Skip to main content
PLOS One logoLink to PLOS One
. 2013 Apr 1;8(4):e60772. doi: 10.1371/journal.pone.0060772

The Evolution of an Osmotically Inducible dps in the Genus Streptomyces

Paul D Facey 1,*, Matthew D Hitchings 1, Jason S Williams 1, David O F Skibinski 1, Paul J Dyson 1, Ricardo Del Sol 1
Editor: Colin Dale2
PMCID: PMC3613396  PMID: 23560105

Abstract

Dps proteins are found almost ubiquitously in bacterial genomes and there is now an appreciation of their multifaceted roles in various stress responses. Previous studies have shown that this family of proteins assemble into dodecamers and their quaternary structure is entirely critical to their function. Moreover, the numbers of dps genes per bacterial genome is variable; even amongst closely related species - however, for many genera this enigma is yet to be satisfactorily explained. We reconstruct the most probable evolutionary history of Dps in Streptomyces genomes. Typically, these bacteria encode for more than one Dps protein. We offer the explanation that variation in the number of dps per genome among closely related Streptomyces can be explained by gene duplication or lateral acquisition, and the former preceded a subsequent shift in expression patterns for one of the resultant paralogs. We show that the genome of S. coelicolor encodes for three Dps proteins including a tailless Dps. Our in vivo observations show that the tailless protein, unlike the other two Dps in S. coelicolor, does not readily oligomerise. Phylogenetic and bioinformatic analyses combined with expression studies indicate that in several Streptomyces species at least one Dps is significantly over-expressed during osmotic shock, but the identity of the ortholog varies. In silico analysis of dps promoter regions coupled with gene expression studies of duplicated dps genes shows that paralogous gene pairs are expressed differentially and this correlates with the presence of a sigB promoter. Lastly, we identify a rare novel clade of Dps and show that a representative of these proteins in S. coelicolor possesses a dodecameric quaternary structure of high stability.

Background

Almost two decades after the first Dps protein (PexB) was characterized in E. coli [1], [2], there has been a continued effort to identify and characterize homologous genes in other prokaryote genomes. Subsequently, Dps proteins have been found in almost all the bacterial groups, including archaea [3]. As a result, the literature now contains an abundance of data on Dps proteins; providing a wealth of knowledge pertaining to their structure [4], interaction with DNA [5] and their importance in the stress response [6]. Interestingly, there is an apparent evolutionary link between the iron sequestering Ferritin (and bacterioferritin) proteins and Dps proteins [7] and, moreover there also appears to be ferritin-like proteins that share functional properties of Dps [8]. Indeed, a few studies have elucidated the crystalline structure of a few Dps proteins [9], [10] and have shown that like ferritins, Dps proteins assemble into oligomers (albeit dodecamers as opposed to 24mers) and their overall three-dimensional shape is entirely critical to their function [11]. Moreover, it is because of the smaller nature of Dps oligomers (when compared to ferritins) that Dps proteins are often referred to as mini-ferritins; as opposed to maxi-ferritins [12]. However, despite similarities between these two protein families, they can be distinguished based on examination of their secondary structure. For example, Dps have a small central helix (often called the BC helix) which is absent in ferritins. Similarly, ferritins possess a helix towards their C-terminus that is absent in Dps [13]. However, both ferritins and Dps both form similar tertiary structures.

The current literature suggests that Dps proteins provide macromolecule protection either by oxidizing and storing ferrous iron in a bioavailable form or by binding and physically shielding DNA. Iron detoxification, which Dps proteins contribute to through the abatement of the Fenton reaction, occurs at the ferroxidation centre. These sites lie at the interface between two anti-parallel subunits ([10] and references therein) and are therefore found within the hollow, inner cavity of the self-assembled dodecamer. However, not all Dps proteins have ferroxidase activity and not all bind DNA [14]. To the exterior of the dodecamer, the variable length N- and C-terminal tails of each monomer have been implicated in DNA binding and dodecamer assembly [15], [16]. For example, removal of the N and C terminal tails of Mycobacterium smegmatis Dps-1 prevents assembly of the dodecamer. However, other Dps proteins are “tailless” and still assemble into dodecamers [17] suggesting that, although in some genera the tails are important for dodecamer assembly, this is not always the case. However, whilst differences in tail length may reflect important variation in structure (and possibly function), this has only been studied in a few bacteria; studies on the evolution and origin of these tails appears scant. Indeed, until recently, the focus of many Dps studies has been on their role in protection during nutrient limitation and under oxidative conditions, usually through the abatement of Fenton Chemistry [18]. However, there now appears some recognition of the multifaceted roles of dps genes (see [19], [20], [21], [22], [23]) and that different Dps proteins within the same genome may be capable of different functions. With increasing numbers of completely sequenced microbial genomes, multiple dps homologs within the same species are now being identified and their structures and functions elucidated [24], [25], [26]. Having more than one dps gene per genome is common amongst bacteria [27]. However, for many genera, variation in the number of dps per genome amongst closely related species is yet to be satisfactorily explained. This is exemplified in species of mycobacteria. Gupta et al., [28] and Roy et al., [29] characterized two dps genes in free-living Mycobacterium smegmatis. Yet, remarkably, dps homologs are absent in the genomes of closely related, but pathogenic, M. leprae, M. bovis and M. tuberculosis. Additionally, more intricate studies are now characterizing the control of dps at the transcriptional level [27], [30] and, not only is there evidence for multiple sigma factor complexes contributing to the transcription of dps [30], [31] but, it also appears that expression of these genes may be driven by suites of different sigma factors e.g. msdps1 [31] and msdps2 [27]. Together, this suggests that the evolutionary history of dps in many genera contains duplications, losses and possible lateral acquisitions.

