prion disease patients group (four cases of possible sCJD patients and 159 cases of suspected CJD patients) using QIAamp DNA Blood Mini Kit (QIAGEN) according to the protocol of the manufacturer`s instructions. Suspected CJD patients were classified if they exhibited clinical symptoms like a dementia and/or amnesia and/or visual problem, rapidly progressive dementia and cases of CJD not ruled out. DNA samples of 296 cases of Korea Association REsource (KARE) data group were obtained from a community-based prospective cohort study with the support of the Korean National Institute of Health (KNIH). This study was approved by Korea Centers for Disease Control and Prevention (KCDC) Institutional Review Board (IRB) in 2010 and 2011.
PCR and sequencing
Ten primer sets were designed for sequencing of PRNP promoter region, exon 1, exon 2 and theirs junction regions (Table 3). The final volume of the PCR was 10μl, consisting of 10ng of DNA, 0.5uM of each primer pair, 0.25mM dNTPs, 3mM MgCl2, 1μl 10 × reaction buffer, and 0.25U Taq DNA polymerase (Intron Biotechnology). The PCR reaction was performed using 96-Well GeneAmp® PCR System 9700 (Applied Biosystems) at the following condition: initial denaturation at 94°C for 5min, followed by 35 cycles of denaturation at 94°C for 30s, annealing at 60–65°C for 30s, initial extension at 72°C for 30–60s, and final extension at 72°C for 10min. The PCR products were purified using a MultiScreen 384-PCR Filter Plate (Milipore). The purified products were then sequenced using a BigDye Terminator Cycle Sequencing Kit and an ABI 3730xl automated sequencer (Applied Biosystems). The sequencing primers were the same as those used for the PCR amplification.
Table 3. Primer sequences used for PCR in this study.
| Fragment | Forward primer sequences | Reverse primer sequences | Chr | Start site | Stop site | |
|---|---|---|---|---|---|---|
| PRNP-P1 |
CAGGAAACAGCTATGACCcctgacctcaagtaatccat |
TGTAAAACGACGGCCAGTttggagggaaagaactagg |
20 |
4,664,601 |
4,665,202 |
|
| PRNP-P2 |
CAGGAAACAGCTATGACCctccctggcttaaacaatc |
TGTAAAACGACGGCCAGTagcacttgaaaggtctgct |
20 |
4,665,059 |
4,665,695 |
|
| PRNP-P3 |
CAGGAAACAGCTATGACCtcattctaactggccacaa |
TGTAAAACGACGGCCAGTtttgggtgagaggtttagg |
20 |
4,665,583 |
4,666,246 |
|
| PRNP-P4 |
CAGGAAACAGCTATGACCagctcaagcaatcttcctg |
TGTAAAACGACGGCCAGTcagctccccgttacataat |
20 |
4,666,123 |
4,666,776 |
|
| PRNP-E1 |
CAGGAAACAGCTATGACCaattgcttcctcattcctg |
TGTAAAACGACGGCCAGTcctaacctgaaaagcgaag |
20 |
4,666,714 |
4,667,389 |
|
| PRNP-E2–1 |
CAGGAAACAGCTATGACCagtacagggtggcaacagt |
TGTAAAACGACGGCCAGTGTGCACAAAGTTGTTCTGG |
20 |
4,679,728 |
4,680,398 |
|
| PRNP-E2–2 |
CAGGAAACAGCTATGACCTTTCGGCAGTGACTATGAG |
TGTAAAACGACGGCCAGTACCAATGGTTATTTGCTGTT |
20 |
4,680,287 |
4,680,892 |
|
| PRNP-E2–3 |
CAGGAAACAGCTATGACCCTCTCTTTGTCCCGGATAG |
TGTAAAACGACGGCCAGTCCATTCCCAAACATTTGAT |
20 |
4,680,731 |
4,681,367 |
|
| PRNP-E2–4 |
CAGGAAACAGCTATGACCCAGTATGGGCTACACAGCA |
TGTAAAACGACGGCCAGTCACAAAGTGCAAGCCAATA |
20 |
4,681,224 |
4,681,889 |
|
| PRNP-E2–5 | CAGGAAACAGCTATGACCTGATTGATTTGAAGTGGAAA | TGTAAAACGACGGCCAGTtgtggagaaaatgcaaaag | 20 | 4,681,756 | 4,682,438 | |
Each primer has universal tagging sequence (in forward primer: CAGGAAACAGCTATGACC; in reverse primer: TGTAAAACGACGGCCAGT) for convenient study.
