Pituitary Adenylate Cyclase-Activating Peptide and Vasoactive Intestinal Polypeptide Bias Langerhans Cell Ag Presentation Towards Th17 Cells

Abstract

Epidermal Langerhans cells (LCs) are dendritic APCs that play an important role in cutaneous immune responses. LCs are associated with epidermal nerves and the neuropeptides vasoactive intestinal polypeptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) inhibit LC Ag presentation for Th1-type immune responses. Here we examined whether PACAP or VIP modulates LC Ag presentation for induction of IL-17A-producing CD4⁺ T cells. Treatment with VIP or PACAP prior to in vitro LC Ag presentation to CD4⁺ T cells enhanced IL-17A, IL-6 and IL-4 production, decreased IFN-γ and IL-22 release and increased RORγt and Gata3 mRNA expression while decreasing T-bet expression. The CD4⁺ T cell population was increased in IL-17A- and IL-4-expressing cells and decreased in IFN-γ-expressing cells. Addition of anti-IL-6 mAb blocked the enhanced IL-17A production seen with LC pre-exposure to VIP or PACAP. Intradermal administration of VIP or PACAP prior to application of a contact sensitizer at the injection site, followed by harvesting of draining lymph node CD4⁺ T cells and stimulation with anti-CD3/anti-CD28 mAbs, enhanced IL-17A and IL-4 production but reduced production of IL-22 and IFN-γ. PACAP and VIP are endogenous mediators that likely regulate immunity and immune-mediated diseases within the skin.

Introduction

Langerhans cells (LCs) are epidermal dendritic APCs that, when activated or matured, can present haptens, immunogenic peptides, and tumor Ag for T cell-dependent immune response [1–4]. LCs often lie in apposition to nerves and calcitonin gene-related peptide (CGRP), a neuropeptide present in epidermal nerves, can regulate LC Ag-presenting function, providing evidence for a regulatory interaction between the nervous system and the immune system within the skin [5–7]. Vasoactive intestinal polypeptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) are members of a superfamily that includes secretin, glucagon and growth hormone-releasing hormone. They bind to an overlapping group of receptors. Two of these, VPAC1 and VPAC2, bind PACAP and VIP with equal affinity. Both are G protein-coupled receptors that activate adenylate cyclase [8–10]. PACAP exists in two forms, a 38 aa molecule (PACAP38) and a 27 aa form (PACAP27) [11]. These have identical activities in most biological systems. Although both types can be found in tissues, PACAP38 is the dominant form [11]. VIP is a 28 aa peptide that has 68% homology with PACAP27 [11]. PACAP38 and VIP immunoreactive nerve fibers are present in human skin [12–14]. VIP and PACAP inhibit LC ability to present Ag in several systems [15, 16] and this effect likely involves, at least in part, inhibition of NF-κB activation [17].

Classically, effector CD4⁺ Th cells were assigned to two different types based on their cytokine expression: IFN-γ− and IL-2-secreting Th1 cells or IL-4- and IL-5-secreting Th2 cells [18, 19]. The discovery of IL-17-producing Th17 cells and IL-22-producing Th22 cells has challenged this paradigm [20–22]. Th17 cells are inflammatory CD4⁺ T cells that produce IL-17 family cytokines and require expression of the retinoid-related orphan receptor ROR γt [23]. IL-6 is a major regulator of the balance between Treg and Th17 cells [24]. Th17 cells carry skin and mucosal homing receptors such as CCR6 and CCR4 [25] and recruit neutrophils and monocytes within tissues [26]. The physiologic function of Th17 cells appears to center on defense against extracellular bacteria and, perhaps, fungi [20]. Recent work suggests strongly that IL-17A is involved in the pathogenesis of a diverse group of immune-mediated diseases. Much attention has been paid to its involvement in chronic skin diseases including psoriasis and atopic dermatitis [28–31]. Psoriatic lesional skin has enhanced IL-23 and IL-17A expression together with an increased population of Th17 cells [30, 32]. Moreover, IL-6, which is necessary for Th17 priming, is over-expressed in lesions of psoriasis [33, 34].

