Abstract
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
Full text
PDF




Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Baumhäckel H., Liesegang B., Radbruch A., Rajewsky K., Sablitzky F. Switch from NP-specific IgG3 to IgG1 in the mouse hybridoma cell line S24/63/63. J Immunol. 1982 Mar;128(3):1217–1220. [PubMed] [Google Scholar]
- Burrows P. D., Beck-Engeser G. B., Wabl M. R. Immunoglobulin heavy-chain class switching in a pre-B cell line is accompanied by DNA rearrangement. Nature. 1983 Nov 17;306(5940):243–246. doi: 10.1038/306243a0. [DOI] [PubMed] [Google Scholar]
- Cebra J. J., Komisar J. L., Schweitzer P. A. CH isotype 'switching' during normal B-lymphocyte development. Annu Rev Immunol. 1984;2:493–548. doi: 10.1146/annurev.iy.02.040184.002425. [DOI] [PubMed] [Google Scholar]
- Davis M. M., Kim S. K., Hood L. E. DNA sequences mediating class switching in alpha-immunoglobulins. Science. 1980 Sep 19;209(4463):1360–1365. doi: 10.1126/science.6774415. [DOI] [PubMed] [Google Scholar]
- Dignam J. D., Lebovitz R. M., Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983 Mar 11;11(5):1475–1489. doi: 10.1093/nar/11.5.1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Echols H. Multiple DNA-protein interactions governing high-precision DNA transactions. Science. 1986 Sep 5;233(4768):1050–1056. doi: 10.1126/science.2943018. [DOI] [PubMed] [Google Scholar]
- Gearhart P. J., Sigal N. H., Klinman N. R. Production of antibodies of identical idiotype but diverse immunoglobulin classes by cells derived from a single stimulated B cell. Proc Natl Acad Sci U S A. 1975 May;72(5):1707–1711. doi: 10.1073/pnas.72.5.1707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gellert M., Nash H. Communication between segments of DNA during site-specific recombination. 1987 Jan 29-Feb 4Nature. 325(6103):401–404. doi: 10.1038/325401a0. [DOI] [PubMed] [Google Scholar]
- Gritzmacher C. A. Molecular aspects of heavy-chain class switching. Crit Rev Immunol. 1989;9(3):173–200. [PubMed] [Google Scholar]
- Jäck H. M., McDowell M., Steinberg C. M., Wabl M. Looping out and deletion mechanism for the immunoglobulin heavy-chain class switch. Proc Natl Acad Sci U S A. 1988 Mar;85(5):1581–1585. doi: 10.1073/pnas.85.5.1581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kataoka T., Miyata T., Honjo T. Repetitive sequences in class-switch recombination regions of immunoglobulin heavy chain genes. Cell. 1981 Feb;23(2):357–368. doi: 10.1016/0092-8674(81)90131-8. [DOI] [PubMed] [Google Scholar]
- Katzenberg D. R., Birshtein B. K. Sites of switch recombination in IgG2b- and IgG2a-producing hybridomas. J Immunol. 1988 May 1;140(9):3219–3227. [PubMed] [Google Scholar]
- Kenter A. L., Birshtein B. K. Chi, a promoter of generalized recombination in lambda phage, is present in immunoglobulin genes. Nature. 1981 Oct 1;293(5831):402–404. doi: 10.1038/293402a0. [DOI] [PubMed] [Google Scholar]
- Kenter A. L., Watson J. V., Azim T., Rabbitts T. H. Colcemid inhibits growth during early G1 in normal but not in tumorigenic lymphocytes. Exp Cell Res. 1986 Nov;167(1):241–251. doi: 10.1016/0014-4827(86)90220-x. [DOI] [PubMed] [Google Scholar]
- Kenter A. L., Watson J. V. Cell cycle kinetics model of LPS-stimulated spleen cells correlates switch region rearrangements with S phase. J Immunol Methods. 1987 Feb 26;97(1):111–117. doi: 10.1016/0022-1759(87)90112-8. [DOI] [PubMed] [Google Scholar]
- Kobayashi I., Stahl M. M., Stahl F. W. The mechanism of the chi-cos interaction in RecA-RecBC-mediated recombination in phage lambda. Cold Spring Harb Symp Quant Biol. 1984;49:497–506. doi: 10.1101/sqb.1984.049.01.056. [DOI] [PubMed] [Google Scholar]
- Marcu K. B. Immunoglobulin heavy-chain constant-region genes. Cell. 1982 Jul;29(3):719–721. doi: 10.1016/0092-8674(82)90431-7. [DOI] [PubMed] [Google Scholar]
- Nikaido T., Nakai S., Honjo T. Switch region of immunoglobulin Cmu gene is composed of simple tandem repetitive sequences. Nature. 1981 Aug 27;292(5826):845–848. doi: 10.1038/292845a0. [DOI] [PubMed] [Google Scholar]
- Nikaido T., Yamawaki-Kataoka Y., Honjo T. Nucleotide sequences of switch regions of immunoglobulin C epsilon and C gamma genes and their comparison. J Biol Chem. 1982 Jul 10;257(13):7322–7329. [PubMed] [Google Scholar]
- Petrini J., Dunnick W. A. Products and implied mechanism of H chain switch recombination. J Immunol. 1989 Apr 15;142(8):2932–2935. [PubMed] [Google Scholar]
- Petrini J., Shell B., Hummel M., Dunnick W. The immunoglobulin heavy chain switch: structural features of gamma 1 recombinant switch regions. J Immunol. 1987 Mar 15;138(6):1940–1946. [PubMed] [Google Scholar]
- Richards J. E., Gilliam A. C., Shen A., Tucker P. W., Blattner F. R. Unusual sequences in the murine immunoglobulin mu-delta heavy-chain region. Nature. 1983 Dec 1;306(5942):483–487. doi: 10.1038/306483a0. [DOI] [PubMed] [Google Scholar]
- Sadowski P. Site-specific recombinases: changing partners and doing the twist. J Bacteriol. 1986 Feb;165(2):341–347. doi: 10.1128/jb.165.2.341-347.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shimizu A., Honjo T. Immunoglobulin class switching. Cell. 1984 Apr;36(4):801–803. doi: 10.1016/0092-8674(84)90029-1. [DOI] [PubMed] [Google Scholar]
- Shimizu A., Takahashi N., Yaoita Y., Honjo T. Organization of the constant-region gene family of the mouse immunoglobulin heavy chain. Cell. 1982 Mar;28(3):499–506. doi: 10.1016/0092-8674(82)90204-5. [DOI] [PubMed] [Google Scholar]
- Singh H., Sen R., Baltimore D., Sharp P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 1986 Jan 9;319(6049):154–158. doi: 10.1038/319154a0. [DOI] [PubMed] [Google Scholar]
- Szurek P., Petrini J., Dunnick W. Complete nucleotide sequence of the murine gamma 3 switch region and analysis of switch recombination sites in two gamma 3-expressing hybridomas. J Immunol. 1985 Jul;135(1):620–626. [PubMed] [Google Scholar]
- Wasserman S. A., Cozzarelli N. R. Biochemical topology: applications to DNA recombination and replication. Science. 1986 May 23;232(4753):951–960. doi: 10.1126/science.3010458. [DOI] [PubMed] [Google Scholar]