Genotyping and statistical analysis
SNPs detection and genotype frequencies estimation were performed using the Phred, Phrap, Consed, Polyphred 5.04 software suite (http://droog.mbt.washington.edu/PolyPhred.html). Hardy-Weinberg equilibrium (HWE) tests, minor allele frequency (MAF) and linkage disequilibrium (LD) among the SNPs were evaluated using Haploview version 4.2 (http://www.broadinstitute.org).
Acknowledgments
The Korean health samples which used to the Korea Association Resource (KARE) project were supported by the Center for Genome Science, Korea NIH. This research was funded by Korea Centers for Disease Control and Prevention (KCDC), Ministry of Health and Welfare (Project Number: 2010-N53002–00 and 2011-N53002–00).
Glossary
Abbreviations:
- CJD
Creutzfeldt-Jakob disease
- TSE
transmissible spongiform encephalopathies
- PRNP
prion protein gene
- SNP
single nucleotide polymorphism
- GSS
Gerstmann–Sträussler–Scheinker disease
- FFI
fatal familial insomnia
- vCJD
variant CJD
- sCJD
sporadic CJD
- HWE
Hardy-Weinberg equilibrium
- MAF
minor allele frequency
- LD
linkage disequilibrium
- UTR
untranslated region
Footnotes
Previously published online: www.landesbioscience.com/journals/prion/article/20195
References
- 1.Palmer MS, Dryden AJ, Hughes JT, Collinge J. Homozygous prion protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. Nature. 1991;352:340–2. doi: 10.1038/352340a0. [DOI] [PubMed] [Google Scholar]
- 2.Croes EA, Alizadeh BZ, Bertoli-Avella AM, Rademaker T, Vergeer-Drop J, Dermaut B, et al. Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease. Eur J Hum Genet. 2004;12:389–94. doi: 10.1038/sj.ejhg.5201161. [DOI] [PubMed] [Google Scholar]
- 3.Mead S, Poulter M, Uphill J, Beck J, Whitfield J, Webb TE, et al. Genetic risk factors for variant Creutzfeldt-Jakob disease: a genome-wide association study. Lancet Neurol. 2009;8:57–66. doi: 10.1016/S1474-4422(08)70265-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Collinge J, Whitfield J, McKintosh E, Beck J, Mead S, Thomas DJ, et al. Kuru in the 21st century--an acquired human prion disease with very long incubation periods. Lancet. 2006;367:2068–74. doi: 10.1016/S0140-6736(06)68930-7. [DOI] [PubMed] [Google Scholar]
- 5.Lee HS, Brown P, Cervenáková L, Garruto RM, Alpers MP, Gajdusek DC, et al. Increased susceptibility to Kuru of carriers of the PRNP 129 methionine/methionine genotype. J Infect Dis. 2001;183:192–6. doi: 10.1086/317935. [DOI] [PubMed] [Google Scholar]
- 6.Furukawa H, Kitamoto T, Tanaka Y, Tateishi J. New variant prion protein in a Japanese family with Gerstmann-Sträussler syndrome. Brain Res Mol Brain Res. 1995;30:385–8. doi: 10.1016/0169-328X(95)00034-P. [DOI] [PubMed] [Google Scholar]
- 7.Lukic A, Beck J, Joiner S, Fearnley J, Sturman S, Brandner S, et al. Heterozygosity at polymorphic codon 219 in variant creutzfeldt-jakob disease. Arch Neurol. 2010;67:1021–3. doi: 10.1001/archneurol.2010.184. [DOI] [PubMed] [Google Scholar]
- 8.Shibuya S, Higuchi J, Shin RW, Tateishi J, Kitamoto T. Codon 219 Lys allele of PRNP is not found in sporadic Creutzfeldt-Jakob disease. Ann Neurol. 1998;43:826–8. doi: 10.1002/ana.410430618. [DOI] [PubMed] [Google Scholar]
