Abstract
Objectives:
Thanatophoric dysplasia (TD) is the most common form of lethal skeletal dysplasia. It is primarily an autosomal dominant disorder and is characterised by macrocephaly, a narrow thorax, short ribs, brachydactyly, and hypotonia. In addition to these core phenotypic features, TD type I involves micromelia with bowed femurs, while TD type II is characterised by micromelia with straight femurs and a moderate to severe clover-leaf deformity of the skull. Mutations in the FGFR3 gene are responsible for all cases of TD reported to date. The objective of the study here was to delineate further the mutational spectrum responsible for TD.
Methods:
Conventional polymerase chain reaction (PCR), allele-specific PCR, and sequence analysis were used to identify FGFR3 gene mutations in a fetus with a lethal skeletal dysplasia consistent with TD, which was detected during a routine antenatal ultrasound examination.
Results:
In this report we describe the identification of two de novo missense mutations in cis in the FGFR3 gene (p.Asn540Lys and p.Val555Met) in a fetus displaying phenotypic features consistent with TD.
Conclusion:
This is the second description of a case of TD occurring as a result of double missense FGFR3 gene mutations, suggesting that the spectrum of mutations involved in the pathogenesis of TD may be broader than previously recognised.
Keywords: Thanatophoric dysplasia, FGFR3, Skeletal dysplasia, Allele-specific PCR
Advances in Knowledge
- This study is only the second report in which the mutations in the FGFR3 gene differ from those classically implicated in the development of thanatophoric dysplasia (TD).
Applications to Patient Care
- The findings suggest that confirmation of a clinical diagnosis of thanatophoric dysplasia should include a comprehensive screen for mutations in all coding exons of the FGFR3 gene, particularly in the absence of one of the classic TD mutations.
Thanatophoric dysplasia (TD) is the most common form of lethal short-limb skeletal dysplasia with a prevalence of approximately 2/100,000 births.1 It was first described as thanatophoric dwarfism by Maroteaux and Lamy in 1967, undergoing a name change in 1977 as a result of a decision reached at the 2nd International Conference on the Nomenclature of Skeletal Dysplasias.2 It is characterised by a range of phenotypic features, foremost among which are macrocephaly, a narrow thorax, short ribs, brachydactyly, and micromelia.3 There are two forms of TD, designated TD type I and TD type II, which can be differentiated principally by the presence of bowed, rather than straight, femurs in TD type I and of a moderate to severe clover-leaf deformity of the skull in TD type II.3 A clover-leaf skull deformity may also occur in TD type I but is infrequent and less severe than in TD type II.3 Both subtypes of TD are considered lethal with most affected infants dying as a result of respiratory insufficiency within the first few hours of life; however, there are reports of a small number of affected individuals who have survived into childhood by virtue of aggressive ventilatory support.4
As with the other severe skeletal dysplasias, TD is frequently diagnosed following a routine antenatal ultrasound screening in the first or second trimester. The earliest radiological signs are increased nuchal thickness and short limbs, but these signs are non-specific.5,6 A molecular diagnosis may be made prenatally if genetic testing for TD is requested on deoxyribonucleic acid (DNA) extracted from a chorionic villus or amniocentesis sample, but is more commonly made following a post-mortem examination carried out to clarify the nature of the lethal skeletal dysplasia in question.5,6
TD is primarily an autosomal dominant disorder, resulting from heterozygous mutations in the FGFR3 gene that lead to ligand-independent activation of the receptor and disruption of cartilage function during linear bone growth.7 Mutations in the FGFR3 gene cause a spectrum of skeletal dysplasias ranging from the relatively mild hypochrondroplasia through to achondroplasia, severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), and thanatophoric dysplasia.7 As expected from the severity of the disorder, the majority of TD-related mutations in the FGFR3 gene are de novo and the recurrence risk for parents with a previously affected pregnancy is very low, particularly if both parents are phenotypically normal.3 A single case of somatic and germline mosaicism for the TD type 1 mutation Arg248Cys has been described.8 The mosaic individual in this instance was affected by a disproportionate asymmetric rhizomelic shortening of the limbs. Her only pregnancy was complicated by severe pre-eclampsia and resulted in the stillbirth of an infant with a phenotype consistent with TD.8
We present here a case in which TD was diagnosed prenatally by ultrasound scanning and describe the results of subsequent molecular analysis, which revealed a double de novo mutational event.
