Abstract
We report that multiple symbionts coexist in Dermacentor silvarum. Based on 16S rRNA gene sequence analyses, we prove that Coxiella-like and Arsenophonus-like symbionts, with 95.6% and 96.7% sequence similarity to symbionts in the closest taxon, respectively, are novel. Moreover, we also provide evidence that the Coxiella-like symbiont appears to be the primary symbiont.
TEXT
Symbionts are ubiquitous in a diverse group of insect hosts. They confer crucial and diverse benefits to their hosts, affecting development (1), nutrition (2), reproduction and speciation (3), defense against natural enemies and environment stress (4, 5), and immunity (6). Symbionts usually are classified as obligate (or primary) symbionts and facultative (or secondary) symbionts according to the extent of the mutual dependence between the host and the symbiont (7). Primary symbionts, restricted to specialized tissues or cells, usually are obligate and essential for the survival of the host and their own vertical transmission. Secondary symbionts, not restricted to specific tissues, usually are facultative and unessential for the host and transmitted either vertically or horizontally between the same or different species (8, 9, 10). Many insect species are usually simultaneously infected by multiple symbionts, including one primary symbiont and various secondary symbionts (11), or two obligate mutual symbionts (12). In general, various symbionts coexist in the same host, interact with each other, and coregulate the biological processes of the host.
Like most insects, ticks exhibit close relationships with symbionts. To date, a wide range of symbionts, such as Coxiella-like (13), Francisella-like (14), Wolbachia-like (15), Rickettsia-like (16), Arsenophonus-like (17), “Candidatus Midichloria mitochondrii” (18), and Rickettsia peacockii (19) symbionts, have been detected in several tick species. However, little attention has been given to coinfection with multiple symbionts of ticks. Hence, we focused the present study on coinfection of the multiple symbionts in tick hosts. The new knowledge gained from this study could be meaningful for a deep understanding of the biology and ecology of ticks.
We first report that three symbionts, namely, Coxiella-like, Arsenophonus-like, and Rickettsia-like symbionts, coexist in Dermacentor silvarum. Interestingly, Coxiella-like and Arsenophonus-like symbionts are different from those in the taxon described previously, with 95.6% and 96.7% similarity to the closest taxon, respectively. Moreover, the Coxiella-like symbiont appears to be the primary symbiont of D. silvarum.
D. silvarum samples were collected in Xiaowutai National Natural Reserve Area in China by flag dragging. Several collected ticks were stored under −80°C conditions. Others were reared on rabbits as described by Liu et al. (20). Before DNA extraction, all tick samples were sterilized as described by Clay et al. (21) and dissected tissue samples were washed three times in sterile phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4·7H2O, 1.4 mM KH2PO4, pH 7.4). All DNA samples, including the genomic DNA from a group of adults (10 females and 10 males, respectively), from every individual field-collected adult, and from a group of ticks at different developmental stages (500 eggs, 200 larvae, and 50 nymphs) and from different tissues (ovaries, salivary glands, Malpighian tubes, and midguts), were extracted using a DNeasy tissue kit (Qiagen, Germany) according to the protocol of the manufacturer. The eubacterial 16S rRNA gene library was constructed by amplifying an approximately 1,500-bp fragment of the 16S rRNA gene using eubacterial universal primers 27F and 1492R (22). The eubacterial 16S rRNA gene libraries were analyzed by restriction fragment length polymorphism (RFLP) using both HaeIII and RsaI restriction endonucleases.
To assess the prevalences, vertical transmission characteristics, and infection sites of three putative symbionts, diagnostic PCR assays were performed with three sets of primers specific for each of them (Table 1). The PCR mixtures contained 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 200 μM (each) deoxynucleoside triphosphates (dNTP), 2.5 U Platinum Taq DNA polymerase (Invitrogen), and 0.5 mM (each) primer. The PCR cycling conditions were as follows: 1 cycle of 94°C for 2 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 15 s; and, finally, 72°C for 10 min. Products were cloned into the plasmid pCR2.1-TOPO (Invitrogen) and sequenced by the Sangon Biotech Company (China).
Table 1.