- 9.Hsiao K, Baker HF, Crow TJ, Poulter M, Owen F, Terwilliger JD, et al. Linkage of a prion protein missense variant to Gerstmann-Sträussler syndrome. Nature. 1989;338:342–5. doi: 10.1038/338342a0. [DOI] [PubMed] [Google Scholar]
- 10.Panegyres PK, Toufexis K, Kakulas BA, Cernevakova L, Brown P, Ghetti B, et al. A new PRNP mutation (G131V) associated with Gerstmann-Sträussler-Scheinker disease. Arch Neurol. 2001;58:1899–902. doi: 10.1001/archneur.58.11.1899. [DOI] [PubMed] [Google Scholar]
- 11.Tateishi J, Kitamoto T, Doh-ura K, Sakaki Y, Steinmetz G, Tranchant C, et al. Immunochemical, molecular genetic, and transmission studies on a case of Gerstmann-Sträussler-Scheinker syndrome. Neurology. 1990;40:1578–81. doi: 10.1212/wnl.40.10.1578. [DOI] [PubMed] [Google Scholar]
- 12.Tranchant C, Sergeant N, Wattez A, Mohr M, Warter JM, Delacourte A. Neurofibrillary tangles in Gerstmann-Sträussler-Scheinker syndrome with the A117V prion gene mutation. J Neurol Neurosurg Psychiatry. 1997;63:240–6. doi: 10.1136/jnnp.63.2.240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Goldfarb LG, Petersen RB, Tabaton M, Brown P, LeBlanc AC, Montagna P, et al. Fatal familial insomnia and familial Creutzfeldt-Jakob disease: disease phenotype determined by a DNA polymorphism. Science. 1992;258:806–8. doi: 10.1126/science.1439789. [DOI] [PubMed] [Google Scholar]
- 14.Goldfarb LG, Haltia M, Brown P, Nieto A, Kovanen J, McCombie WR, et al. New mutation in scrapie amyloid precursor gene (at codon 178) in Finnish Creutzfeldt-Jakob kindred. Lancet. 1991;337:425. doi: 10.1016/0140-6736(91)91198-4. [DOI] [PubMed] [Google Scholar]
- 15.Medori R, Tritschler HJ, LeBlanc A, Villare F, Manetto V, Chen HY, et al. Fatal familial insomnia, a prion disease with a mutation at codon 178 of the prion protein gene. N Engl J Med. 1992;326:444–9. doi: 10.1056/NEJM199202133260704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Synofzik M, Bauer P, Schöls L. Prion mutation D178N with highly variable disease onset and phenotype. J Neurol Neurosurg Psychiatry. 2009;80:345–6. doi: 10.1136/jnnp.2008.149922. [DOI] [PubMed] [Google Scholar]
- 17.Gabizon R, Rosenmann H, Meiner Z, Kahana I, Kahana E, Shugart Y, et al. Mutation and polymorphism of the prion protein gene in Libyan Jews with Creutzfeldt-Jakob disease (CJD) Am J Hum Genet. 1993;53:828–35. [PMC free article] [PubMed] [Google Scholar]
- 18.Rodríguez-Martínez AB, Alfonso-Sánchez MA, Peña JA, Sánchez-Valle R, Zerr I, Capellari S, et al. Molecular evidence of founder effects of fatal familial insomnia through SNP haplotypes around the D178N mutation. Neurogenetics. 2008;9:109–18. doi: 10.1007/s10048-008-0120-x. [DOI] [PubMed] [Google Scholar]
- 19.Jeong BH, Lee KH, Kim NH, Jin JK, Kim JI, Carp RI, et al. Association of sporadic Creutzfeldt-Jakob disease with homozygous genotypes at PRNP codons 129 and 219 in the Korean population. Neurogenetics. 2005;6:229–32. doi: 10.1007/s10048-005-0016-y. [DOI] [PubMed] [Google Scholar]