The aim of the present study is to investigate the evolutionary history of the dps genes in Streptomyces. Recent studies have identified three dps genes (herein named dpsASc, dpsBSc and dpsCSc) in the genome of the model actinomycete S. coelicolor [19]. dpsASc has been shown to be part of the well characterized, osmotically-induced Sigma B regulon and is significantly overexpressed as a result of osmotic stress and heat shock [19], [30]. Similarly, dpsCSc is also mildly induced during heat shock. However, despite contributing to nucleoid compaction, dpsBSc appears not to be induced during osmotic nor heat shock. Phylogenetic analysis indicates that horizontal gene transfer (HGT) and gene duplication are plausible explanations for the distribution of dps genes among Streptomyces.

Results

Distribution of DpsSc orthologs in Bacteria

We used the three Streptomyces coelicolor Dps proteins as BLASTP queries for homology searches among Bacterial and Archaeal lineages. Our searches yielded 1120 unique protein sequences and included sequences from 299 completely sequenced prokaryote genomes across 8 different phyla. Retrieved sequences varied in annotation and included Dps family ferritin, starvation induced dps, ferritin, DNA-binding Dps and hypothetical proteins. All sequences were confirmed to be Dps by the possession of signature amino acids and the helical pattern characteristic of Dps protein’s secondary structure [6], [19] (figure 1 provides a schematic representation showing the positions of the helices in the three Dps proteins in S. coelicolor). The results of our homology searches showed that the number of dps genes per genome was variable – even amongst closely related species. However, most (75%) genomes encoded for only one Dps protein, with 18% encoding for two Dps proteins, 5% encoding for three Dps proteins and less than one percent of all genomes scrutinized had more than 3 dps genes.

Figure 1. Amino acid alignment of S. coelicolor Dps proteins.

Figure 1

Amino acid alignment of the three S. coelicolor Dps proteins showing the position of the five characteristic Dps helices along with the position of the different length N- and C-terminal tails.

Interestingly, there was no significant (P>0.05; Mann-Whitney) distributional bias in the number of homologs per genome among the 8 phyla. Similarly in Streptomyces, the number and distribution of dps genes among closely related species was unequal. Moreover, the genomes of S. coelicolor and S. ghanaensis are within a minority of bacteria that contain 3 dps genes.

Variation in tail length of bacterial Dps and assembly and stability of S. coelicolor Dps

We uncovered significant differences in the distributions of tail lengths in Dps proteins within and among bacterial genera. Interestingly, all tail lengths appeared to occur randomly throughout the bacterial phyla - and this variation is also evident in Streptomyces. Moreover, not only does the S. coelicolor genome encode for three Dps proteins, each of these has different tail lengths (Figure 1). However, as expected from the variable distribution of Dps in Streptomyces, this pattern is not conserved. Indeed, in our dataset, the presence of three dps genes in the same genome, each encoding for a protein with a different secondary structure is unique. In other genomes that have three dps (e.g. S. ghanaensis) at least two Dps homologs have similar tail lengths. For example, in S. ghanaensis, two Dps are orthologous to DpsBSc and have both short N- and C-terminal tails and the other is orthologous to DpsASc and has a longer N-terminal tail (compared to C-terminal tail). The most frequent tail length arrangement (83% of all Dps proteins in Streptomycetes) is short/negligible tails, making this secondary structure almost ubiquitous in Streptomyces. Only 30% of Dps proteins in Streptomyces have longer C-terminal tails and 20% with longer N-terminal tails.

A native protein Western blot (Figure 2A) revealed that DpsASc and DpsCSc readily assemble into higher oligomeric states in vivo in contrast to DpsBSc that does not. Moreover, our in vivo observations of DpsASc shows that it appears to be present in two major species on a 7% native PAGE gel (lanes 1–3). The mobility of the lower DpsA oligomer indicates that it is significantly smaller than a dodecamer (but larger than DpsB) whilst the upper species is believed to be a dodecamer.

Figure 2. A: Immunoblot of a native PAGE gel.

Figure 2

Immunoblot showing the in vivo oligomeric state of DpsASc, DpsBSc and DpsCSc overexpressed using a thiostrepton inducible promoter. Overexpression of DpsA (lane A), DpsB (lane B) and DpsC (lane C) from a thiostrepton inducible promoter. Black arrow indicates the non-dodecameric DpsB. B: Coomassie blue stained native PAGE gel assessing the stability of assembled DpsSc oligomers. Coomassie blue stained native PAGE gel showing the stability of assembled S. coelicolor Dps oligomers after incubation with 8 M urea. Lane A−  =  DpsASc without 8 M urea, lane A+  =  DpsASc + 8 M urea, Lane C−  =  DpsCSc without 8 M Urea, lane C+  =  DpsCSc + 8 M urea.

S. coelicolor Dps oligomers also display differences in their resistance to denaturation. Of the two Dps that assemble into dodecamers (DpsA and DpsC), we found that DpsC dodecamers are significantly more resistant to denaturation than those of DpsA. The native PAGE gels (Figure 2B) indicate that whilst the dodecamer of DpsA is denatured by 8 M urea, the DpsC oligomer is much more stable. Even after extended incubation with 8 M urea, the DpsC dodecamer exhibits very little disassembly - indicating that the molecular interactions maintaining the oligomeric structure are very strong.

The distribution of orthologous protein clusters and tail lengths

Highlighted on the Maximum-likelihood reconstructed phylogeny of Actinobacterial Dps sequences (figure 3) are three distinct clades. These correspond to the three S. coelicolor orthologous Dps protein clusters. Remarkably, proteins that are orthologous to DpsCSc are rare in bacteria, and even rarer in Streptomyces – certainly, orthologs of DpsCSc were found in only five Streptomycetes. Thus, this very narrowly distributed clade contains very interesting Dps proteins. Similarly, orthologs of DpsASc are rare in Streptomyces, and, this is suggestive of non-lineal inheritance. In contrast, many Streptomycetes possess an ortholog of DpsBSc (indicated in figure 3 by the large cluster of Streptomyces) and the origin of this large cluster of orthologous proteins has a very deep node - indicative, maybe, of very early divergence in the Streptomyces. In all cases we found that the GC content of dps genes was consistent with the local GC content of neighbouring genes and also the genome average.