Oligonucleotide primers used for PCR amplification and sequencing
| Primer name | Species | Target gene | Nucleotide sequence (5′–3′) | Annealing temp (°C) | Approx product size (bp) | Source or reference |
|---|---|---|---|---|---|---|
| CLS-Ds110F | CLS-Ds | 16S rRNA | CACGTAGGAATCTACCTTGTAG | 55 | 90 | This study |
| CLS-Ds170R | CGTTTTGTTCCGAAGAAATTAT | |||||
| ALS-Ds82F | ALS-Ds | 16S rRNA | AGGGAGCTTGCTTCCTGGCCGG | 59 | 130 | This study |
| ALS-Ds198R | CGAAGGTGTGAGGCCTAATGG | |||||
| Rickettsia354F | Rickettsia | 16S rRNA | CAGCAATACCGAGTGAGTGATGAAG | 56 | 350 | 23 |
| Rickettsia647R | AGCGTCAGTTGTAGCCCAGATG | |||||
| RpCS.877p | Rickettsia | gltA | GGGGACCTGCTCACGGCGG | 46 | 380 | 24 |
| RpCS.1258n | CATAACCAGTGTAAAGCTG | |||||
| Rr190.70p | Rickettsia | rompA | GGTGGTCAGGCTCTGAAGCTAAC | 48 | 530 | 25 |
| Rr190.602n | TGCAGTTTGATAACCGACAGTCTC |
The results of RFLP analyses revealed diverse microbial associations (Fig. 1). We found that the sequences of Dc-9 and Dc-54 from the female gene library and of Dx-6 and Dx-11 from the male gene library were closely related to those of Arsenophonus-like symbionts (ALSs) of D. variabilis (GenBank accession no. AY265342) (26), with 98% to 98.15% similarity, and those symbionts were designated ALS-Ds; the sequences of Dc-8 and Dc-71 from the female gene library and of Dx-56 and Dx-68 from the male gene library shared 94.1% to 94.3% similarity with those of the Coxiella-like symbiont of Haemaphysalis longicornis (GenBank accession no. AB001519) (27), and those symbionts were designated CLS-Ds; and the sequences of Dc-3 and Dc-24 from the female gene library and Dx-7 and Dx-21 from the male gene library of symbionts designated RLS-Ds shared the highest sequence similarity with sequences of the Rickettsia symbiont (99.8%), which had been detected in many Dermacentor species (23, 28). Further studies showed that the sequences obtained had the highest (99.1% and 99.8%, respectively) similarity with those of the gltA gene (GenBank accession no. DQ365804) and rompA gene (GenBank accession no. DQ365801) of R. raoultii.
Fig 1.
Phylogenetic tree of three symbionts (CLS-Ds, ALS-Ds, and RLS-Ds) of D. silvarum and related tick-associated symbionts based on 16S rRNA gene sequence similarity. The tree was rooted with Bacillus subtilis (X60646) and constructed using the neighbor-joining method, and clustering nodes were also recovered using the maximum-likelihood method. Numbers at nodes represent the levels of bootstrap support (percent) based on neighbor-joining analysis of 1,000 replicated data sets. GenBank accession numbers are given in parentheses. The bar represents 5% sequence divergence. α-proteobacteria, alphaproteobacteria; γ-proteobacteria, gammaproteobacteria.
All three putative symbionts were detected from ticks at different developmental stages, indicating that they can be transmitted vertically (Fig. 2). The infection site analyses showed that CLS-Ds infected ovaries and Malpighian tubes, while the others were found in all tissues tested (Fig. 3). The prevalence analyses revealed that CLS-Ds showed 100% infection in adults; for ALS-Ds, 42% (36/86) infection in females and 22% (10/46) infection in males; and for RLS-Ds, 86% (74/86) infection in females and 91% (42/46) infection in males. All field-collected D. silvarum samples harbored one symbiont, and at least 40% of the females and 22% of the males were infected by all three symbionts.
Fig 2.

Detection of vertical transmission of CLS-Ds (a), ALS-Ds (b), and RLS-Ds (c) by diagnostic PCR amplification from D. silvarum at different developmental stages. Lanes 1 to 7: M, DNA ladder; E, eggs; L, larvae; N, nymphs; AF, adult females; AM, adult males; N, negative control.