- 20.Choi BY, Kim SY, Seo SY, An SS, Kim S, Park SE, et al. Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients. BMC Infect Dis. 2009;9:132. doi: 10.1186/1471-2334-9-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Park MJ, Jo HY, Cheon SM, Choi SS, Kim YS, Kim JW. A case of gerstmann-sträussler-scheinker disease. J Clin Neurol. 2010;6:46–50. doi: 10.3988/jcn.2010.6.1.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jeong BH, Lee KH, Lee YJ, Kim YH, Cho YS, Carp RI, et al. PRNP 1368 polymorphism is not associated with sporadic Creutzfeldt-Jakob disease in the Korean population. Eur J Neurol. 2008;15:846–50. doi: 10.1111/j.1468-1331.2008.02203.x. [DOI] [PubMed] [Google Scholar]
- 23.Jeong BH, Lee KH, Lee YJ, Kim YJ, Choi EK, Kim YH, et al. Lack of association between PRNP 1368 polymorphism and Alzheimer’s disease or vascular dementia. BMC Med Genet. 2009;10:32. doi: 10.1186/1471-2350-10-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jeong BH, Nam JH, Lee YJ, Lee KH, Jang MK, Carp RI, et al. Polymorphisms of the prion protein gene (PRNP) in a Korean population. J Hum Genet. 2004;49:319–24. doi: 10.1007/s10038-004-0150-7. [DOI] [PubMed] [Google Scholar]
- 25.Doh-ura K, Kitamoto T, Sakaki Y, Tateishi J. CJD discrepancy. Nature. 1991;353:801–2. doi: 10.1038/353801b0. [DOI] [PubMed] [Google Scholar]
- 26.Ohkubo T, Sakasegawa Y, Asada T, Kinoshita T, Goto Y, Kimura H, et al. Absence of association between codon 129/219 polymorphisms of the prion protein gene and Alzheimer’s disease in Japan. Ann Neurol. 2003;54:553–4, author reply 555. doi: 10.1002/ana.10748. [DOI] [PubMed] [Google Scholar]
- 27.Nozaki I, Hamaguchi T, Sanjo N, Noguchi-Shinohara M, Sakai K, Nakamura Y, et al. Prospective 10-year surveillance of human prion diseases in Japan. Brain. 2010;133:3043–57. doi: 10.1093/brain/awq216. [DOI] [PubMed] [Google Scholar]
- 28.Shiga Y, Satoh K, Kitamoto T, Kanno S, Nakashima I, Sato S, et al. Two different clinical phenotypes of Creutzfeldt-Jakob disease with a M232R substitution. J Neurol. 2007;254:1509–17. doi: 10.1007/s00415-007-0540-9. [DOI] [PubMed] [Google Scholar]
- 29.Beck J, Collinge J, Mead S. Prion protein gene M232R variation is probably an uncommon polymorphism rather than a pathogenic mutation. Brain. 2011 doi: 10.1093/brain/awr294. [DOI] [PubMed] [Google Scholar]
- 30.Bishop MT, Pennington C, Heath CA, Will RG, Knight RS. PRNP variation in UK sporadic and variant Creutzfeldt Jakob disease highlights genetic risk factors and a novel non-synonymous polymorphism. BMC Med Genet. 2009;10:146. doi: 10.1186/1471-2350-10-146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Mead S, Mahal SP, Beck J, Campbell T, Farrall M, Fisher E, et al. Sporadic--but not variant--Creutzfeldt-Jakob disease is associated with polymorphisms upstream of PRNP exon 1. Am J Hum Genet. 2001;69:1225–35. doi: 10.1086/324710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Vollmert C, Windl O, Xiang W, Rosenberger A, Zerr I, Wichmann HE, et al. KORA group Significant association of a M129V independent polymorphism in the 5′ UTR of the PRNP gene with sporadic Creutzfeldt-Jakob disease in a large German case-control study. J Med Genet. 2006;43:e53. doi: 10.1136/jmg.2006.040931. [DOI] [PMC free article] [PubMed] [Google Scholar]