Figure 3. Majority rule consensus phylogenetic tree of Actinobacterial Dps orthologous proteins.

Figure 3

Maximum-likelihood reconstructed phylogenetic tree of Actinobacterial Dps proteins. Indicated are three orthologous protein clusters (shaded boxes). DpsASc, DpsBSc and DpsCSc indicates the position of S. coelicolor Dps in the tree. Paralogous gene pairs of DpsB in Streptomyces are indicated using matched Roman numerals. σB indicates those proteins where a putative sigB-like promoter was identified. Bootstrap values >60% are indicated next to major nodes.

Duplication and expression of Dps in Streptomyces genomes

Our expression analysis shows that there is a trend for at least one dps per genome to be upregulated during osmotic stress although the identity of the upregulated ortholog differs among Streptomyces (Figure 4). Moreover, possession of an osmotically regulated dps appears to have arisen in many genomes after gene duplication. The ML phylogenetic tree identifies a duplication of dps genes in a few Streptomyces genomes. The genomes of S. avermitilis, S. scabies, S. ghanensis, S. griseoflavus, S. viridochromogenes and S. sviceus contain two highly similar copies (pairwise mean percentage similarity  =  97% ± 1.5 S.D) of a dps that is orthologous to dpsBSc. Interestingly, expression analysis after osmotic upshock shows that only one member of each paralogous gene pair is induced (Figure 4) and these group together within the tree (Figure 3).

Figure 4. Normalized fold change in dps transcript abundance among five Streptomyces in response to osmotic stress.

Figure 4

q RT PCR monitoring of dps transcript abundance after 1 hour incubation with 250 mM KCl in S. co.  =  S. coelicolor; S. gha  =  S. ghanaensis; S. alb  =  S. albus; S. av  =  S. avermitilis; S. ven.  =  S. venezuelae. Relationships to S. coelicolor dps orthologs are indicated in parentheses. dps transcript abundance is normalized to principal sigma factor hrdB. Paralogous gene pairs are sequentially numbered. Presence of a sigB-like promoter motif upstream of the ORF is indicated with an asterisk. Error bars represent standard deviation of the mean normalized transcript abundance. A broken Y-axis has been used.

Figure 5 summarizes the results of our searches for sigB-like promoter motifs upstream of dps genes in 17 completely sequenced Streptomycetes. Although dpsASc is transcribed from a sigB-like promoter, our approach of mapping putative sigB promoters using an in silico approach revealed that not all orthologs of dpsASc in other species possess a recognizable SigB-dependent promoter. Furthermore, for species that lack an ortholog of dpsASc, or where this ortholog is present but lacks a sigB-like consensus promoter sequence upstream, the genome often contains an alternative ortholog with a putative SigB-dependent promoter. In species where we identified a duplicated dps, in all cases one of these copies had a sigB promoter motif. Moreover, in four species tested, we confirmed that dps genes with a sigB-like promoter motif upstream of their ORF are significantly upregulated during osmotic stress (Figure 2).

Figure 5. dps location maps among 17 Streptomycete chromosomes.

Figure 5

Approximate chromosome location of dps orthologs in 17 Streptomycete chromosomes. Species names are abbreviated to the left of the diagram: S. gha  =  S. ghanaensis; S. griseof  =  S. griseoflavus; S. prist  =  S. pristinaespiralis; S. co.  =  S. coelicolor; S. liv.  =  S. lividans; S. alb  =  S. albus; S. flavo  =  S. flavogriseus; S.gris  =  S. griseus; S. virido  =  S.viridochromogenes; S. scab  =  S. scabies; S. aver  =  S. avermitilis; S. clav  =  S. clavuligerus; S. gris. gris  =  S. griseus subsp. griseus; S. him  =  S. himastatinicus; S. svic  =  S. sviceus; S. griseoaur  =  S. griseoaurantiacus; S. venez  =  S. venezuelae. Chromosomes were orientated based on the centrally located initiator protein (black arrow). Light grey arrows represent orthologs of dpsASc, clear arrows represent orthologs of dpsCSc, striped arrows represent orthologs of dpsBSc. Figures above arrows represent approximate chromosome location in Mb. Figures in parentheses  =  chromosome size. Asterisks indicate those genes where we identified sigB-like promoter motifs upstream of ORFs. Scale bar  =  1 Mb.

Gene synteny and chromosomal location of dps in Streptomyces

In order to provide insights into an evolutionary history of dps, which may have included gene duplications and lateral acquisitions in Streptomyces, we performed synteny comparisons among all completely sequenced and assembled Streptomycete genomes. In addition, we also compared the chromosome locations of dps genes in 17 streptomycete genomes. Our comparisons of gene location (Figure 5) showed that orthologs of dpsASc and dpsCSc are generally located outside of the core genome (i.e. in the chromosome arms - demarcated using a consensus of existing published coordinates [32], [33], [34]); the exceptions are in S. albus and S. griseus.

The distribution of dpsBSc orthologs is more complex. In species where we identified duplicated copies of dpsB, at least one of these copies is always located nearer to the ends of the chromosome and this copy always possesses a putative sigB-like promoter. The other copy, without the sigB promoter is found more centrally in the chromosome. In addition, a comparison of the genomic neighborhood around these paralogs (figure 6) revealed a high degree of gene conservation around the dps lacking a putative sigB-like promoter. In contrast, very poor gene synteny occurred around the copy where we identified a sigB-like promoter motif upstream of corresponding ORFs. Orthologs of dpsASc and dpsCSc displayed very poor gene synteny in the genomes analysed.