Fig 3.

Detection of infection sites of CLS-Ds (a), ALS-Ds (b), and RLS-Ds (c) by diagnostic PCR amplification from different tissues of D. silvarum. Lanes 1 to 6: M, DNA ladder; O, ovaries; G, salivary glands; Mg, midguts; Mt, Malpighian tubules; N, negative control.
The results demonstrated that D. silvarum harbored diverse assemblages of putative symbionts, including Coxiella-like symbionts (CLS-Ds), Arsenophonus-like symbionts (ALS-Ds), and Rickettsia-like symbionts (RLS-Ds). This is the first report proving that various vertically transmitted symbionts coinhabit D. silvarum. To date, only a few reports have concerned the coinfection of multiple symbionts in ticks. For example, Noda et al. (27) and Reinhardt et al. (29) reported that Ornithodoros moubata hosted two kinds of symbionts, namely, Rickettsia-like and Francisella-like symbionts. Besides, it has been previously reported that Amblyomma americanum simultaneously harbored Coxiella-like symbionts, which are primary and are closely related to host reproduction (30, 31), and Rickettsia-like and Arsenophonus-like symbionts (21). In this study, we found an important coinfection phenomenon in D. silvarum, which provides a new model and clue for elucidating the issues about the interaction and interrelationship between symbionts and their hosts.
Interestingly, two of three putative categories of symbionts, CLS-Ds and ALS-Ds, in D. silvarum are novel. They have highest (95.6% and 96.7%) similarity with the phylogenetically most closely related species of the genera Coxiella and Arsenophonus, respectively. Phylogenetic analyses (Fig. 4 and 5) also revealed that CLS-Ds and ALS-Ds formed clear and unique clusters in their respective phylogenetic trees, and they were distinguished from those of the other species and tick-associated microorganisms in this genus.
Fig 4.
Phylogenetic tree of Coxiella-like symbionts (CLS-Ds) of D. silvarum and Coxiella-like microorganisms from other tick species based on 16S rRNA gene sequence similarity. The tree was rooted with Bacillus subtilis (X60646) and constructed using the neighbor-joining method, and clustering nodes were also recovered using the maximum-likelihood method. Numbers at nodes represent the levels of bootstrap support (percent) based on neighbor-joining analysis of 1,000 replicated data sets. GenBank accession numbers are given in parentheses. The bar represents 2% sequence divergence.
Fig 5.
Phylogenetic tree of Arsenophonus-like symbionts (ALS-Ds) of D. silvarum and Arsenophonus-like symbionts of D. variabilis based on 16S rRNA gene sequence similarity. The tree was rooted with Bacillus subtilis (X60646) and constructed using the neighbor-joining method, and clustering nodes were also recovered using the maximum-likelihood method. Numbers at nodes represent the levels of bootstrap support (percent) based on neighbor-joining analysis of 1,000 replicated data sets. GenBank accession numbers are given in parentheses. The bar represents 2% sequence divergence.
To date, various Coxiella-like microorganisms have been detected in both hard and soft ticks (21, 32, 33, 34, 35, 36, 37, 38). Interestingly, Coxiella-like microorganisms exhibited diverse 16S rRNA genotypes from different tick species. Phylogenetic analyses (Fig. 4) revealed that Coxiella-like microorganisms from different tick species formed different independent branches. Moreover, the Coxiella-like microorganisms in soft and hard ticks obviously were grouped separately. Previous studies have suggested that the Coxiella-like symbiont in A. americanum is a primary symbiont because of its ubiquitous distribution (21, 30), vertical transmission (13, 21), infection of specific tissues (13), loss of fitness with antibiotic treatment (31), and reduced genome (30). In this study, we found that CLS-Ds exhibited vertical infection and infected specific tissues. Thus, we hypothesize that CLS-Ds might be a primary symbiont and essential for the survival of its tick host. It may be involved in regulation of host reproduction, because it inhabits the ovary.