Methods
Informed consent was provided by the parents of the proband reported here; the proband was studied at the genetic level to confirm a clinical diagnosis of TD. The New Zealand multi-region ethics committee has ruled that cases of patient management do not require formal ethics committee approval.
A skin biopsy from the affected fetus was taken at autopsy and the tissue was cultured according to conventional cytogenetic techniques. Genomic DNA (gDNA) was isolated from the cultured cells by phenol/chloroform extraction and ethanol precipitation. In the case of peripheral blood in ethylenediaminetetraacetic acid (EDTA), gDNA was isolated using the Gentra Puregene DNA Extraction kit (Qiagen Pty Ltd, Doncaster, Australia).
The messenger ribonucleic acid (mRNA) sequence of transcript 1 of the FGFR3 gene was identified using the University of California Santa Cruz (UCSC) genome browser.9 This website provides a direct link to ExonPrimer for the design of primers flanking coding exons. The first coding exon of transcript 1 of the FGFR3 gene is exon 2, so primers were not designed against exon 1. ExonPrimer is a Perl script that uses a combination of Primer3 and Blat to design intronic primers against a complementary DNA (cDNA) of interest. Default parameters were used. The coverage (entire coding exon and at least 20 bp of flanking intronic sequence to allow interrogation of splice sites) and specificity of the primers were confirmed using the in-silico polymerase chain reaction (PCR) tool also available on the UCSC genome browser. All primers were checked for single nucleotide polymorphisms using the software tool available from the National Genetic Reference Laboratory, Manchester, UK.10 The primers were tailed with M13 sequences for ease of subsequent sequence analysis, and were synthesised by Invitrogen Ltd., (Renfrewshire, UK) [Table 1].
Table 1:
Primers for the amplification of all coding exons of the FGRF3 gene (Refseq accession number NM_000142.4)
| Exon | Forward primer | REVERSE PRIMER | Amplicon size (bp) |
|---|---|---|---|
| 2 | TGTAAAACGACGGCCAGTGAGCTGCCTTCCTCCTCC | CAGGAAACAGCTATGACCCGGGGCGTCACTCACAC | 380 |
| 3 | TGTAAAACGACGGCCAGTGCTGTGTCTGTAAACGGTGC | CAGGAAACAGCTATGACCGACCCACGCAGGGACTC | 441 |
| 4 | TGTAAAACGACGGCCAGTTCTCTCTGGTCATTGGTGGA | CAGGAAACAGCTATGACCAGCCCCTCCTGTATCCTGAG | 394 |
| 5 | TGTAAAACGACGGCCAGTTCCTACACAGGACGGGAAAC | CAGGAAACAGCTATGACCGGATGCTGCCAAACTTGTTC | 507 |
| 6 | TGTAAAACGACGGCCAGTCCATCTCCTGGCTGAAGAAC | CAGGAAACAGCTATGACCTGCGTCACTGTACACCTTGC | 500 |
| 7 | TGTAAAACGACGGCCAGTTGGACGTGCTGGGTGAG | CAGGAAACAGCTATGACCCAACCCCTAGACCCAAATCC | 433 |
| 8 | TGTAAAACGACGGCCAGTTGTGGACTCTGTGCGGTG | CAGGAAACAGCTATGACCCTTTGGCGTGTCCCGAG | 316 |
| 9 | TGTAAAACGACGGCCAGTCTCCCAGTGGTGCCTGC | CAGGAAACAGCTATGACCAGAGAGGGCTCACACAGCC | 422 |
| 10 | TGTAAAACGACGGCCAGTCTTCATTCAATGCTGGTGGA | CAGGAAACAGCTATGACCACAGAACCCCAGCCACAC | 436 |
| 11 | TGTAAAACGACGGCCAGTGAGCATGGAGGGCTTCCT | CAGGAAACAGCTATGACCTTTCCCGATCATCTTCATCA | 436 |
| 12 | TGTAAAACGACGGCCAGTGCCAAGCCTGTCACCGTAG | CAGGAAACAGCTATGACCACACCAGGTCCTTGAAGGTG | 487 |
| 13–14 | TGTAAAACGACGGCCAGTGGTAGGTGCGGTAGCGG | CAGGAAACAGCTATGACCCCAGGCGTCCTACTGGC | 594 |
| 15–16 | TGTAAAACGACGGCCAGTGGGGTCATGCCAGTAGG | CAGGAAACAGCTATGACCTATTCGGGAACAGCCTGAAG | 619 |
| 17–18 | TGTAAAACGACGGCCAGTCAGGCTGTTCCCGAATAAGG | CAGGAAACAGCTATGACCCACCAGCAGCAGGGTGG | 589 |
Blue and red coloured bases represent M13 sequences that tail the forward and reverse primers.
We used the freely accessible online tetra-primer amplification refractory mutation system (ARMS)-PCR primer design programme11 to design allele-specific PCR primers to target the DNA variants of interest.12 Specificity is ensured by not only using allele-specific primers with differing 3’ terminal bases but also including an additional mismatched base at position-2 from the 3’ end. Two pairs of primers were designed. Each pair contained one allele-specific primer that would result in amplification of only the wild-type allele of each of the two variants in question. The other primer in each pair was positioned such that the second variant was also included within the amplicon, thereby allowing the phase of the variants to be determined. These two additional primer pairs were likewise tailed with M13 sequences and were synthesised by Invitrogen Ltd. (Renfrewshire, UK).
Conventional and allele-specific PCR were performed using 1U Faststart Taq DNA polymerase (Invitrogen Ltd, Renfrewshire, UK), 50 ng genomic DNA, 2mM MgCl2, and 0.8 μM forward and reverse primers with the following cycle conditions: 95° C for 4 minutes, 35 cycles of 94° C for 45 seconds, 60° C for 30 seconds, 72° C for 30 seconds, and a final extension at 72° C for 10 minutes. All amplicons amplified efficiently under these conditions.
An amount of 5 μL of each PCR was cleaned with ExoSAP-IT (Affymetrix, Santa Clara, California, USA) prior to bidirectional DNA sequencing using M13 forward and reverse primers and Big-Dye Terminator, Version 3.0 (Applied Biosystems Ltd., Carlsbad, California, USA). An amount of 20 μL of sequenced product was purified using an automated Agencourt CleanSEQ (Agencourt Bioscience Corp., Beverly, Massachusetts, USA) procedure with the aid of an epMOTION 5075 liquid handling robot (Eppendorf, Hamburg, Germany). An amount 15 μL of purified product was then subjected to capillary electrophoresis using an Applied Biosystems model 3130xl genetic analyser.
The analysis of sequence traces was performed using Variant Reporter, Version 1.0 (Applied Biosystems). Genebank NM_000142.4 was used as the reference sequence, with cDNA number +1 corresponding to the A of the translation initiation codon. Amino acid numbering began at the first amino acid in RefSeq accession number NP_000133.1. Exons were numbered sequentially, with exon 2 being the first exon analysed (exon 1 is non-coding). Variant Reporter uses advanced algorithms and quality metrics to automate the detection of variants and to streamline the analysis process. Traces produced from the sequencing of allele-specific PCR amplicons were analysed manually.
Results
The fetus was the third child to non-consanguineous parents. The first antenatal ultrasound scan at 13 weeks gestation demonstrated a nuchal thickness of 2.0 mm. The second ultrasound at 19 weeks was technically very difficult because of fetal lie and maternal habitus. However, it demonstrated the presence of a grossly enlarged skull with an abnormal shape (biparietal diameter [BPD] 59 mm, head circumference [HC] 207 mm). The fetal chest was subjectively small and the limbs were short with both femoral length (FL) and humeral length (HL) well below the 5th centile (FL 22 mm; HL 19 mm). These findings were indicative of a lethal skeletal dysplasia. The parents were counselled accordingly and decided to proceed with a termination which was performed at 19 weeks and 5 days’ gestation.
Skeletal radiographs [Figure 1] showed a narrow thorax in both anteroposterior and lateral views. The skull was large in relation to the facial bones and abnormally shaped but without a clover-leaf appearance. The vertebral bodies were flat with an H-shaped appearance but no notching of the central portions of the upper and lower plates. There was narrowing of the lumbar interpediculate distances from L1–L3. The long bones were short and relatively broad with mild bowing of the femora. The metaphyseal regions were cupped and flared. The pelvic bones were short and broad with horizontal inferior margins of the iliac bones.
Figure 1:
Fetal phenotype: skeletal radiographs of anteroposterior (I), lateral (II) and pelvic (III) views.
Overall, the radiologic findings were consistent with TD with an overlap between TD type I and TD type II. The vertebral abnormalities were more consistent with TD type II, while the mild femoral angulation was not characteristic of TD type II, but was not as severe as would be expected in TD type I.
Conventional PCR and bidirectional sequence analysis of all coding exons of the FGFR3 gene in the affected fetus detected compound heterozygosity for the mutations c.1620C>A (p.Asn540Lys) and c.1663G>A (p.Val555Met) in exons 12 and 13, respectively, of the FGFR3 gene [Figure 2].
Figure 2:
(Panel A) Fetal genotype: sequence electropherograms show the c.1620C>A (p.Asn540Lys); (Panel B) c.1663G>A (p.Val555Met) variants in exons 12 and 13, respectively, of the FGFR3 gene in the affected fetus.
In order to determine the phase of these mutations, subsequent allele-specific PCR was performed [Figure 3]. Sequencing of the amplicons produced by allele-specific PCR demonstrated that the variants were present in cis [Figure 4].
Figure 3:
Sequences and primers for allele-specific PCR: allele-specific primer sequences are shown to determine the phase of the FGFR3 gene mutations detected in the affected fetus.
Figure 4:
Sequence electropherograms of allele-specific PCR. (Panel A)Amplicon produced by primers specific for wild-type allele at c.1663. The red arrow indicates position c.1620—note the apparent homozygosity for wild-type c.1620C. (Panel B) Amplicon produced by primers specific for wild-type allele at c.1620. The red arrow indicates position c.1663—note the apparent homozygosity for wild-type c.1663G.
DNA extracted from the peripheral blood of both parents was analysed for the presence of each of these variants. Both variants proved to be absent in each parent, indicating that they were most probably de novo in the fetus (gonadal mosaicism in one of the parents has not been excluded).
Discussion
The case we present here exhibits the classic phenotypic features of TD with overlapping features of type I and type II. Molecular genetic testing for TD type I involves either full sequence analysis of all coding exons of the FGFR3 gene (as was the approach taken in this case), or more targeted initial analysis of exons 7, 10, 15, and 19, which are the exons containing the mutations responsible for 99% of cases of TD type I reported to date. This is followed by full analysis if no mutation is identified.3 The mutations themselves can be placed into two classes. The first includes the two most common TD type I mutations, Arg248Cys and Tyr373Cys, and involves the creation of new unpaired cysteine residues.3 The second class of pathogenic TD type I mutations result in obliteration of the native stop codon and addition of a hydrophobic alpha helix-containing domain to the carboxyl terminus of the protein.3 The single mutation known to cause TD type II, p.Lys650Gly, destabilises the activation loop of the second portion of the split tyrosine kinase domain resulting in ligand-independent activation.11
Neither of the mutations detected in the fetus described above fall into these categories. The first variant, c.1620C>A (p.Asn540Lys), is present in the heterozygote state in approximately 72% of individuals with classic hypochondroplasia.14 The second variant, c.1663G>A (p.Val555Met), is not listed in the online Human Gene Mutation Database (HGMD) and does not appear to be reported in the literature. Bioinformatic analysis using the online prediction tools Polyphen-215 and SIFT16 suggests that it is highly likely to be of pathogenic significance. In addition, valine at position 555 is conserved across species.
Compound heterozygosity in trans for the Asn540Lys mutation and the Gly380Arg mutation that is responsible for 98% of cases of achondroplasia17 has been reported.18–21 Individuals who are compound heterozygotes for these two variants typically display a more severe skeletal phenotype than seen in classical achondroplasia, but the condition is still compatible with survival, unlike the lethal form of achondroplasia that results from homozygosity for the Gly380Arg mutation. It has been shown that the level of ligand-independent tyrosine kinase activity is directly related to the skeletal phenotype, so it is to be expected that the combination of the less-activating mutation Asn540Lys and Gly380Arg will result in a less severe phenotype than that caused by homozygosity for Gly380Arg alone.13
In contrast, a case of apparent TD type I in association with compound heterozygosity for Asn540Lys and a second previously unreported mutation, Gln485Arg, has also been described.22 In this instance, as in our case, the two FGFR3 mutations identified were de novo in the affected fetus and in cis. Analysis of the deduced X-ray crystallographic structure of FGFR3 led the authors to postulate that the presence of two mutations in cis alters the receptor structure to such an extent that it is held in a fully activated state, with each mutation attenuating the effect of the other, leading to the lethal form of skeletal dysplasia characteristic of TD.22
Each of the mutations identified in our fetus is located within the first portion of the split intra-cellular tyrosine kinase domain.23 It has been recognised that the activation of FGFR3 caused by substitutions within the tyrosine kinase domain is due to a mechanism that mirrors the conformational changes that are normally a result of ligand-mediated FGFR3 dimerisation and autophosphorylation.23,24 Double mutation alleles have been reported in association with a range of disorders, often complicating genotype-phenotype correlations.25,26 It is probable that the basis of the severe phenotype seen in our case, in contrast to the phenotype that results from the Asn540Lys mutation alone or in combination with Gly380Arg, is related to the ‘double-hit’ effect of two mutations both acting in this critical region of the protein. It is the combination of the location of the mutations and the attenuating effect they have upon each other that is significant.
A recent review of the current understanding of FGFR3 signalling in the skeletal dysplasias concludes that, although progress is being made, there are still a large number of questions to be answered regarding almost every aspect of the action of FGFR3, particularly when it comes to cartilage.23 The rate of de novo double mutations occurring in the same gene in cis is predicted to be very low at approximately,12–13 therefore it is unlikely to be a common mechanism in the pathogenesis of TD.27
Conclusion
The case we describe is the second report in which the mutations differ from those classically implicated in the development of TD. Findings such as this may be usefully incorporated into the design of functional studies in the future, and suggest that the range of genotypes potentially responsible for the characteristic TD phenotype is likely to be broader than previously recognised.
References
- 1.Martınez-Frıas ML, de Frutos CA, Bermejo E, ECEMC Working Group. Nieto MA. Review of the recently defined molecular mechanisms underlying thanatophoric dysplasia and their potential therapeutic implications for achondroplasia. Am J Med Genet Part A. 2010;152A:245–55. doi: 10.1002/ajmg.a.33188. [DOI] [PubMed] [Google Scholar]
- 2.Schild RL, Hunt GH, Moore J, Davies H, Horwell DH. Antenatal sonographic diagnosis of thanatophoric dysplasia: A report of three cases and a review of the literature with special emphasis on the differential diagnosis. Ultrasound Obstet Gynecol. 1996;8:62–7. doi: 10.1046/j.1469-0705.1996.08010062.x. [DOI] [PubMed] [Google Scholar]
- 3.Karczeski B, Cutting GR. Thanatophoric Dysplasia. In: Pagon RA, Bird TD, Dolan CR, et al., editors. GeneReviews™. Seattle: University of Washington; 1993. [Google Scholar]
- 4.MacDonald IM, Hunter AG, MacLeod PM, MacMurray SB. Growth and development in thanatophoric dysplasia. Am J Med Genet. 1989;33:508–12. doi: 10.1002/ajmg.1320330420. [DOI] [PubMed] [Google Scholar]
- 5.Giancotti A, Castori M, Spagnuolo A, Binni F, D’Ambrosio V, Pasquali G, et al. Early ultrasound suspect of thanatophoric dysplasia followed by first trimester molecular diagnosis. Am J Med Genet Part A. 2011;155:1756–8. doi: 10.1002/ajmg.a.34052. [DOI] [PubMed] [Google Scholar]
- 6.Delahaye S, Rosenblatt J, Costa JM, Bazin A, Bénifla JL, Jouannic JM. First-trimester molecular prenatal diagnosis of a thanatophoric dysplasia. Prenat Diagn. 2010;30:1222–3. doi: 10.1002/pd.2638. [DOI] [PubMed] [Google Scholar]
- 7.Hatzaki A, Sifakis S, Apostolopoulou D, Bouzarelou D, Konstantinidou A, Kappou D, et al. FGFR3 related skeletal dysplasias diagnosed prenatally by ultrasonography and molecular analysis: Presentation of 17 cases. Am J Med Genet Part A. 2011;155:2426–35. doi: 10.1002/ajmg.a.34189. [DOI] [PubMed] [Google Scholar]
- 8.Hyland VJ, Robertson SP, Flanagan S, Savarirayan R, Roscioli T, Masel J, et al. Somatic and germline mosaicism for a R248C missense mutation in FGFR3, resulting in a skeletal dysplasia distinct from thanatophoric dysplasia. Am J Med Genet Part A. 2003;120:157–68. doi: 10.1002/ajmg.a.20012. [DOI] [PubMed] [Google Scholar]
- 9.Genome Browser. University of California Santa Cruz (UCSC) From: http://genome.ucsc.edu Accessed: Apr 2012
- 10.National Genetic Reference Laboratory, Manchester, UK, Software tool. From: http://ngrl.man.ac.uk/SNPCheck.html Accessed: Apr 2012
- 11.PRIMER1: primer design for tetra-primer ARMS-PCR. From: http://primer1.soton.ac.uk/primer1.html Accessed: Apr 2012