Figure 6. Schematic representation of the genomic neighbourhood of dpsBSc in Streptomyces.

Figure 6

Consensus genomic neighbourhood around dpsBSc orthologs (without a sigB promoter) in completely sequenced and assembled Streptomyces genomes. The nomenclature of genes follows that of S. coelicolor orthologs. Numbers in parenthesis represents (as a percentage) the number of times that gene occurs in that position among all the Streptomyces tested. Genes that do not match 100% are not shown. H/p  =  hypothetical protein.

Discussion

The ancestral dps in Streptomyces possessed short N- and C- terminal tails and was not involved in the osmotic stress response

Our in silico predictions, coupled with expression analysis, is suggestive that in many Streptomyces there is a requirement for an osmotically inducible dps. However, the presence of such a dps within the genomes of Streptomyces appears fairly recent in evolutionary history. Indeed, we provide evidence that an osmotically inducible dps arose either after gene duplication and functional divergence or, in other cases, through the lateral acquisition of an osmotically inducible dps from other Actinobacteria. In support of the former, the orthologous relationships in many Streptomyces are on a one-to-many basis – e.g. S. coelicolor contains a single copy of dpsBSc, yet, S. avermitilis, S. scabies, S. ghanaensis, S. griseoflavus, S. viridochromogenes and S. sviceus contain two homologous dpsB sequences with a high pairwise percentage similarity. The occurrence of two highly similar copies of dps in these genomes provides strong evidence for paralogy. Interestingly, a very distinct dichotomy could be observed among paralogous gene pairs based on chromosome location, gene synteny and presence of a putative sigB promoter motif. Principally, paralogous pairs could be divided into (i) those that were located within 2 Mb of the chromosome ends, had a poorly conserved genomic neighbourhood and possessed a sigB-like promoter motif upstream and (ii), those that were located within the chromosome core, had a highly conserved genomic neighbourhood and did not possess a sigB-like promoter motif.

In addition, the presence of a sigB promoter motif also conferred expression after osmotic upshock in all paralogs tested. This, coupled with the almost ubiquitous nature of the second class of dpsB genes in the genomes of most Streptomyces makes them ideal candidates for the ancestral dps within this genus. Certainly, in support of this, Bentley’s [32] comparisons between S. coelicolor, and C. diphtheriae chromosomes indicated that the last common ancestor (LCA) of these taxa may have shared the core region (but not the arms) of the S. coelicolor chromosome. Thus, as the core of the C. diphtheriae genome, like many Streptomycetes, possesses an ortholog of dpsBSc, this is consistent with the hypothesis that the LCA encoded a short- tailed Dps protein and is the ancestral dps in the genus Streptomyces. Therefore, osmotically-inducible dpsBSc orthologs appear to have arisen more recently; possibly as a result of an environmental pressure for osmotic protection. Furthermore, despite the large amount of data implementing Dps tails in the binding of DNA during the stress response, the fact that we show the presence or absence of tails does not correlate with osmotic inducibility suggests that tails are not required for the function of these proteins under osmotic shock.

Evidence for lateral acquisition of dps genes in Streptomyces

Phylogenetic reconstruction using all retrieved Dps orthologs indicates that the evolution of Dps proteins in some bacterial species results from HGT rather than by lineal descent. Indeed, HGT has already been demonstrated for dps genes elsewhere (e.g. the lactic acid bacterium, Oenococcus oeni; [35]) and recent evidence purports that HGT as a mechanism is prevalent in Streptomyces [36]. More specifically, it has been shown that the terminal regions at either end of many Streptomycete chromosomes are “hot spots” for laterally acquired genes - with these regions spanning up to 2 Mb in length [32]. Certainly, in S. coelicolor, our data are suggestive of HGT as both dpsASc and dpsCSc are found within such a region [23]. Together, this would suggest that, at least in S. coelicolor, dpsA and dpsC were additions to the genome. Certainly, orthologs of DpsASc are under-represented in other Streptomyces species (being found only in S. coelicolor and S. albus) making the evolution of these orthologs inconsistent with a common ancestry. Interestingly, in agreement with other studies on actinobacterial Dps proteins in the DpsA clade (i.e. that of Mycobacterium smegmatis; [37]), DpsASc also assembles into two different sized oligomers – suggesting that proteins within this clade may assemble in a similar fashion and could therefore have a similar evolutionary origin. Furthermore, as with Mycobacterium smegmatis Dps, the removal of the C-terminal tail of DpsA and N-terminal tail of DpsC in S. coelicolor confers an inability of these proteins to assemble correctly (unpublished).

In support of lateral acquisition of dpsCSc-like genes, structural and phylogenetic comparisons highlight a clade containing only nine actinobacterial sequences. This is despite the initial BLAST searches using very relaxed E-values. Interestingly, this clade is populated by some species that have been shown to grow in high temperature environments [26][29]. Thus, this very narrowly distributed clade contains very interesting Dps proteins. Indeed, S. coelicolor DpsC protein dodecamers are highly resistant to denaturation by urea (8 M over night incubation). Our initial modeling studies of this group of proteins (unpublished) suggest that the very long N-terminal tails of these proteins may act to stabilize the dodecamer. As only a small number of species contain orthologs of this gene, they are more likely to have been acquired by horizontal gene transfer rather than having been lost in the majority of species.

The fact that DpsB in S. coelicolor does not assemble in our in vivo observations is also very interesting. Whilst it is possible that DpsB assembles under different conditions to the other two Dps proteins in S. coelicolor, we hypothesise that this protein (and orthologs of this protein in other Streptomyces), being the ancestral Dps in this genus, may have become redundant as the number of dps genes increased in these genomes. However, further analyses are required to test this.