Besides CLS-Ds, another novel symbiont, ALS-Ds, which belongs to the genus Arsenophonus, was also detected. ALSs have been found in D. variabilis (26), D. andersoni (17) and A. americanum (21). Arsenophonus is one of the four major inherited symbionts of arthropods; about 5% of the species of arthropods have been found to be infected by Arsenophonus (39). The type species, A. nasoniae, can give rise to sex ratio bias of the wasp Nasonia vitripennis (40). However, there is no evidence that the Arsenophonus-like symbionts in ticks can lead to sex ratio bias. In this study, we found that ALS-Ds exhibited wide tissue distribution and imperfect infection. Thus, it appears to be a facultative and unessential symbiont for D. silvarum.
The third vertical transmitted microorganism screened here was R. raoultii, which has been detected in many Dermacentor species (41, 42, 43, 44). The present study reported for the first time the vertical transmission of R. raoultii in D. silvarum, suggesting a closer relationship between R. raoultii and its tick host.
Nucleotide sequence accession numbers.
The 16S rRNA gene GenBank accession numbers for CLS-Ds are JN866594, JX432011, JX432012, and JX432013; for ALS-Ds are JN866582, JN866587, JX432014, and JX432015; and for RLS-Ds are JN866588, JX432016, JX432017, and JX432018.
ACKNOWLEDGMENT
This work was supported by National Natural Science Funds grant 31272372 from the National Natural Science Foundation of China.
Footnotes
Published ahead of print 25 January 2013
REFERENCES
- 1.Koropatnick TA, Engle JT, Apicella MA, Stabb EV, Goldman WE, McFall-Ngai MJ. 2004. Microbial factor-mediated development in a host-bacterial mutualism. Science 306:1186–1188 [DOI] [PubMed] [Google Scholar]
- 2.Shigenobu S, Watanabe H, Hattori M, Sakaki Y, Ishikawa H. 2000. Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS. Nature 407:81–86 [DOI] [PubMed] [Google Scholar]
- 3.Stouthamer R, Breeuwer JA, Hurst GD. 1999. Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annu. Rev. Microbiol. 53:71–102 [DOI] [PubMed] [Google Scholar]
- 4.Oliver KM, Moran NA, Hunter MS. 2006. Costs and benefits of a superinfection of facultative symbionts in aphids. Proc. Biol. Sci. 273:1273–1280 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Russell JA, Moran NA. 2006. Costs and benefits of symbiont infection in aphids: variation among symbionts and across temperatures. Proc. Biol. Sci. 273:603–610 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Haine ER. 2008. Symbiont-mediated protection. Proc. Biol. Sci. 275:353–361 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chaves S, Neto M, Tenreiro T. 2009. Insect-symbiont systems: from complex relationships to biotechnological applications. Biotechnol. J. 4:1753–1765 [DOI] [PubMed] [Google Scholar]
- 8.Dale C, Moran NA. 2006. Molecular interactions between bacterial symbionts and their host. Cell 126:453–465 [DOI] [PubMed] [Google Scholar]
- 9.Moran NA, McCutcheon JP, Nakabachi A. 2008. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42:165–190 [DOI] [PubMed] [Google Scholar]
- 10.Gosalbes MJ, Latorre A, Lamelas A, Moya A. 2010. Genomics of intracellular symbionts in insects. Int. J. Med. Microbiol. 300:271–278 [DOI] [PubMed] [Google Scholar]