LCs link the innate and adoptive immune systems by priming naïve T cells that can become polarized toward a particular Th cell subtype. LC exposure to CGRP inhibits LC-Ag presentation for Th1 responses and biases Ag presentation toward Th2-type immunity [6, 7, 35]. We have now asked whether PACAP or VIP influences the ability of LCs to generate a Th17 response during Ag presentation. We found that both VIP and PACAP modulate LC Ag presentation for an IL-17A or IL-22 response with in vitro Ag-presenting assays. Injection of PACAP or VIP intradermally into mice followed by immunization to a hapten at the injected site similarly modulated the cytokine response by stimulated draining lymph node cells. We suggest that these neuropeptides regulate immune processes in the skin and this signaling system may potentially be a target for therapy.

Results

LC exposure to PACAP or VIP enhances the IL-17A response of CD4⁺ cells upon Ag presentation

T cells from DO11.10 Tg mice recognize presentation of (cOVA_323–339) [36, 37]. CD4⁺ T cells from DO11.10 Tg mice were enriched to ~97% homogeneity (Fig. 1A). To determine whether PACAP or VIP influences the ability of LCs to generate an IL-17A response during Ag presentation, LCs from BALB/c mice were cultured in VIP, PACAP or medium alone, washed, and then co-cultured with DO11.10 Tg CD4⁺ T cells in the presence of varying concentrations of cOVA_323–339. After 48-h, supernatants were assayed for IL-17A content. LC exposure to VIP or PACAP significantly enhanced the IL-17A response (Fig. 1B). FACS analysis of CD4⁺ T cells stimulated in this manner showed that exposure of LCs to either PACAP or VIP enhances Ag presentation for induction of IL-17A-expressing CD4⁺ T cells (Fig. 2A, lower panel). Double– staining for IL-17 and IFN-γ demonstrated a substantial increase in IL-17 single-positive cells along with a substantial decrease in IFN-γ single-positive cells with PACAP or VIP treatment of LCs (Fig. 2A, lower panel). There also appeared to be a modest generation of IL-17, IFN-γ double-positive cells.

Figure 1.

LC treatment with PACAP or VIP prior to Ag presentation enhances the IL-17 response of CD4⁺ T cells. (A) CD4⁺ T cells from splenocytes of DO11.10 Tg mice were enriched to ~97% by flow cytometry. (B) Exposure of LCs to PACAP or VIP biases Ag presentation towards enhanced IL-17 production. LCs from BALB/c mice were cultured in VIP (left), PACAP (right) or CM alone. They were then washed 4 times and co-cultured with DO11.10 Tg CD4⁺ T cells in the absence or presence of varying concentrations of cOVA_323–339. After 48 h, culture supernatants were assayed for IL-17 content. Data are shown as the mean ± SD of 3 separate plates set-up with 2 wells per condition in each plate, and are representative of 3 such experiments. ^*P < 0.05, ^*** P < 0.001, CM group vs VIP or PACAP groups, ANOVA.

Figure 2.

LC treatment with PACAP or VIP biases Ag presentation towards generation of IL-17-containing CD4⁺ T cells. (A) Experiments were set-up as in Figure 1B. Cells were stimulated with PMA and ionomycin for the last 5-h of co-culture and LCs still bound to beads were removed. Remaining cells were surface-stained with anti-CD4 mAb and intracellularly stained with anti-IL-17 mAb followed by flow cytometry analysis. Black line histogram = no VIP or PACAP, gray line histogram = VIP or PACAP, filled histogram = isotype control. A dot-blot is also shown with double-staining for intracellular IL-17 and IFN-γ (IgG - isotype control). Similar data were obtained in 3 independent experiments. (B) Effect of exposure of LCs to PACAP or VIP on expression of RORγt, T-bet, Gata3 and AHR. Experiments were set-up as in Figure 1B. Twenty-four h later, LCs still bound to beads were removed and remaining CD4⁺ T cells were collected for RNA extraction. Expression of RORγt, T-bet, Gata3 and AHR was quantified by real-time RT-PCR using specific primers and GAPDH as an internal control, and normalized to cultures with LCs not exposed to VIP or PACAP. Data are shown as the mean + SD of 4 experiments. ^***P < 0.001; CM group vs VIP or PACAP groups, simultaneous tests for general linear hypotheses underlying the linear mixed effects model.

We assessed cell proliferation by measuring lactic dehydrogenase content of cells in wells setup in an identical manner by lysing cells after 48 h of culture. Pretreatment of LCs with PACAP or VIP did not significantly change cell proliferation compared with LCs treated with CM alone (data not shown). Separate experiments examining cell proliferation with the MTT assay yielded the same result (data not shown).

The orphan nuclear receptor RORγt directs the differentiation program of Th17 cells [18]. As another test of whether exposure to VIP or PACAP enhances LC Ag presentation for Th17 polarization, we set-up these Ag-presenting cultures and 24-h later LCs still bound to magnetic beads were removed and RORγt mRNA expression of the remaining cells (primarily CD4⁺ T cells) was assessed using real-time PCR. We found significantly higher expression of RORγt mRNA in groups in which LCs were cultured in VIP or PACAP compared with control groups cultured with non-treated LCs (Fig. 2B). We also examined the effect of PACAP or VIP exposure of LCs on expression of transcription factors relevant to production of Th1 cells (T-bet), Th2 cells (Gata3) and IL-22 (AHR). Pre-exposure to PACAP or VIP led to reduced expression of T-bet and enhanced expression of Gata3 (Fig. 2B), consistent with the effects observed on IFNγ and IL-4 expression (below). No effect on AHR expression was observed despite a decrease in IL-22 release observed after LC exposure to PACAP or VIP (below). Thus, effects of these neuropeptides on IL-22 production does not appear to depend on modulation of AHR expression.

LC Exposure to PACAP or VIP inhibits CD4⁺ cell IL-22 and IFN-γ responses but enhances the IL-4 response

IL-22 production by T cells was initially considered to be a characteristic of the Th17 lineage [38–40]. Furthermore, IL-22 is thought to play an important role in inflammatory skin diseases such as atopic dermatitis and psoriasis [40–44]. We examined whether VIP or PACAP influences LC Ag presentation for an IL-22 response. Experiments were set-up as above. Exposure of LCs to VIP or PACAP decreased the IL-22 response of CD4⁺ T cells upon presentation of cOVA_323–339 (Fig. 3A), suggesting divergent regulation of IL-17A and IL-22. Furthermore, exposure of LC to VIP or PACAP enhanced the IL-4 response while decreasing the IFN-γ response (Fig. 3A). These results were confirmed by FACS analysis of CD4⁺ T cells (Fig. 3B) which showed an increase in a subpopulation of cells producing IL-4 with a decrease in IFN-γ-producing cells. Double–staining for IL-17 and IL-4 demonstrated a substantial increase in IL-17 single-positive cells, as expected, along with a substantial increase in IL-4 single-positive cells with PACAP or VIP treatment of LCs (Fig. 3B, lower panel). There is a suggestion of a small generation of IL-17, IL-4 double-positive cells.

Figure 3.

LC treatment with PACAP or VIP prior to Ag presentation decreases IL-22 and IFN-γ responses while enhancing the IL-4 response. (A) VIP or PACAP treatment of LCs before Ag presentation to CD4⁺ T cells results in decreased IL-22 and IFN-γ production with increased IL-4 production. BALB/c LCs were cultured in VIP, PACAP or CM alone. LCs were then washed 4 times and co-cultured with DO11.10 Tg CD4⁺ T cells in the absence or presence of the indicated concentrations of cOVA_323–339. After 48 h, supernatants were harvested and assayed for IL-22, IL-4 and IFN-γ. Data are shown as the mean ± SD of 3 separate plates set-up with 2 wells per condition per plate, and are representative of 3 such experiments.^*P <0.05,^**P < 0.01,^***P < 0.001, CM group vs VIP or PACAP groups, ANOVA. (B) Pretreatment of LCs with PACAP or VIP increases IL-4-containing CD4⁺ T cells while decreasing IFN-γ -containing cells. Experiments were set-up as in (A). For the last 5-h of co-culture, cells were stimulated with PMA and ionomycin. LCs still bound to beads were thereafter removed and remaining cells were surface-stained with anti-CD4 mAb and intracellularly stained with anti-IL-4 mAb or anti-IFN-γ mAb followed by flow cytometry analysis. Black line histogram = no VIP or PACAP, gray line histogram = VIP or PACAP, filled histogram = isotype control. A dot-blot is also shown with double-staining for intracellular IL-17 and IL-4 (IgG - isotype control). Similar data were obtained in 2 independent experiments. (C) Pretreatment of LCs with PACAP or VIP decreases IL-22-containing CD4⁺ T cells. A dot-blot is also shown with double-staining for intracellular IL-17 and IL-22 (IgG - isotype control). Similar data were obtained in 2 independent experiments.