Conclusions

In summary, we propose that an osmotically inducible dps in Streptomyces has resulted from duplications and lateral acquisitions. That dpsCSc is very poorly represented in the bacterial lineage is interesting, and this, coupled with the stability of DpsCSc dodecamers, is suggestive of either very selective acquisition of a gene encoding for a protein with a highly specific function or, significant gene loss. Certainly, the proteins within this clade warrant further study. Moreover, through environmental selection pressure, the genomes of many Streptomyces now contain an osmotically induced dps. This may have arisen in two ways. Either by duplication, whereby one of the paralogs later becomes part of the osmotically inducible SigB regulon, or, in the absence of such an event, Streptomyces have acquired an osmotically induced dpsA that is subsequently transcribed as part of the SigB regulon. The order with which these events have occurred is difficult to ascertain. However, the absence of dpsB but the presence of dpsA with an upstream sigB-like promoter motif in S. flavogriseus and S. albus is suggestive that acquisition of dpsA preceded or paralleled duplication of dpsB in other species. In those species where an osmotically induced dps is absent, or where our in-silico analysis has not identified a sigB promoter motif upstream of a dps ORF (i.e. S. venezuelae), this may indicate that there is not a requirement for this trait in the host environment - indeed, S. venezuelae is significantly less salt tolerant than S. coelicolor (unpublished). Lastly, the variable distribution of dps genes in other bacterial genomes is consistent with the patterns we have shown for Streptomyces. Thus, we propose that the evolutionary pathway that we describe here, which involves both HGT and gene duplication, may be applicable to the evolution of Dps proteins in many other species.

Methods

Bacterial strains, media, RNA isolation and Q RT PCR

Streptomyces strains were grown at 30°C on the surface of MS (mannitol soya flour) agar or on cellophane discs [38]. Liquid cultures of nutrient broth were set up in 10 mL volumes. Liquid cultures were incubated at 30°C with shaking (250 r. p. m.). To induce osmotic stress, cellophane disc cultures were grown on MS agar for 16 hours and then transferred to MS agar containing 250 mM KCl. For each species tested, total RNA was isolated from three independent cultures (3 biological replicates), reverse transcription and q RT PCR procedures were performed as previously described [30]. The quantification of dps ortholog transcript abundance was performed on five Streptomyces species. These were specifically chosen to provide Streptomycetes that, (i) possessed three different Dps proteins (S. coelicolor), (ii) duplicated dps with and without putative sigB promoters (S. avermitilis and S. ghanaensis and S. albus), and (iii) a single dps, orthologous to dpsCSc (S. venezuelae).

Gene specific priming (GSP) of dps and hrdB/rpoD was performed using oligonucleotides shown in Table 1. Alignment of the hrdB gene sequences showed that the annealing sites of the hrdB oligonucleotides used by [19] were conserved among Streptomyces spp., thus, these were used to amplify the endogenous reference gene in all samples. Specificity of the reaction was assessed using melt analysis. Fold change in transcript abundance was calculated using the efficiency corrected Pfaffl method [39].

Table 1. Plasmids, strains and oligonucleotides.

Description Source
E. coli BL21 (DE2) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3  =  λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5
E. coli ET12567 (pUZ8002) Dam13::Tn9 dcm6 hsdM hsdR recF143 16 zjj201::Tn10 galK2 galT22 ara14 lacY1 xyl5 leuB6 thi1 tonA31 rpsL136 hisG4 tsx78 mtli glnV44, containing the non-transmissible oriT mobilizing plasmid, pUZ8002
S. coelicolor A3(2)
S. ghanaensis
S. albus
S. venezuelae
S. avermitilis
pGEMT-Easy AmpicillinR Promega corp.
pET26b+ KanamycinR Novagen
pDpsA4 dpsA in pGEM-T Easy Facey et al., 2009
pDpsC1 dpsC in pGEM-T Easy Facey et al., 2009
pDpsA7 H dpsA::His6, HygromycinR Facey et a., 2009
pDpsA9 pIJ8600, tipA-dpsA::His6 Facey et al., 2009
pDpsB9 pIJ8600, tipA-dpsB::His6 Facey et al., 2009
pDpsC9 pIJ8600, tipA-dpsC::His6 Facey et al., 2009
pDpA14 dpsA coding sequence in pET26b+ This study
pDpsC14 dpsC coding sequence in pET26b+ This study
All species hrdBFor -CCTCCGCCTGGTGGTCTC Facey et al.,2009
hrdBRev - CTTGTAGCCCTTGGTGTAGTC Facey et al., 2009
S.coelicolor
dpsAF-AGCGGAAGTGGGACGACTAC Facey et al., 2009
dpsAR-TCAGAAGGTCCTCGGTGGC Facey et al., 2009
dpsBF-GTCGTGAAGAGCCCGTTGTC Facey et al., 2009
dpsBR-AGGTGTACGGAGCGGAAGC Facey et al., 2009
dpsCF-GGCACCGTCAAGCAGTTCC Facey et al., 2009
dpsCR-CCGCCAGGACCTTGTTGAG Facey et al., 2009
S. avermitilis
dpsB1F-CTCTCGCTCATCGGGAAG This study
dpsB1R-TTCGTCGAGCTGGAGATG This study
dpsB2F-GTGGATCTGTCACTCGTG This study
dpsB2R-AGTTGCAGGTGAATGGAG This study
S. ghanaensis
dpsAF-CATGAAGGAGACCGAGAC This study
dpsAR-GACGAACCACTGGAAGAG This study
dpsB1F-ATCGACGCCACCGAGAAG This study
dpsB1R-GAACATCCACCGCTGCTT This study
dpsB2F-TCGTGAAGAGTCCATTGTC This study
dpsB2R-CGAGGGCGAGATCCACCAG This study
S. venezuelae
dpsCF-CTCAACCTGCCGAACAAG This study
dpsCR-AAGTACACCTCGTTGTCGTT This study
S. albus
dpsAF-AAGCTCATCGACCTCCTG This study
dpsAR-CCAGTGGATGTGCTTCAG This study
dpsBF-AGCCAGGACATCTTCATCA This study
dpsBR-CTAGCTGTTCTCCGCCTG This study