- 11.Distel DL, Beaudoin DJ, Morrill W. 2002. Coexistence of multiple proteobacterial endosymboionts in the gills of the wood-boring bivalve Lyrodus pedicellatus (Bivalvia: Teredinidae). Appl. Environ. Microbiol. 68:6292–6299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.McCutcheon JP, Moran NA. 2007. Parallel genomic evolution and metabolic interdependence in an ancient symbiosis. Proc. Natl. Acad. Sci. U. S. A. 104:19392–19397 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Klyachko O, Stein BD, Grindle N, Clay K, Fuqua C. 2007. Localization and visualization of a Coxiella-type symbiont within the lone star tick, Amblyomma americanum. Appl. Environ. Microbiol. 73:6584–6594 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ivanov IN, Mitkova N, Reye AL, Hübschen JM, Vatcheva-Dobrevska RS, Dobreva EG, Kantardjiev TV, Muller CP. 2011. Detection of new Francisella-like tick endosymbionts in Hyalomma spp. and Rhipicephalus spp. (Acari: Ixodidae) from Bulgaria. Appl. Environ. Microbiol. 77:5562–5565 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang X, Norris DE, Rasgon JL. 2011. Distribution and molecular characterization of Wolbachia endosymbionts and filarial nematodes in Maryland populations of the lone star tick (Amblyomma americanum). FEMS Microbiol. Ecol. 77:50–56 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Gillespie JJ, Joardar V, Williams KP, Driscoll T, Hostetler JB, Nordberg E, Shukla M, Walenz B, Hill CA, Nene VM, Azad AF, Sobral BW, Caler E. 2012. A Rickettsia genome overrun by mobile genetic elements provides insight into the acquisition of genes characteristic of an obligate intracellular lifestyle. J. Bacteriol. 194:376–394 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Dergousoff SJ, Chilton NB. 2010. Detection of a new Arsenophonus-type bacterium in Canadian populations of the Rocky Mountain wood tick, Dermacentor andersoni. Exp. Appl. Acarol. 52:85–91 [DOI] [PubMed] [Google Scholar]
- 18.Sassera D, Beninati T, Bandi C, Bouman EAP, Sacchi L, Fabbi M, Lo N. 2006. ‘Candidatus Midichloria mitochondrii’, an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle. Int. J. Syst. Evol. Microbiol. 56:2535–2540 [DOI] [PubMed] [Google Scholar]
- 19.Niebylski ML, Schrumpf ME, Burgdorfer W, Fischer ER, Gage KL, Schwan TG. 1997. Rickettsia peacockii sp. nov., a new species infecting wood ticks, Demacentor andersoni, in Western Montana. Int. J. Syst. Bacteriol. 47:446–452 [DOI] [PubMed] [Google Scholar]
- 20.Liu J, Liu Z, Zhang Y, Yang X, Gao Z. 2005. Biology of Dermacentor silvarum (Acari: Ixodidae) under laboratory conditions. Exp. Appl. Acarol. 36:131–138 [DOI] [PubMed] [Google Scholar]
- 21.Clay K, Klyachko O, Grindle N, Civitello D, Oleske D, Fuqua C. 2008. Microbial communities and interactions in the lone star tick, Amblyomma americanum. Mol. Ecol. 17:4371–4381 [DOI] [PubMed] [Google Scholar]
- 22.Wilson KH, Blitchington RB, Greene RC. 1990. Amplification of bacterial of bacterial 16S ribosomal DNA with polymerase chain reaction. J. Clin. Microbiol. 28:1942–1946 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Baldridge GD, Brukhardt NY, Simser JA, Kurtti TJ, Munderloh UG. 2004. Sequence and expression analysis of the ompA gene of Rickettsia peacockii, an endosymbiont of the Rocky Mountain wood tick, Dermacentor andersoni. Appl. Environ. Microbiol. 70:6628–6636 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Roux V, Rydkina E, Eremeeva M, Raoult D. 1997. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the Rickettsiae. Int. J. Syst. Bacteriol. 47:252–261 [DOI] [PubMed] [Google Scholar]
- 25.Regnery RL, Apruill CL, Plikaytis BD. 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173:1576–1589 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Grindle N, Tyner JJ, Clay K, Fuqua C. 2003. Identification of Arsenophonus-type bacteria from the dog tick Dermacentor variabilis. J. Invertebr. Pathol. 83:264–266 [DOI] [PubMed] [Google Scholar]
- 27.Noda H, Munderloh UG, Kurtti TJ. 1997. Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals. Appl. Environ. Microbiol. 63:3926–3932 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Macaluso KR, Aonenshine DE, Ceraul SM, Azad AF. 2002. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia. J. Med. Entomol. 39:809–813 [DOI] [PubMed] [Google Scholar]