- 12.Ye S, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single nucleotide polymorphisms. Nucl Acids Res. 2001;29:E88. doi: 10.1093/nar/29.17.e88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bellus GA, Spector EB, Speiser PW, Weaver CA, Garber AT, Bryke CR, et al. Distinct missense mutations of the FGFR3 lys650 codon modulate receptor kinase activation and the severity of the skeletal dysplasia phenotype. Am J Hum Genet. 2000;67:14–21. doi: 10.1086/316892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Francomano CA. Hypochondroplasia. In: Pagon RA, Bird TD, Dolan CR, editors. GeneReviews™. Seattle, Washington: University of Washington; 1993. [Google Scholar]
- 15.Polyphen-2 prediction tool. From: http://genetics.bwh.harvard.edu/pph2/index.shtml Accessed: Apr 2012
- 16.SIFT prediction tool. From: http://sift.jcvi.org/www/SIFT_enst_submit.html Accessed: Apr 2012
- 17.Pauli RM. Achondroplasia. In: Pagon RA, Bird TD, Dolan CR, et al., editors. GeneReviews™. Seattle: University of Washington; 1993. [Google Scholar]
- 18.McKusick VA, Kelly TE, Dorst JP. Observations suggesting allelism of the achondroplasia and hypochondroplasia genes. J Med Genet. 1973;10:11–16. doi: 10.1136/jmg.10.1.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Sommer A, Young-Wee T, Frye T. Achondroplasia-hypochondroplasia complex. Am J Med Genet. 1987;26:949–57. doi: 10.1002/ajmg.1320260426. [DOI] [PubMed] [Google Scholar]
- 20.Huggins MJ, Smith JR, Chun K, Ray PN, Shah JK, Whelan DT. Achondroplasia-hypochondroplasia complex in a newborn infant. Am J Med Genet. 1999;84:396–400. [PubMed] [Google Scholar]
- 21.Chitayat D, Fernandez B, Gardner A, Moore L, Glance P, Dunn M, et al. Compound heterozygosity for the achondroplasia-hypochondroplasia FGFR3 mutations: Prenatal diagnosis and postnatal outcome. Am J Med Genet. 1999;84:401–5. [PubMed] [Google Scholar]
- 22.Pannier S, Martinovic J, Heuertz S, Delezoide AL, Munnich A, Schibler L, et al. Thanatophoric dysplasia caused by double missense FGFR3 mutations. Am J Med Genet Part A. 2009;149A:1296–1301. doi: 10.1002/ajmg.a.32880. [DOI] [PubMed] [Google Scholar]
- 23.Foldynova-Trantirkova S, Wilcox WR, Krejci P. Sixteen years and counting: The current understanding of fibroblast growth factor receptor 3 (FGFR3) signaling in skeletal dysplasias. Hum Mutat. 2012;33:29–41. doi: 10.1002/humu.21636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Webster MK, D’Avis PY, Robertson SC, Donoghue DJ. Profound ligand-independent kinase activation of fibroblast growth factor receptor 3 by the activation loop mutation responsible for a lethal skeletal dysplasia, thanatophoric dysplasia type I. Mol Cell Biol. 1996;16:4081–7. doi: 10.1128/mcb.16.8.4081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Savov A, Angelicheva D, Balassopoulou A, Jordanova A, Noussia-Arvanitakis S, Kalaydjieva L. Double mutant alleles: Are they rare? Hum Mol Genet. 1995;4:1169–71. doi: 10.1093/hmg/4.7.1169. [DOI] [PubMed] [Google Scholar]
- 26.Blair E, Price SJ, Baty CJ, Östman-Smith I, Watkins H. Mutations in cis can confound genotype-phenotype correlations in hypertrophic cardiomyopathy. J Med Genet. 2001;38:385–423. doi: 10.1136/jmg.38.6.385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kondrashov AS. Direct estimates of human per nucleotide mutation rates at 20 loci causing mendelian diseases. Hum Mutat. 2002;21:12–27. doi: 10.1002/humu.10147. [DOI] [PubMed] [Google Scholar]