Obtaining an othologous data set of Dps proteins

An actinobacterial orthologous data set of DpsSc proteins was obtained using a Reciprocal Best-Hit (RBH; [40]) approach. Briefly, the three S. coelicolor Dps protein sequences were used as queries for retrieving homologous sequences using the Blastp algorithm [41] and a relaxed E value threshold of 1E−03. Default parameters were used throughout - however, to limit data redundancy, we retrieved sequences from the refseq database. Results from these initial searches were then re-blasted back limiting results to Streptomyces coelicolor. Only proteins that came out as best hits bi-directionally were retained. Sequences of retrieved proteins were aligned using ClustalW implemented in Molecular Evolutionary Genetics Analysis software (MEGA; [42]). Moreover, to correct for erroneous annotations and to exclude bacterioferritins from the orthologous data list, firstly, a distance based (Neighbor-joining) tree was reconstructed that included all putative Dps orthologs and Streptomyces coelicolor bacterioferritin (Genbank: NP626370) and secondly, the secondary structure of all proteins were predicted using JPRED3 [43]. All secondary structure annotations were scrutinized and poorly predicted structures (i.e. those with confidence levels lower than 40%) were manually removed. Sequences were excluded from the data set if they grouped together with S. coelicolor bacterioferritin and also lacked the characteristic BC helix of Dps (i.e. those sequences that were bacterioferritins/ not Dps). In addition, to characterize Dps homologs in terms of N- and C- terminal tail length, using the secondary structure predictions, we manually counted the number of amino acid upstream of the first and downstream of the last alpha helix for each protein.

Gene synteny and chromosome location of dps genes in completely sequenced Streptomyces genomes

In the absence of horizontal gene transfer and duplication, the chromosome location of orthologous genes and gene synteny surrounding them is often conserved amongst closely related species. Thus, we chose to compare location of dps genes in 17 completely sequenced and assembled Streptomyces genomes. In addition, we manually compared gene synteny of genes surrounding dps. Chromosome coordinates of orthologous dps genes used to construct gene location maps were retrieved from NCBI. To calibrate chromosome orientation, we chose to use the direction of the initiator protein, dnaA, located in the central oriC region of streptomycete chromosomes [44], [45].

Phylogenetic reconstruction

A Maximum-likelihood based phylogeny using Actinobacterial Dps ortholog sequences was reconstructed using MEGA using the amino acid substitution model JTT + F +I. The consensus tree was drawn using the Majority Rule criteria. To assess the robustness of inferred phylogenies, we used 500 bootstrap pseudoreplicates.

Identification of SigB dependent promoters upstream of dps genes

The conservation of a sigB-like regulon among dps orthologs in Streptomycetes was investigated using an in-silico approach. An in silico search using the degenerative motif GNNTN(N) 14–16 GGGYAY was performed on the complete genomic sequences of 17 Streptomycetes using COMplex PAttern of sequence search software (COMPAsss; [46]). Organisms were only included in the analysis if they were classified down to the species level. The occurrence of this motif, which represents the −10 and −35 regions of the dpsA/sigB recognizable promoter [30] in the 17 Streptomyces genomes, was retrieved using the COMPAsss built-in database mining capability linked to the NCBI nucleotide database. Generated hit tables were scrutinized for putative functional promoters by limiting hits to those found in intergenic regions and to motifs located within 200 nucleotides of dps ORFs.

Protein methods

Assembly of S. coelicolor Dps into higher state oligomers was investigated in vivo using C-terminally His-tagged dpsASc, dpsBSc and dpsCSc under the control of a thiostrepton inducible promoter to ensure sufficient protein concentration levels, encoded respectively by plasmids pDpsA9, pDpsB9 and pDpsC9 [19]. For overexpression, 24-hour liquid cultures were spiked with the antibiotic thiostrepton (25 µg ml−1) for protein induction and incubated for a further hour. Cells were pelleted by centrifugation (5 000 x g for 5 min) and the media replaced with sonication buffer (50 mM Tris-HCl, pH 8, 200 mM NaCl, 15 mM EDTA, Complete protease inhibitor cocktail (Roche Diagnostics). Cells were disrupted by sonication on ice (20 seconds at 20% amplitude). Cell free extracts were obtained by centrifugation (13 000 x g for 2 min at 4°C) and removal of the supernatant. Equal volumes of supernatant were mixed with NativePAGE sample buffer (Invitrogen) and proteins were separated in a 7% polyacrylamide gel using a tris-glycine running buffer excluding sodium dodecyl sulphate (SDS) at 4°C. After electrophoresis, gels were soaked in 1 X SDS running buffer for 30 min and then equilibrated for 5 min in cold Bjerrum and Schafer-Nielsen transfer buffer. Proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Hybond-P, Amersham) using a semi-dry electrophoretic transfer cell (Trans-Blot SD, BioRad). His-tagged proteins were detected with a Penta- His peroxidase conjugate (Qiagen). Immunological detection was performed using an ECL Advance Western blotting detection kit (Amersham Pharmacia Biotech). The stability of assembled S. coelicolor Dps dodecamers was investigated using recombinantly expressed Dps. Briefly, C-terminal translational fusions to 6xhistidine tag were created as follows: the coding sequences for dpsASc and dpsCSc were excised from plasmids pDpsA4 and pDpsC1 [19] as NdeI/BglII fragments and subcloned into pET26b(+) digested NdeI/BglII to create pDpA14 and pDpsC14 respectively. Plasmids were transformed into E. coli BL21 (DE3) and grown in 1 L cultures of 2 X YT until mid-log phase. Expression of recombinant Dps proteins was performed at 30°C for 3 h after the addition of isopropyl-1-thio-D-galactoside (IPTG) to a final concentration of 0.1 mM. Cells were harvested by centrifugation and resuspended in a sonication buffer (20 mM Tris/HCl, 500 mM NaCl, 50 mM Imidazole, Complete protease inhibitor cocktail [Roche Diagnostics], pH 7.5) and disrupted by sonication. A cell-free supernatant was applied to a Ni Sepharose High Performance column (HisTrap HP; GE Healthcare). Fractions containing Dps proteins were pooled and buffer exchanged using HiTrap (GE Healthcare) into 20 mM, 200 mM NaCl and 5% Glycerol. To assess stability, purified proteins were mixed with Urea (8 M) and incubated overnight; followed by native PAGE. Proteins were visualised using Coomassie Blue staining.