- 29.Reinhardt C, Aeschlimann A, Hecker H. 1972. Distribution of rickettsia-like microorganisms in various organs of an Ornithodoros moubata laboratory strain (Ixodoidae, Argasidae) as revealed by electron microscopy. Z. Parasitenkd. 39:201–209 [DOI] [PubMed] [Google Scholar]
- 30.Jasinskas A, Zhong J, Barbour AG. 2007. Highly prevalent Coxiella sp. bacterium in the tick vector Amblyomma americanum. Appl. Environ. Microbiol. 73:334–336 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zhong J, Jasinskas A, Barbour AG. 2007. Antibiotic treatment of the tick vector Amblyomma americanum reduced reproductive fitness. PLoS One 2:e405 doi:10.1371/journal.pone.0000405 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ahantarig A, Malaisri P, Hirunkanokpun S, Sumrandee C, Trinachartuanit W, Baimai V. 2011. Detection of Rickettsia and a novel Haemaphysalis shimoga symbiont bacterium in ticks in Thailand. Curr. Microbiol. 62:1496–1502 [DOI] [PubMed] [Google Scholar]
- 33.Almeida AP, Marcili A, Leite RC, Nieri-Bastos FA, Dominques LN, Martins JR, Labruna MB. 2012. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae). Ticks Tick Borne Dis. 3:203–206 [DOI] [PubMed] [Google Scholar]
- 34.Bernasconi MV, Casati S, Peter O, Piffaretii J. 2002. Rhipicephalus ticks infected with Rickettsia and Coxiella in southern Switzerland (Canton Ticino). Infect. Genet. Evol. 2:111–120 [DOI] [PubMed] [Google Scholar]
- 35.Machado-Ferreira E, Dietrich G, Hojgaard A, Levin M, Piesman J, Zeidner NS, Soares CA. 2011. Coxiella symbionts in the Cayenne tick Amblyomma cajennense. Microb. Ecol. 62:134–142 [DOI] [PubMed] [Google Scholar]
- 36.Mediannikov O, Ivanov L, Nishikawa M, Saito R, Sidelnikov YN, Zdanovskaya NI, Tarasevich IV, Suzuki H. 2003. Molecular evidence of Coxiella-like microorganism harbored by Haemaphysalis concinnae ticks in the Russian Far East. Ann. N. Y. Acad. Sci. 990:226–228 [DOI] [PubMed] [Google Scholar]
- 37.Reeves WK. 2008. Molecular evidence for a novel Coxiella from Argas monolakensis (Acari: Argasidae) from Mono Lake, California, USA. Exp. Appl. Acarol. 44:57–60 [DOI] [PubMed] [Google Scholar]
- 38.Reeves WK, Loftis AD, Priestley RA, Wills W, Sanders F, Dasch GA. 2005. Molecular and biological characterization of a novel Coxiella-like agent from Carios capensis. Ann. N. Y. Acad. Sci. 1063:343–345 [DOI] [PubMed] [Google Scholar]
- 39.Duron O, Bouchon D, Boutin S, Bellamy L, Zhou L, Engelstadter J, Hurst GD. 2008. The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol. 6:27–38 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Skinner SW. 1985. Son-killer: a third extrachromosomal factor affecting sex ratios in the parasitoid wasp Nasonia vitripennis. Genetics 109:745–754 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Mediannikov O, Matsumoto K, Samoylenko I, Drancourt M, Roux V, Rydkina E, Davoust B, Tarasevich I, Brouqui P, Fournier P. 2008. Rickettsia raoultii sp. nov, a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int. J. Syst. Evol. Microbiol. 58:1635–1639 [DOI] [PubMed] [Google Scholar]
- 42.Selmi M, Martello E, Bertolotti L, Bisanzio D, Tomassone L. 2009. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus ticks collected on wild boars in Tuscany, Italy. J. Med. Entomol. 46:1490–1493 [DOI] [PubMed] [Google Scholar]
- 43.Spitalská E, Stefanidesova K, Kocianova E, Boldis V. 2012. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus and Dermacentor reticulatus ticks from Slovak Republic. Exp. Appl. Acarol. 57:189–197 [DOI] [PubMed] [Google Scholar]
- 44.Tian Z, Liu G, Shen H, Xie J, Luo J, Tian M. 2012. First report on the occurrence of Rickettsia slovaca and Rickettsia raoultii in Dermacentor silvarum in China. Parasit. Vectors 5:19–22 [DOI] [PMC free article] [PubMed] [Google Scholar]