We also performed double-staining for IL-17 and IL-22. Intracellular IL-22 could be ascertained in only a small number of cells (Fig. 3C). Treatment of LCs with VIP or PACAP appeared to decrease IL-22-positive cells while increasing IL-17-positive cells (as above). Interestingly, in our experiments some IL-22-positive cells appeared to be single-positive.

Neutralization of IL-6 inhibits VIP and PACAP effects on LC Ag presentation for an IL-17A response

To determine whether IL-6 is involved in PACAP and VIP effects on the IL-17A response, we first examined whether VIP or PACAP influence IL-6 production upon presentation of cOVA_323–339. LC exposure to VIP or PACAP enhanced IL-6 production upon Ag presentation to responsive CD4⁺ T cells (Fig. 4A). We then set-up similar experiments in which anti-IL-6 mAb were added to Ag presentation cultures to neutralize this cytokine with isotype control mAb added to control wells. Addition of anti-IL-6 mAb significantly blocked the effects of VIP or PACAP on enhancement of IL-17A production (Fig. 4B).

Figure 4.

IL-6 is involved in VIP- and PACAP-mediated polarization of LC Ag presentation. (A) VIP or PACAP treatment of LCs leads to enhanced IL-6 production. BALB/c LCs were cultured in VIP, PACAP or CM alone. LCs were then washed 4 times and co-cultured with DO11.10 Tg CD4⁺ T cells in the presence or absence of varying concentrations of cOVA_323–339. After 48 h, supernatants were assayed for IL-6 content. Data are shown as the mean ± SD of 3 separate plates with 2 wells per condition in each plate and are representative of 3 such experiments TC = T cells alone; LC = LCs alone. (B) Neutralization of IL-6 inhibits the enhancing effects of VIP and PACAP on LC Ag presentation for an IL-17 response. BALB/c LCs were cultured in VIP, PACAP or CM alone. LCs were then washed 4 times and co-cultured with DO11.10 Tg CD4⁺ T cells in the presence or absence of anti-IL-6 mAb or isotype control mAb, followed by adding cOVA_323–339. After 48 h, supernatants were assayed for IL-17 content. Data are shown as the mean ± SD of 3 separate plates with 2 wells per condition in each plate and are representative of 3 independent experiments.^**P < 0.01,^***P < 0.001, CM group vs VIP or PACAP groups, simultaneous tests for general linear hypotheses underlying the linear mixed effects model.

Effect of intradermal PACAP or VIP on the CD4⁺ lymph node cell response to epicutaneous immunization

To determine whether VIP or PACAP can modulate the immune response in vivo, groups of BALB/c mice were injected intradermally with PACAP, VIP or medium alone. Fifteen minutes later, mice were immunized by topical application of dinitrofluorobenzene (DNFB) at sites of injection. Three days later, draining lymph nodes were harvested and a single cell suspension of lymphocytes was stimulated in culture with anti-CD3 and anti-CD28. After 72-hr, supernatants were assayed for cytokine content. Lymphocytes from mice treated with PACAP or VIP produced significantly more IL-17A and IL-4 with significantly less IL-22 and IFN-γ compared with cells from control mice (Fig. 5).

Figure 5.

Intradermal administration of PACAP or VIP prior to hapten painting at injected sites enhances IL-17 and IL-4 production while inhibiting IL-22 and IFN-γ production by stimulated CD4⁺ lymphocytes from draining lymph nodes. Groups of 10 BALB/c mice were injected intradermally in the mid-dorsal area with VIP, PACAP or PBS alone. Fifteen minutes after injection, each mouse was painted with DNFB at the injection site. Three days after immunization, draining lymph nodes were removed. CD4⁺ T cells were isolated and cultured in wells in 96-well plates coated with anti-mouse CD3 mAb in CM containing anti-mouse CD28 mAb. After 48 h, supernatants were assayed for IL-17, IL-4, IFN-γ and IL-22. Data are shown as the mean ± SD of 3 separate plates set-up at the same time with two wells per condition in each plate and are representative of 2 such experiments.^**P< 0.01, ^***P< 0.001, CM group vs VIP or PACAP groups, simultaneous tests for general linear hypotheses underlying the linear mixed effects model.

Discussion

Among the skin’s protective properties are innate and adaptive immune functions to protect against environmental and microbiologic challenges [45]. Many observations suggest that the nervous system plays a role in regulating cutaneous immunity. Although definitive studies are difficult, it is generally believed that stress modulates inflammatory skin disorders including psoriasis, atopic dermatitis and roasacea, amongst others [46–48]. Of particular interest, psoriasis has been reported to clear from denervated sites [49–51], suggesting a role for the nervous system in that disorder. Both the LC-like cell line XS106 and primary murine LCs express mRNA for VPAC1 and VPAC2 receptors [52] and culture of LCs in VIP or PACAP inhibits their ability to present Ag for elicitation of delayed-type hypersensitivity in previously immunized mice [15, 16]. Also, intradermal administration of PACAP suppressed induction of contact hypersensitivity at the injected site [15]. PACAP and VIP inhibited the ability of LC to present Ag to a Th1 clone and augmented IL-10 production by a LPS-stimulated LC-like dendritic cell line, while downregulating LPS-stimulated IL-1β and IL-12 p40 production [15, 16, 53]. Our current observations, that PACAP or VIP treatment of LCs enhances the generation of Th17 cells and enhances IL-17A and IL-4 release while inhibiting IL-22 and IFN-γ production, support the hypothesis that neural activity regulates and directs immune function. Of course, LCs are not the only APCs in the skin; several dendritic cell subsets are present in murine skin that exhibit functional specialization [54]. There is evidence that LCs are able to present Ag for the generation of Th17 cells [54, 55] while Langerin⁺ dermal DCs do not [55]. While murine LCs have been reported to cross-present Ag in vitro, in vivo models indicate that Langerin⁺ dermal DCs may be responsible for CD8⁺ responses [56] and neither mature or immature human LCs could cross-present ultraviolet radiation-inactivated measles virus or measles virus-infected apoptotic cells [56]. Indeed, Langerin⁺ DCs, but not LCs, may play a role in the induction of CD4⁺ CD25⁺ Foxp3⁺ Treg cells [57]. In this regard, preliminary data demonstrate that BM-derived DCs (BM-DCs) are less efficient than LCs at promoting Th17 cell generation in our system and that pre-exposure to PACAP or VIP had only a small effect on augmenting Ag presentation for an IL-17A response (data not shown). Thus, there appears to be some specificity to the effect of PACAP/VIP on LCs.

An important question is the nature of the changes in LCs induced by PACAP or VIP relevant to the effects we have found. In preliminary experiments, we treated LCs in vitro with PACAP or VIP for 2 h and then examined expression of IL-6 and TGFβ1 at the protein level and by real-time PCR. As these cytokines are relevant to the differentiation of Th17 cells, we hypothesized that treatment with PACAP or VIP may have increased expression of IL-6 and/or TGFβ. However, no effect on expression of these cytokines was observed. Also, no change in expression of IL-12 p40 was seen. Perhaps treatment with these neuropeptides conditions LCs to respond to T cell products by producing enhanced amounts of IL-6 and/or TGFβ1. Alternatively, it is possible that these neuropeptides have different molecular or cell biologic effects on LCs relevant to generation of Th17 cells.

In the skin, IL-17A acts directly on keratinocytes and regulates production of MIP-3α, IL-8 and HBD2 [41, 52, 53]. IL-22 and IL-17A are expressed in psoriatic lesions along with an increased population of Th17 cells [23, 32]. Circulating Th17 cells are increased in psoriasis as are Th22 and Th1 cells [43]. Of particular interest, there are mouse models of psoriasis-like skin disease that involve roles for IL-23, IL-17A, Th1 and Th17 cells [43, 58]. A direct role for Th17 cell cytokines in the pathogenesis of psoriasis is suggested by the finding that the intradermal administration of IL-23 in mouse skin results in epidermal acanthosis [40]. Experiments with IL-out mice show that this effect of IL-23 is mediated by IL-22 [40]. Intradermal administration of IL-22 also results in acanthosis [44]. Also of interest, TLR-2-activated human LCs have been shown to promote Th17 differentiation via production of IL-1β, TGFβ, and IL-23 [59]. Human LCs have also been shown to induce Th22 cells [60].

Th22 cells are recently described human inflammatory CD4⁺ T cells that produce IL-22 but not IL-17A or IFN-γ [61–63]. IL-22 acts on non-hematopoietic epithelial cells including keratinocytes and epithelial cells of the digestive and respiratory tracts [64]. It triggers the production of antimicrobial peptides and expression of genes involved in cellular differentiation. Thus, IL-22 may be involved in early host defense against microbial pathogens and in epithelial homeostasis [65]. IL-22 mediates epidermal hyperplasia and keratinocyte proliferation by down-modulating terminal keratinocyte differentiation [41, 66, 67]. Hence, IL-22 producing T cells are thought to be involved in inflammatory diseases with marked epidermal acanthosis, such as psoriasis [41–44, 67]. While the IL-17A receptor is highly and widely expressed in normal human tissue, expression of the functional receptor for IL-22 is limited in distribution; it is highly expressed on hepatocytes, keratinocytes and a variety of epithelial tissues [68] but not on hematopoietic cells [38, 69]. To date, Th22 cells have not been described in mice.

Our findings that PACAP and VIP bias LCs to present Ag for enhanced IL-17A expression while suppressing expression of IL-22 highlight the complexity of neuropeptide regulation of Th cell circuits. The finding that PACAP or VIP treatment of LCs increased IL-4 expression along with augmented IL-17A expression is somewhat surprising. However, increased IL-4 production by T cells stimulated with PACAP or VIP-treated macrophages has been described [70, 71]. Importantly, these results were confirmed with an in vivo assay. Of course, BALB/c mice are biased towards Th2 responses [72] and the use of this strain may have influenced this result.

In addition to its involvement in psoriasis, Th17 cells are believed to have a significant role in autoimmune disorders [73–75].

A possible role of Th17 cells in antitumor immunity has also been considered [76, 77]. Evidence exists for both a protective role for these cells against malignancies as well as for promoting the development and growth of tumors (reviewed in [76, 77]).

Regulation of VIP and PACAP expression and release in the skin is poorly understood. In the mouse, topical or intracutaneously applied Ags induce a long-lasting increase in nerve density and axonal growth of SP/CGRP-containing fibers; this is seen as soon as 48 h after induction of inflammation [78]. Furthermore, PACAP expression in dorsal root ganglia is increased upon damage (axotomy) or inflammation [79]. Expression of PACAP38 and VIP are increased in psoriatic lesions [80, 81]. Serum levels of VIP are increased in both adults [82] and children [83] with atopic dermatitis and VPAC2 receptor expression by mast cells is decreased in acute lesions of atopic dermatitis [14]. Identification of significant functions for Th17 and Th22 cells in psoriasis and atopic dermatitis suggests that PACAP and/or VIP may have a regulatory role in these disorders. Indeed, as discussed above, nervous system influences have been found to modulate the expression of psoriasis. Our finding that these neuropeptides enhance IL-17A responses while depressing IL-22 responses demonstrate the complexity of putative neuropeptide regulation of these processes. Of course, these neuropeptides do not function alone and future experiments will examine their activities in combination with other regulatory factors. Identification of the conditions by which these or other neuropeptides may participate in the pathogenesis of inflammatory skin diseases could prove to be of considerable importance and may have implications for the development of novel approaches to the therapy of these disorders.

Materials and methods

Mice

Female BALB/c (H-2^d), and DO11.10 TCR Tg mice (BALB/c background) [C.Cg-Tg (DO11.10) 10Dlo/J] mice were purchased from The Jackson Laboratory. These mice carry MHC class II-restricted, rearranged TCR αand β chain genes that encode a TCR that recognizes a fragment of chicken OVA (cOVA_323–339) presented by I-A^d [36, 37]. All experiments involving animals were approved by the Institutional Animal Care and Use Committee of Weill Cornell Medical College.

Reagents

VIP and PACAP were purchased from Bachem; cOVA_323–339 from Peptides International; anti-mouse IL-6 and anti-mouse CD3 mAbs along with isotype controls from R&D Systems; and anti-mouse CD28 mAb from BD Biosciences.

Media and cell lines

Complete medium (CM) consisted of RPMI 1640 (Mediatech), 10% FBS (Gemini Bio-Products) 100 U/ml penicillin, 100 μg/ml streptomycin, 0.1 mM nonessential amino acids, 0.1 mM essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, and 10 mM HEPES buffer (all from Mediatech).

Preparation of epidermal LCs

Epidermal cells (ECs) were prepared using a modification of a standard protocol [15, 16]. Truncal skins of mice were shaved with electric clippers and chemically depilated. Subcutaneous fat and carnosus panniculus were removed by blunt dissection. Skin was floated dermis-side down for 45 min in Ca²⁺/Mg²⁺-free PBS containing 0.5 U of dispase/ml (BD Biosciences) and 0.38% trypsin (BD Biosciences). Epidermal sheets were collected by gentle scraping, washed, and dissociated by repetitive pipetting in HBSS (Mediatech) supplemented with 2% FBS. ECs were filtered through a 40-μm cell strainer (BD Biosciences) to yield ECs containing 2–3% LC.

ECs were incubated with anti-I-A^d mAb (BD Biosciences) (1/50 dilution) for 30 min at 4°C. They were then incubated with goat anti-mouse IgG conjugated to magnetic microspheres (Dynabeads M-450; Invitrogen) for 10 min with continuous, gentle agitation. LCs were isolated by placing the tube in a magnetic particle concentrator (Dynal Biotech), discarding the supernatant and washing the bead-bound cells (up to 5 times) with HBSS containing 2% FBS. By FACS (using anti-I-A^d mAb), this procedure yields a population of ~95% LCs.

Isolation of CD4⁺ T cells from DO11.10 Tg mice

DO11.10 Tg mouse spleens were mechanically disrupted to yield a single cell suspension and erythrocytes lysed. CD4⁺ cells were obtained by removal of NK and NK T cells with magnetic microspheres linked to anti-CD49b monoclonal antibodies (Miltenyi Biotec) followed by negative selection using anti-mouse CD45R, anti-CD11b, anti-Ter119, anti-CD16/32, and anti-CD8 antibodies linked to magnetic microspheres (Invitrogen) according to the manufacturer’s instructions. This procedure yielded a T cell population of ~97% CD4⁺ T cells by FACS.

In vitro Ag presentation to CD4⁺ T cells from DO11.10 Tg mice

BALB/c LCs were plated in 96-well round bottom plates (10⁴ cells/well), and exposed to VIP, PACAP or medium alone for 2-h at 37°C. Cells were then washed 4 times with CM. Neuropeptide-treated or untreated LCs were co-cultured in each well with 2×10⁵ CD4⁺ T cells from DO11.10 Tg mice (BALB/c background) in 200 μl of CM with varying concentrations of cOVA_323–339. Forty-eight h later cytokine content of supernatants was assessed. In some experiments 0.5 μg/ml of anti-IL-6 mAb or the isotype control was added to sets of wells when setting up the co-cultures of LCs and T cells.

Cytokine determination

Supernatant IL-17A, IFN-γ IL-22 and IL-6 levels were determined with sandwich ELISA kits from R&D systems (IL-17A, IL-4 and IL-6), Agix America (IL-22) and BD Biosciences (IFN-γ), following the manufacturer's instructions.

Flow cytometry

LCs were treated with 100 nM VIP, PACAP or medium alone for 2-h, washed 4 times, and then co-cultured with CD4⁺ T cells from DO11.10 Tg mice in the presence of 10 µM OVA_323–339 for 48 h. For the last 5-h of co-culture, cells were stimulated with 50 ng/ml PMA and 750 ng/ml ionomycin (Sigma-Aldrich). After 1-h, GolgiStop (BD Biosciences) was added to block cytokine secretion. LCs still bound to beads were then removed by magnetic capture. CD4⁺ T cells were surface stained for 20–30 min at 4°C with PerCP-Cy 5.5-labled anti-CD4 mAb (BD Biosciences) in PBS supplemented with 1 % BSA and 0.2 % sodium azide. CD4⁺ cells were gated upon as shown in Supporting Information Fig. 1. After fixation and permeabilization with Cytofix/Cytoperm (BD Biosciences), cells were stained with FITC or Alexa Fluor 647-labeled anti-IFN-γ (clone XMG1.2; BD Biosciences), PE or Alexa Fluor 647-lableled anti-IL-17A (clone TC11-18H10; BD Biosciences), anti-IL-4 (clone 11B11, BD Biosciences) and/or anti-IL22 (clone 1H8PWSR, eBioscience) clone monoclonal antibodies. Analysis was performed on a FACSCalibur (BD Biosciences). Data analysis was conducted using CellQuest Pro software (BD Biosciences).

Real-time PCR

LCs were cultured in 100 nM VIP, PACAP or medium alone for 2-h, and then co-cultured with CD4⁺ T cells from DO11.10 Tg mice in the presence of 10 μM OVA_323–339 for 24-h. Cultures were stimulated with PMA (50 ng/ml) and ionomycin (750 ng/ml) for 5-h, and LCs still bound to beads were removed by magnetic capture. Total RNA was isolated from the remaining cells (primarily CD4⁺ T cells) using the RNeasy Plus Mini Kit (Qiagen); DNA eliminator columns were used to eliminate any contamination with genomic DNA. cDNA was synthesized using a high-capacity RNA-to-cDNA kit according to the manufacturer’s instructions (Applied Biosystems). Real-time PCR for RORγt, T-bet, Gata3 and AHR expression was performed using power SYBR Green PCR Master Mix (Applied Biosystems). Primers utilized were: RORγt - 5’-GGCTGTCAAAGTGATCT GGA-3’ forward; 5’-CCTAGGGATACCACCCTTCA-3’ reverse; T-bet – 5’- CTGCCTGCAGTGCTTCTAAC-3’ forward; 5’- GCTGAGTGATCTCTGCGTTC - 3’ reverse; Gata3 – 5’- ACTCAGGTGATCGGAAGAGC-3’ forward; 5’- AGAGGAATCCGAGTGTGACC -3’ reverse; AHR – 5’- CACTGACGGATGAAGAAGGA-3’ forward; 5’- TCGTACAACACAGCCTCTCC-3’ reverse. Expression was normalized to GAPDH.

Sensitization of mice to DNFB

BALB/c mice were divided into three groups of 5. Mice were shaved on the dorsum with electric clippers, and injected intradermally with 100 μl of PBS containing 530 pmol VIP, 530 pmol PACAP or PBS alone. Fifteen minutes after injection, the mice were painted with 10 μl of DNFB [1 % in acetone and olive oil (4:1)] epicutanousely at the injection site.

Preparation of supernatants conditioned by CD4⁺ T cells stimulated with anti-CD3 and anti-CD28

Three days after immunization, mice were sacrificed and draining lymph nodes (axillary and inguinal) removed. Lymph nodes were mechanically disrupted and passed through a 70 μm nylon mesh to yield a single cell suspension. CD4⁺ T cells were isolated as described above. Ninety-six well flat-bottom plates were treated with 10 µg/ml of anti-mouse CD3 mAb in PBS overnight and washed. T cells were cultured (3×10⁵ cells/well) in 250 µl of CM containing 2 µg/ml of anti-mouse CD28 mAb. Supernatants were collected 72-h after stimulation and cytokine content determined.

Biostatistics

Differences in average cytokine levels under different treatments at varying cOVA concentrations were analyzed using ANOVA. Average cytokine levels under each cOVA concentration were then compared between PACAP or VIP treatment and control groups. P-values were adjusted by controlling for the false discovery rate (FDR).

For assessment of mRNA levels, effects of intradermal administration of neuropeptides and effects of anti-IL-6 mAb on Ag-presenting cultures, a linear mixed-effects model was used to estimate the average level of the biomarkers under different treatments. This model takes into account variations for each treatment both within and between plate and samples. Differences in the average level of the biomarker under pairs of experimental conditions of interest were evaluated using simultaneous tests for general linear hypotheses [84]. P-values were again adjusted for multiple comparisons by controlling the FDR.

Abbreviations

DNFB

dinitrofluorobenzene

CGRP

calcitonin gene-related peptide

LC

Langerhans cell

PACAP

pituitary adenylate cyclase-activating peptide

VIP

vasoactive intestinal polypeptide