Funding Statement

This research has been supported by a grant from the BBSRC (BB/E019242/1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Matin A (1991) The molecular basis of carbon-starvation-induced general resistance in Escherichia coli. Molecular Microbiology 5: 3–10. [DOI] [PubMed] [Google Scholar]
  • 2. Almirón M, Link AJ, Furlong D, Kolter R (1992) A novel DNA-binding protein with regulatory and protective roles in starved Escherichia coli. Genes & Development 6: 2646–2654. [DOI] [PubMed] [Google Scholar]
  • 3. Chowdhury RP, Saraswathi R, Chatterji D (2010) Mycobacterial stress regulation: The Dps "twin sister" defense mechanism and structure-function relationship. IUBMB Life 62: 67–77. [DOI] [PubMed] [Google Scholar]
  • 4. Pesek J, Büchler R, Albrecht R, Boland W, Zeth K (2011) Structure and Mechanism of Iron Translocation by a Dps Protein from Microbacterium arborescens. Journal of Biological Chemistry 286: 34872–34882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Calhoun LN, Kwon YM (2010) Structure, function and regulation of the DNA-binding protein Dps and its role in acid and oxidative stress resistance in Escherichia coli: a review. J Appl Microbiol 110: 375–386. [DOI] [PubMed] [Google Scholar]
  • 6. Chiancone E, Ceci P (2010) The multifaceted capacity of Dps proteins to combat bacterial stress conditions: Detoxification of iron and hydrogen peroxide and DNA binding. Biochim Biophys Acta 1800: 798–805. [DOI] [PubMed] [Google Scholar]
  • 7. Peña MMO, Bullerjahn GS (1995) The DpsA Protein of Synechococcus sp. Strain PCC7942 Is a DNA-binding Hemoprotein. Journal of Biological Chemistry 270: 22478–22482. [DOI] [PubMed] [Google Scholar]
  • 8. Takatsuka M, Osada-Oka M, Satoh EF, Kitadokoro K, Nishiuchi Y, et al. (2011) A Histone-Like Protein of Mycobacteria Possesses Ferritin Superfamily Protein-Like Activity and Protects against DNA Damage by Fenton Reaction. PLoS One 6: e20985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Grant RA, Filman DJ, Finkel SE, Kolter R, Hogle JM (1998) The crystal structure of Dps, a ferritin homolog that binds and protects DNA. Nat Struct Biol 5: 294–303. [DOI] [PubMed] [Google Scholar]
  • 10. Kim SG, Bhattacharyya G, Grove A, Lee YH (2006) Crystal structure of Dps-1, a functionally distinct Dps protein from Deinococcus radiodurans. J Mol Biol 361: 105–114. [DOI] [PubMed] [Google Scholar]
  • 11.Andrews SC (2010) The ferritin-like superfamily: Evolution of the biological iron storeman from a rubrerythrin-like ancestor. Biochima et Biophysica Acta: 691-705. [DOI] [PubMed]
  • 12. Zhang Y, Orner BP (2011) Self-Assembly in the Ferritin Nano-Cage Protein Superfamily. International Journal of Molecular Sciences 12: 5406–5421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Fan R, Boyle AL, Cheong W, Ng Sl, Orner BP (2009) A helix swapping study of two protein cages. Biochemistry 48: 5623–5630. [DOI] [PubMed] [Google Scholar]
  • 14. Haikarainen T, Papageorgiou AC (2010) Dps-like proteins: structural and functional insights into a versatile protein family. Cell Mol Life Sci 67: 341–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Bhattacharyya G, Grove A (2007) The N-terminal extensions of Deinococcus radiodurans Dps-1 mediate DNA major groove interactions as well as assembly of the dodecamer. J Biol Chem 282: 11921–11930. [DOI] [PubMed] [Google Scholar]
  • 16. Roy S, Saraswathi R, Gupta S, Sekar K, Chatterji D, et al. (2007) Role of N and C-terminal tails in DNA binding and assembly in Dps: structural studies of Mycobacterium smegmatis Dps deletion mutants. J Mol Biol 370: 752–767. [DOI] [PubMed] [Google Scholar]
  • 17. Su M, Cavallo S, Stefanini S, Chiancone E, Chasteen ND (2005) The so-called Listeria innocua ferritin is a Dps protein. Iron incorporation, detoxification, and DNA protection properties. Biochemistry 44: 5572–5578. [DOI] [PubMed] [Google Scholar]
  • 18. Ishikawa T, Mizunoe Y, Kawabata S, Takade A, Harada M, et al. (2003) The iron-binding protein Dps confers hydrogen peroxide stress resistance to Campylobacter jejuni. J Bacteriol 185: 1010–1017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Facey PD, Hitchings MD, Saavedra-Garcia P, Fernandez-Martinez L, Dyson PJ, et al. (2009) Streptomyces coelicolor Dps-like proteins: differential dual roles in response to stress during vegetative growth and in nucleoid condensation during reproductive cell division. Mol Microbiol 73: 1186–1202. [DOI] [PubMed] [Google Scholar]
  • 20. Nair S, Finkel SE (2004) Dps protects cells against multiple stresses during stationary phase. J Bacteriol 186: 4192–4198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Thieme D, Grass G (2010) The Dps protein of Escherichia coli is involved in copper homeostasis. Microbiol Res 165: 108–115. [DOI] [PubMed] [Google Scholar]
  • 22. Choi SH, Baumler DJ, Kaspar CW (2000) Contribution of dps to acid stress tolerance and oxidative stress tolerance in Escherichia coli O157:H7. Appl Environ Microbiol 66: 3911–3916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Nicodeme M, Perrin C, Hols P, Bracquart P, Gaillard JL (2004) Identification of an iron-binding protein of the Dps family expressed by Streptococcus thermophilus. Curr Microbiol 48: 51–56. [DOI] [PubMed] [Google Scholar]
  • 24. Roy S, Saraswathi R, Chatterji D, Vijayan M (2008) Structural studies on the second Mycobacterium smegmatis Dps: invariant and variable features of structure, assembly and function. J Mol Biol 375: 948–959. [DOI] [PubMed] [Google Scholar]
  • 25. Schwartz JK, Liu XS, Tosha T, Diebold A, Theil EC, et al. CD and MCD spectroscopic studies of the two Dps miniferritin proteins from Bacillus anthracis: role of O2 and H2O2 substrates in reactivity of the diiron catalytic centers. Biochemistry 49: 10516–10525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Reon BJ, Nguyen KH, Bhattacharyya G, Grove A (2012) Functional comparison of Deinococcus radiodurans Dps proteins suggests distinct in vivo roles. Biochemical Journal Epub ahead of print. [DOI] [PubMed]
  • 27. Saraswathi R, Pait Chowdhury R, Williams SM, Ghatak P, Chatterji D (2009) The Mycobacterial MsDps2 Protein Is a Nucleoid-Forming DNA Binding Protein Regulated by Sigma Factors σA and σB. PLoS One 4: e8017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gupta S, Pandit SB, Srinivasan N, Chatterji D (2002) Proteomics analysis of carbon-starved Mycobacterium smegmatis: induction of Dps-like protein. Protein Eng 15: 503–512. [DOI] [PubMed] [Google Scholar]
  • 29. Roy S, Gupta S, Das S, Sekar K, Chatterji D, et al. (2003) Crystallization and preliminary X-ray diffraction analysis of Mycobacterium smegmatis Dps. Acta Crystallogr D Biol Crystallogr 59: 2254–2256. [DOI] [PubMed] [Google Scholar]
  • 30. Facey PD, Sevcikova B, Novakova R, Hitchings MD, Crack JC, et al. (2011) The dpsA Gene of Streptomyces coelicolor: Induction of Expression from a Single Promoter in Response to Environmental Stress or during Development. PLoS One 6: e25593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Chowdhury RP, Gupta S, Chatterji D (2007) Identification and characterization of the dps promoter of Mycobacterium smegmatis: promoter recognition by stress-specific extracytoplasmic function sigma factors sigmaH and sigmaF. J Bacteriol 189: 8973–8981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis GL, Thomson NR, et al. (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417: 141–147. [DOI] [PubMed] [Google Scholar]
  • 33. Fisher G, Decaris B, Leblond P (1997) Occurrence of deletions, associated with genetic instability in Streptomyces ambofaciens, is independent of the linearity of the chromosomal DNA. Journal of Bacteriology 179: 4553–4558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Choulet F, Aigle B, Gallois A, Mangenot S, Gerbaud C, et al. (2006) Evolution of the Terminal Regions of the Streptomyces Linear Chromosome. Molecular Biology and Evolution 23: 2361–2369. [DOI] [PubMed] [Google Scholar]
  • 35. Athane A, Bilhere E, Bon E, Morel G, Lucas P, et al. (2008) Characterization of an acquired dps-containing gene island in the lactic acid bacterium Oenococcus oeni. J Appl Microbiol 105: 1866–1875. [DOI] [PubMed] [Google Scholar]
  • 36. Doroghazi JR, Buckley DH (2010) Widespread homologous recombination within and between Streptomyces species. ISME J 4: 1136–1143. [DOI] [PubMed] [Google Scholar]
  • 37. Gupta S, Chatterji D (2003) Bimodal Protection of DNA by Mycobacterium smegmatis DNA-binding Protein from Stationary Phase Cells. Journal of Biological Chemistry 278: 5235–5241. [DOI] [PubMed] [Google Scholar]
  • 38.Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces Genetics. Norwich: John Innes Foundation.
  • 39. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research 29: e45–e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Moreno-Hagelsieb G, Latimer K (2008) Choosing BLAST options for better detection of orthologs as reciprocal best hits. Bioinformatics 24: 319–324. [DOI] [PubMed] [Google Scholar]
  • 41. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. Journal of Molecular Biology 215: 403–410. [DOI] [PubMed] [Google Scholar]
  • 42.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al.. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution. [DOI] [PMC free article] [PubMed]
  • 43. Cole C, Barber JD, Barton GJ (2008) The Jpred 3 secondary structure prediction server. Nucleic Acids Research 36: W197–W201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Smulczyk-Krawczyszyn A, Jakimowicz D, Ruban-Ośmiałowska B, Zawilak-Pawlik A, Majka J, et al. (2006) Cluster of DnaA Boxes Involved in Regulation of Streptomyces Chromosome Replication: from In Silico to In Vivo Studies. Journal of Bacteriology 188: 6184–6194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Hopwood DA (2006) Soil To Genomics: The Streptomyces Chromosome. Annu Rev Genet 40: 1–23. [DOI] [PubMed] [Google Scholar]
  • 46. Maccari G, Gemignani F, S L (2010) COMPASSS (COMplex PAttern of Sequence Search Software), a simple and effective tool for mining complex motifs in whole genomes. Bioinformatics 26: 1777–1778. [DOI] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES