Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2013 Mar 30;13:73. doi: 10.1186/1471-2180-13-73

The expression and regulation of matrix metalloproteinase-3 is critically modulated by Porphyromonas gingivalis lipopolysaccharide with heterogeneous lipid A structures in human gingival fibroblasts

Thanuja D K Herath 1, Yu Wang 2, Chaminda J Seneviratne 1, Richard P Darveau 3, Cun-Yu Wang 4, Lijian Jin 1,✉
PMCID: PMC3623786  PMID: 23548063

Abstract

Background

Porphyromonas gingivalis lipopolysaccharide (LPS) is a crucial virulence factor strongly associated with chronic periodontitis which is the primary cause of tooth loss in adults. It exhibits remarkable heterogeneity containing tetra-(LPS1435/1449) and penta-(LPS1690) acylated lipid A structures. Human gingival fibroblasts (HGFs) as the main resident cells of human gingiva play a key role in regulating matrix metalloproteinases (MMPs) and contribute to periodontal homeostasis. This study investigated the expression and regulation of MMPs1-3 and tissue inhibitors of MMP-1 (TIMP-1) in HGFs in response to P. gingivalis LPS1435/1449 and LPS1690 and hexa-acylated E. coli LPS as a reference. The expression of MMPs 1–3 and TIMP-1 was evaluated by real-time PCR and ELISA.

Results

The MMP-3 mRNA and protein were highly upregulated in P. gingivalis LPS1690- and E. coli LPS-treated cells, whereas no induction was observed in P. gingivalis LPS1435/1449-treated cells. On the contrary, the expression of MMP-1 and −2 was not significantly affected by P. gingivalis LPS lipid A heterogeneity. The TIMP-1 mRNA was upregulated in P. gingivalis LPS1435/1449- and E. coli LPS-treated cells. Next, signal transduction pathways involved in P. gingivalis LPS-induced expression of MMP-3 were examined by blocking assays. Blockage of p38 MAPK and ERK significantly inhibited P. gingivalis LPS1690-induced MMP-3 expression in HGFs.

Conclusion

The present findings suggest that the heterogeneous lipid A structures of P. gingivalis LPS differentially modulate the expression of MMP-3 in HGFs, which may play a role in periodontal pathogenesis.

Keywords: Periodontal disease, P. gingivalis LPS, Lipid A heterogeneity, MMPs, Human gingival fibroblasts

Background

Periodontal disease is a bacterially induced and highly common chronic inflammatory condition in humans, and severe periodontal disease (periodontitis) remains the major cause of tooth loss in adult population worldwide [1]. Dysregulated host response to pathogenic plaque biofilm critically contributes to destructive inflammation resulting in tissue damage and alveolar bone loss [2]. Porphyromonas gingivalis is a keystone periodontal pathogen in the mixed microbial community and it releases copious amount of lipopolysaccharide (LPS) which perpetually interacts with host cells, thereby significantly contributing to periodontal pathogenesis [1-4].

LPS is a potent immuno-inflammatory modulator which causes serious complications in host. It is comprised of three major components viz. outermost O-antigen, core oligosaccharide regions and innermost lipid A [3]. Lipid A is the biologically most active component of LPS that imparts the endotoxin activity. Its structure differs widely among Gram-negative bacteria species depending on the differences in composition of attached fatty acids, number of phosphorylation sites and substituted groups attached to the phosphate residues [3]. The canonical lipid A structure in Escherichia coli LPS is a hexa-acylated diphosphorylated glucosamine disaccharide. Previous studies have shown that P. gingivalis possesses highly heterogeneous lipid A structures containing penta-acylated LPS1690 and tetra-acylated LPS1435/1449, and this structural discrepancy may critically account for contrasting biological activities induced by P. gingivalis LPS [3,4].

Human gingival fibroblasts (HGFs) are the major cell type in human gingiva [5-7]. They play a key role in maintenance and remodeling of extra cellular matrix (ECM) by producing various structural components, such as collagen, elastin, glycoprotein and glycosaminoglycans. In addition, HGFs also synthesize and secrete various members of matrix metalloproteinases (MMPs) in response to P. gingivalis LPS challenge, which ultimately contribute to periodontal tissue destruction [8]. MMPs are a family of structurally and functionally related proteolytic enzymes containing a zinc-binding catalytic domain and they are active against the components of ECM [8-10]. The activity of MMPs is largely regulated by several naturally occurring inhibitors like tissue inhibitors of metalloproteinases (TIMPs) [11]. Overall, there is a remarkable balance between MMPs and TIMPs in periodontal connective tissues and disturbance of this balance is therefore critically implicated in the destruction of periodontal tissues [12,13]. In normal conditions, MMPs are involved in the remodeling and turnover of periodontal tissues under the strict control of TIMPs, which bind specifically to the active site of the enzyme thereby maintaining the equilibrium between degradation and regeneration of ECM [8,14]. Increased production of MMPs 1–3 is observed in chronic inflammatory condition such as periodontitis that results in excessive connective tissue breakdown [14,15]. MMPs such as MMP-1, -2, -3, -9 and −13 are synthesized in periodontal tissues in response to periodontopathic bacteria like P. gingivalis. Previous studies have suggested that LPS could regulate the MMP expression in various host cell types including HGFs [10,16].

Currently, there are no studies on the role of P. gingivalis LPS lipid A heterogeneity with respect to expression of MMPs in HGFs. The present study therefore aimed to investigate the expression and regulation of MMPs 1–3 and TIMP-1 in HGFs in response to the different isoforms of P. gingivalis LPS1435/1449 and P. gingivalis LPS1690 as well as E. coli LPS as a reference. This study sheds light on the regulation of MMP expression and underlying signal transduction pathways in HGFs in response to heterogeneous P. gingivalis LPS, which could have important implications in the pathogenesis of periodontal disease.

Results

Heterogeneous P. gingivalis LPS lipid A structures differentially modulate MMPs 1–3 and TIMP-1 mRNAs

The dose-dependent experiments showed that both P. gingivalis LPS1435/1449 and LPS1690 differentially modulated the expression of MMP-3 transcript. The latter (0.1-10 μg/ml) markedly upregulated the expression of MMP-3 mRNA while the former did not affect the expression (Figure 1c). Similarly, E. coli LPS (0.1-10 μg/ml) significantly upregulated MMP-3 expression. Both isoforms of P. gingivalis LPS upregulated to different extent the expression of MMP-1 and MMP-2 mRNAs, while E. coli LPS significantly upregulated the expression of these transcripts (Figures 1a and b). TIMP-1 mRNA expression was significantly induced in P. gingivalis LPS1435/1449- and E. coli LPS-treated cells, and no significant induction was observed following P. gingivalis LPS1690 stimulation (Figure 1d).

Figure 1.

Figure 1

Dose-dependent expression of MMPs 1−3 and TIMP-1 mRNAs in P. gingivalis LPS-treated HGFs. Expression of MMP-1 (a), MMP-2 (b) MMP-3 (c) and TIMP-1(d) mRNAs after the stimulation of P. gingivalis (Pg) LPS1435/1449, LPS1690 and E. coli LPS in a dose-dependent assay (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml and 10 μg/ml) for 24 h. The expression of mRNAs was measured by real-time qPCR. Each bar represents the mean ± SD of three independent experiments with three replicates. *Significant difference (p < 0.05) as compared with the controls without LPS treatment.

Notably, MMP-3 transcript was differentially expressed in the cells treated by the two isoforms of P. gingivalis LPS. P. gingivalis LPS1690 significantly upregulated MMP-3 mRNA expression at 24 and 48 h, while E. coli LPS showed prompt expression at 12 h (Figure 2c). MMP-2 mRNA was significantly upregulated by both P. gingivalis LPS1435/1449 and LPS1690 at 48 h (Figure 2b), and MMP-1 transcript was significantly upregulated by P. gingivalis LPS1690 (Figure 2a). E. coli LPS significantly upregulated both MMP-1 and MMP-2 mRNA expression. TIMP-1 transcript was differently modulated by P. gingivalis LPS1435/1449 and LPS1690. The former significantly upregulated its expression at 24 and 48 h, so did E. coli LPS at 48 h.

Figure 2.

Figure 2

Time-dependent expression of MMPs 1−3 and TIMP-1 mRNAs in P. gingivalis LPS-treated HGFs. Expression of MMP-1 (a), MMP-2 (b) MMP-3 (c) and TIMP-1(d) mRNAs after the stimulation of P. gingivalis (Pg) LPS1435/1449 (1 μg/ml), LPS1690 (1 μg/ml) and E. coli LPS (1 μg/ml) in a time-dependent assay (2–48 h). The expression of mRNAs was measured by real-time qPCR. Each bar represents the mean ± SD of three independent experiments with three replicates. *Significant difference (p < 0.05) as compared with the controls without LPS treatment.

P. gingivalis LPS1690 significantly upregulates MMP-3 protein expression

Both dose- and time-dependent experiments showed that MMP-3 protein was differentially modulated by P. gingivalis LPS1435/1449 and LPS1690 in consistent with its transcript expression profile (Figure 3). P. gingivalis LPS1690 at 1 μg/ml and 10 μg/ml significantly upregulated MMP-3 protein expression in a time-dependent manner (12–48 h) (Figure 3c). The MMP-3 level detected in the culture supernatant was greatly higher than that in the cellular fraction (Figures 3a and b). Similar observations occurred in E. coli LPS-treated cells. Moreover, the MMP-3 level induced by P. gingivalis LPS1690 was significantly greater than that stimulated by P. gingivalis LPS1435/1449 (Figures 3a-c).

Figure 3.

Figure 3

P. gingivalis LPS1690 significantly upregulates the expression of MMP-3 proteins. Expression of MMP-3 proteins in the culture supernatants (a) and cellular fractions (b) of HGFs after the stimulation of P. gingivalis (Pg) LPS1435/1449, LPS1690 and E. coli LPS in a dose-dependent assay (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml and 10 μg/ml) for 24 h. Time-dependent expression of MMP-3 proteins in the culture supernatants (c) of HGFs after the stimulation of P. gingivalis LPS1435/1449 (1 μg/ml), LPS1690 (1 μg/ml) and E. coli LPS (1 μg/ml) for 2–48 h. The protein expression levels were measured by ELISA. Each bar represents the mean ± SD of two independent experiments with three replicates. Significant difference as compared with the controls without LPS treatment, *p < 0.05. Significant difference between the cells treated with P. gingivalis LPS1435/1449 and LPS1690 respectively, †p < 0.05. Significant difference between the cells treated with P. gingivalis LPS and E. coli LPS respectively, #p < 0.05.

Next, western blot analysis confirmed that MMP-3 protein markedly increased in P. gingivalis LPS1690- and E. coli LPS-treated cells at 48 h, while P. gingivalis LPS1435/1449 did not induce MMP-3 at a notable level (Figures 4a and c).

Figure 4.

Figure 4

MMP-2 and −3 as well as TIMP-1 protein expression in P. gingivalis LPS- and E. coli LPS-treated HGFs. Confluent HGFs were stimulated with P. gingivalis (Pg) LPS1435/1449 (1 μg/ml), LPS1690 (1 μg/ml) and E. coli LPS (1 μg/ml) at 24 h and 48 h. Culture supernatants of 40 μg were subjected to SDS-PAGE and probed with anti-rabbit polyclonal MMP-2 (1:1000), MMP-3 (1:1000) and TIMP-1 (1:1000) antibodies. Blots were re-probed with α-Tubulin to confirm equal loading in samples. MMP-2: 64 kDa; MMP-3: 54 kDa; TIMP-1: 28 kDa and Tubulin: 50 kDa (a). Quantification of band intensities was performed by ImageJ software. The fold increase values of proteins MMP-2 (b), MMP-3 (c) and TIMP-1 (d) as compared with α-Tubulin are shown in the graphs. One representative blot was shown from three independent experiments. *Significant difference (p < 0.05) as compared with the data at 24 h.

The MMP-2 protein expression is not significantly affected by P. gingivalis LPS and E. coli LPS

Basal expression of MMP-2 was observed at 24 h, and increased at 48 h (Figures 4 and 5). With reference to the control, P. gingivalis LPS and E. coli LPS did not significantly affect the expression levels of MMP-2 proteins (Figures 4a and b). Gelatin zymograms revealed that the MMP-2 presented in two forms including pro-MMP-2 (72 kDa) and active-MMP-2 (68 kDa). In both culture supernatant (Figure 5a and b) and cellular fraction (Figure 5c and d), the activity of MMP-2 at 24 and 48 h was not significantly affected by P. gingivalis LPS and E. coli LPS.

Figure 5.

Figure 5

Detection of MMP-2 in supernatant (a) and cellular fraction (c) of HGFs by gelatin zymography and molecular weight positions of pro-MMP-2 (72 kDa) and active-MMP-2 (68 kDa). 5a: Lane1: molecular weight marker; Lane 2: untreated conditioned medium at 48 h; Lane 3: untreated conditioned medium at 24 h; Lanes 4–5: P. gingivalis (Pg) LPS1435/1449 -treated culture medium at 24 h and 48 h; Lanes 6–7: P. gingivalis LPS1690 -treated medium at 24 h and 48 h; Lanes 8–9: E. coli LPS-treated culture medium at 24 h and 48 h, respectively. 5c: Lane1: Marker; Lanes 2–3: untreated cellular component at 48 h and 24 h; Lanes 4–5: P. gingivalis (Pg) LPS1435/1449 -treated cellular component at 48 h and 24 h; Lanes 6–7: P.gingivalis LPS1690- treated cellular component at 48 h and 24 h; Lanes 8–9: E-coli LPS-treated cellular component at 48 h and 24 h, respectively. Quantification of band intensities was performed by densitometry analysis using ImageJ software. The fold increase values of MMP-2 in culture supernatant (b) and cellular fraction (d) as compared with the control are shown. *Significant difference (p < 0.05) as compared with the data at 24 h.

P. gingivalis LPS1690 induces MMP-3 expression via MAPK signaling pathway

Blocking assays were performed to elucidate the involvements of NF-ĸB and MAPK signaling pathways of P. gingivalis LPS1690 induced MMP-3 expression in HGFs. Both ERK inhibitor (U1026) and p38 MAPK inhibitor (SB202190) significantly suppressed the expression levels of MMP-3 transcript (Figure 6a) and protein (Figure 6b) in P. gingivalis LPS1690- and E. coli LPS-treated cells. Notably, U1026 inhibited MMP-3 expression to a greater extent with reference to SB202190. The expression of MMP-3 was not significantly reduced by IKK-2 inhibitor IV in P. gingivalis LPS1690-treated cells, whereas it significantly suppressed MMP-3 in E. coli LPS-treated cells (Figure 6).

Figure 6.

Figure 6

Effects of NF-ĸB and MAPK inhibitors on P. gingivalis LPS1690-induced MMP-3 mRNA (a) and protein (b) expression in HGFs. Cells were pretreated with IKK-2 inhibitor IV (NF-ĸB inhibitor), SB202190 (p38 MAPK inhibitor) and U1026 (ERK inhibitor) in serum free medium for 1 h, and then treated with P. gingivalis (Pg) LPS1690 (1 μg/ml) and E. coli LPS(1 μg/ml) for additional 12 h. Total RNA was harvested and MMP-3 mRNA levels were determined by real-time qPCR. Cell culture supernatants were collected and the protein expression level was measured by ELISA. The histogram shows quantitative representations of the MMP-3 mRNA levels of three independent experiments. Each value represents the mean ± SD. *Significant difference (p < 0.05) as compared with the controls. #Significant difference (p < 0.05) as compared with the cells treated with P. gingivalis LPS1690 or E. coli LPS alone.

Discussion

Periodontal disease is a complex inflammatory disease initiated by pathogenic plaque biofilms and results in destruction of tooth-supporting tissues and alveolar bone [17,18]. Proteolytic enzymes like MMPs play a major role in the degradation of collagens in periodontal tissues. The expression and regulation of MMPs and TIMPs in HGFs are therefore crucial for maintenance of tissue homeostasis and periodontal health. Although many studies have been performed to elucidate the mechanisms involved in the synthesis and regulation of MMPs in periodontal research, no studies are available on the effect of P. gingivalis LPS structural heterogeneity on the expression of MMPs and the underlying regulatory mechanisms.

MMP-3 is known as stromelysin which has both elastinolytic and collagenolytic activities that degrade basement membrane components such as laminin, elastin fibronectin as well as collagen types II, III, IV, V, IX, X and XI [8,19]. Its level could significantly increase following the stimuli of pro-inflammatory cytokines, growth factors and LPS [14,20-22]. It has been shown that HGFs could upregulate the expression of MMP-3 due to the effects of pro-inflammatory cytokines such as IL-1β and TNF-α [23-25]. The current study showed that the expression of MMP-3 mRNA and protein was markedly upregulated by P. gingivalis LPS1690, whereas no induction was observed in cells treated with P. gingivalis LPS1435/1449, indicating that the heterogeneous lipid A structures of P. gingivalis LPS may differentially modulate the expression of MMP-3 in HGFs. Moreover, TIMP-1 expression was differently modulated by the two isoforms of P. gingivalis LPS as well. It functions as an inhibitor of MMPs by forming non-covalent complexes with MMPs. It has recently been shown that MMP-3 and TIMP-1 variants may significantly contribute to chronic periodontitis and disease progression [26]. The imbalance between MMPs and TIMPs has been implicated in periodontal tissue destruction [27].

P. gingivalis has long been recognized as a major periodontopathogen [28]. Recently, it is regarded as a keystone pathogen due to its ability to significantly influence the oral microbial community by modulating the innate host response [29,30]. Moreover, this bacterium adopts multiple pathogenic mechanisms to evade or subvert the host immune system [31-33]. Notably, P. gingivalis LPS exhibits significant structural heterogeneity with both isoforms of LPS1435/1449 and LPS1690, and our recent studies show that they differentially affect the innate host defense and underlying signaling pathways, thereby contributing to the pathogenesis of periodontal disease [4,34,35]. The current observation that the different isoforms of P. gingivalis LPS modulate the expression of MMP-3 and TIMP-1 may represent an additional pathogenic mechanism adopted by this noxious species to disturb the physiological tissue remodeling and tissue homeostasis, leading to the initiation of periodontal disease.

P. gingivalis and its virulence attributes such as LPS can stimulate various cells types to secrete MMPs including MMP-3 [36,37]. On the contrary, some studies have suggested that P. gingivalis LPS may not induce MMPs such as MMP-1, -2 and −9 [38]. A study performed on gingival epithelial cells using P. gingivalis LPS and E. coli LPS showed that neither LPS nor IL-1β induced MMP-2 or MMP-9 [39]. Studies on tissue models such as synovial membranes dissected from rat knee joints showed induction of MMP-1, -3 and −9 mRNA levels but not MMP-2 in response to LPS stimulation [40]. However, foregoing studies have not considered the heterogeneous nature of bacterial LPS lipid A structures. Therefore, the conflicting findings of the previous studies could to some extent be due to different isoforms of P. gingivalis LPS as demonstrated in the present study.

In the present study, E. coli LPS-treated HGFs exhibited rapid and significant induction of MMPs 1 and 2 mRNAs with reference to the cells treated with P. gingivalis LPS1690. One possibility for this observation may be the higher responsiveness of HGFs to hexa-acylated nature of the E. coli LPS as compared to the penta-acylated structure of P. gingivalis LPS1690. This notion is consistent with previous findings that E. coli LPS is a potent inducer of the production of MMPs in fibroblast-like synovial cells and rat chondrocytes, as well as other innate host response molecules in HGFs and gingival/oral epithelia [41,42]. Moreover, it was noted that both P. gingivalis LPS1435/1449 and E. coli LPS significantly upregulated the expression of MMP-2 mRNA but not its protein as compared to the controls. A number of factors may account for this finding, such as the stability of mRNA, its processing and splicing patterns, half-life of the target protein and post-translational modifications [43,44]. Therefore, in the present study increase in MMP-2 mRNA expression level may not be necessarily reflected at its protein level.

TIMPs exhibit high affinity for binding with MMPs and lead to inhibition of their activities. In the present study, TIMP-1 mRNA was upregulated by P. gingivalis LPS1435/1449-treated HGFs, while no significant up-regulation was observed in P. gingivalis LPS1690-stimulated cells. The current results may not be comparable with previous studies in which the structural heterogeneity of LPS was not fully considered [45-49]. This omission may account for the conflicting reports in the literature. Hence, some studies have observed lower TIMP-1 levels in the conditioned media of HGFs in response to P. gingivalis LPS [49]. In contrast, other studies have noted the increased expression level of TIMP-1 in gingival crevicular fluid of periodontitis patients [45,47]. Moreover, periodontal treatment could alter the balance between MMP-3 and TIMP-1 [46,48]. Based upon the current findings, further study may be warranted to explore the association of different isoforms of P. gingivalis LPS with periodontal conditions in periodontal patients and the possible effect of periodontal treatment on the expression of these LPS isoforms by P. gingivalis. In addition, the discrepancy observed in TIMP-1 mRNA and protein expression following the stimulation of both P. gingivalis LPS1435/1449 and E. coli LPS in HGFs could be due to the complex regulation of transcription and translation [43,44].

LPS is the major immuno-stimulatory component of P. gingivalis which has shown to be capable of interacting with TLRs. Binding of LPS to TLRs activates the downstream signal transduction pathways such as NF-ĸB and MAPK [50,51]. Previous studies have suggested that the activation of MMPs could be through both NF-ĸB and MAPK signaling [23,52-54]. The present study demonstrated that p38 MAPK and ERK are critically involved in P. gingivalis LPS1690- and E. coli LPS-induced expression of MMP-3 in HGFs. This finding is supported by a previous study that p38 MAPK and ERK1/2 pathways are essential for the expression and regulation of MMPs in various cell types in response to LPS [54]. ERK, JNK and p38 MAPK pathways play vital roles in regulating the expression of MMPs induced by various stimulants such as cytokines [53,55,56]. It is noteworthy that the nature of the stimuli could result in specific signal transduction pathway in the same cell type. For instance, MAPK inhibitor significantly reduced the MMP-3 production in HGFs stimulated with IL-1β, but not with epidermal growth factor [23]. In addition, NF-ĸB pathway may be involved in regulation of MMP-3 expression in rabbit dermal fibroblasts, human saphenous vein and rabbit aortic smooth muscle cells [57,58]. The present study showed that NF-ĸB signaling is not critically involved in LPS-induced MMP-3 expression in HGFs. Notably, the MAPK pathway but not NF-κB was significantly involved in the regulation of MMP-3 expression in HGFs in both mRNA and protein levels. Previous studies have also proven that the expression of MMP-3 is mainly mediated through P38 MAPK, ERK and tyrosine kinase pathways, but not through NF-κB pathway [23,59,60]. Moreover, although a study reported that the activation of NF-κB could be important for MMP-3 secretion, no consensus NF-κB binding site was identified in the MMP-3 gene promoter [61,62]. It suggests that NF-κB may regulate the expression of this gene through different binding sites or interacting with other transcription factors [59]. Therefore, within the context and limitations of the present study, it is tempting to speculate that MAPK pathway may be crucial for MMP-3 expression in HGFs in response to P. gingivalis LPS1690. Furthermore, it would be interesting to extend the study to other cells types in human gingiva like gingival epithelial cells to ascertain whether MAPK pathway plays a predominant role in the expression and regulation of MMP-3 in other cells of oral tissues.

Conclusions

The present study reveals that HGFs significantly express MMP-3 in response to penta-acylated P. gingivalis LPS1690 and hexa-acylated E. coli LPS, but not to the tetra-acylated P. gingivalis LPS1435/1449 in HGFs. Blocking p38 MAPK and ERK pathways significantly down-regulates P. gingivalis LPS1690- and E. coli LPS-induced expression of MMP-3. These findings indicate that the heterogeneous lipid A structures of P. gingivalis LPS differentially modulate the expression of MMP-3 in HGFs, which may play a role in periodontal pathogenesis.

Methods

Preparation, purification and identification of P. gingivalis LPS

P. gingivalis LPS was isolated from P. gingivalis ATCC 33277 (the American Type Culture Collection, Rockville, MD). LPS was prepared by the cold MgCl2-Ethanol procedure followed by lipid extraction and conversion to sodium salts as previously described [63,64]. Optical densities were measured at 280 nm and 260 nm to verify the nucleic acid and protein contamination. LPS preparations were further treated to remove the endotoxin protein and the final protein contamination was less than 0.1% [65]. The fatty acid composition of P. gingivalis LPS was further analysed by Gas chromatographic-mass spectroscopy. Then two separate extractions of P. gingivalis LPS with tetra- (LPS1435/1449) and penta-acylated (LPS1690) lipid A structures were generated, and their structures were verified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The canonical hexa-acylated LPS of Escherichia coli JM 83-wild type strain was used as the reference [66].

Cell culture

HGFs were obtained from Sciencell research laboratories (Carlsbad, CA, USA) and cultured according to the manufacturer’s instructions [67,68]. Continuous subcultures up to 10th passage contained homogeneous, slim and spindle-shaped cells growing in characteristic swirls. Third to fourth passages of HGFs without any signs of senescence were used for all experiments as described in our previous study [4].

Stimulation of HGFs by heterogeneous P. gingivalis LPS

The cells suspended at 105 cell/ml were seeded on six-well-plates and grown until confluent at 37°C with 5% CO2 in a culture medium for fibroblasts consisting of basal medium with 2% fetal bovine serum, penicillin/streptomycin (0.01% w/v) and fibroblast growth supplement. Once the cells were over 90% confluent, fibroblast medium (FM) was replaced entirely with serum free and animal component free-medium (FM-acf) for the dose- and time-dependent experiments. In the dose-dependent assay, cells were stimulated with P. gingivalis LPS1435/1449, P. gingivalis LPS1690 or E. coli LPS in the media containing various doses of LPS (0.001 μg/ml −10 μg/ml). Subsequently, 1 μg of LPS was selected as the appropriate dose for the following time-dependent experiments. Cells were incubated with P. gingivalis LPS or E. coli LPS at 1 μg/ml and harvested at 2, 12, 24 and 48 h. Cells without LPS treatment were designated as the controls. Culture supernatants were collected and centrifuged to remove the cellular debris and stored at −70°C for subsequent protein assays. Cellular fraction was then washed with PBS and collected for mRNA and protein extraction.

RNA extraction, cDNA synthesis and real-time qPCR

Total RNA extraction, cDNA transcription and real-time qPCR for MMPs1-3 and TIMP-1 were performed as previously described [17]. In brief, total RNA was extracted from the homogenized HGFs using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions [35]. cDNA was synthesized by reverse transcriptase-PCR at 43°C for 90 min in a 20 μl of reaction mixture containing 1 μg of total RNA, 1 μl (200 U) of SuperScript™ First-Strand Synthesis System (Invitrogen Corp., Carlsbad, CA, USA), 0.5 μg of oligo dT-primer, first-strand buffer, 10 mM DTT, and 1 mM dNTPs. A control reaction was performed without reverse transcriptase for all samples to verify the absence of genomic DNA contamination. Real-time qPCR was then performed by using the StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) in at least three separate experiments. Amplification reactions were undertaken in 20 μl of reaction mixture containing 10 μl of Power SYBR® Green PCR Master Mix, 1 μl of cDNA template and 1 μl of each pair of primers for the targeting cytokine genes (Sigma, St. Louis, MO, USA). Real-time primer pairs were designed using ABI software to amplify a sequence that contains two or more exons whenever possible. The amplification efficiencies of the primers used were above 90%. The specific sequences for each pair of primers are listed in Table 1. β-actin was amplified as an internal control. The real-time qPCR reaction conditions were set at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. The results were analyzed using the comparative cycle threshold (Ct) method as previously described [35]. The expression level of each gene was normalized to a β-actin (ΔCt) and the fold changes for each gene were calculated by comparing the test and control samples from the ΔΔCt values.

Table 1.

Nucleotide sequence of real-time qPCR primers

Primers Sequence (5′-3′)
MMP1-F
ATG CTG AAA CCC TGA AGG TG
MMP1-R
CTG CTT GAC CCT CAG AGA CC
MMP2-F
AGG GCA CAT CCT ATG ACA GC
MMP2-R
ATT TGT TGC CCA GGA AAG TG
MMP3-F
GCA GTT TGC TCA GCC TAT CC
MMP3-R
GAG TGT CGG AGT CCA GCT TTC
TIMP1-F
CTG TTG TTG CTG TGG CTG AT
TIMP1-R
TCC GTC CAC AAG CAA TGA GT
β-actin -F
TTG GCA ATG AGC GGT T
β-actin -R AGTTGAAGGTAGTTTCGTGGAT

Total protein extraction and detection of MMP-3 by ELISA

Total proteins were extracted from homogenized HGFs using CellLyticTM MT-mammalian cell lysis extraction reagent (Sigma, USA). Protein concentrations in both of the cell-bound fraction and culture supernatant were measured respectively by BCA protein assay kit (Pierce, Thermo Scientific, USA) according to the manufacturer’s instructions. Enzyme-linked immunosorbent assay (ELISA) was performed to confirm the expression of MMP-3 proteins (BioRad Laboratories, Hercules, CA, USA). The protein expression in both cell lysate and culture supernatants were measured following manufacturer’s instruction with the minimal detectable concentration of 0.009 ng/ml. No cross reactivity or no interference was observed with recombinant MMP-3. The absorbance values were determined by a micro-plate reader (Victor, Vienna, VA, USA) at optical absorbance of 450 nm and the final concentration was determined with reference to a standard curve. Experiments were repeated two times with three biological replicates.

Western blot analysis for MMP-2, -3 and TIMP-1 proteins

Total cell lysates were prepared and 40 μg of cellular extracts were separated by 10% SDS-PAGE gel and subsequently transferred onto a polyvinylidene difluoride membrane (PVDF). The proteins were then blocked against the protein-free blocking buffer (Pierce, Thermo Scientific) for 1 h. Afterwards, membranes were incubated overnight at 4°C with primary antibodies against polyclonal rabbit anti-human IgG; MMP-2 (1:1000; Cell signaling), MMP-3 (1:1000; BioVendor) and TIMP-1 (1:1000; Cell signaling), and incubated with horseradish peroxidase (HRP) conjugated anti-rabbit secondary antibodies (1:10000). Visualization of the immunoreactive proteins were accomplished by the use of SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Rockford, IL, USA) and exposed to X-ray films. α-Tubulin was used as the internal loading control (1:1000; Cell signaling). The detected bands were scanned on a calibrated densitometer, GS-800 and assessed by the imageJ software-based analysis (http://rsb.info.nih.gov/ij/) to quantify the integrated density.

Gelatin zymography for enzymatic activity of MMP-2

SDS-PAGE gelatin zymography was performed to observe the enzymatic activity of MMP-2. Supernatants and cellular proteins were collected from cells grown in serum-free medium at 24 h and 48 h as described above. Centrifugal filter devices (Amicon Ultra-0.5-Millipore USA) with a cut off value of 30000 NMWL (Nominal Molecular Weight Limit) were used to concentrate the supernatants. Culture supernatants or cellular extracts (40 μg) were mixed with 2 × non-reducing sample buffer without β-mercaptoethanol (0.125 M Tris–HCl at pH 6.8, 4% SDS, 20% glycerol and 0.05% bromophenol blue). Proteins were separated by 10% Tris-glycine polyacrylamide gel copolymerized with 0.1% gelatin as a substrate. After electrophoresis, gels were washed in renaturation buffer (2.5% Triton X-100 in 50 mM Tris–HCl at pH 7.5) for 1 h and incubated for 20 h at 37°C in incubation buffer (0.15 M NaCl, 10 mM CaCl2 and 0.02% NaN3 in 50 mM Tris–HCl at pH 7.5). Gels were stained with 5% Coomassie blue and destained with 7% methanol and 5% acetic acid to reveal zones of lysis within the gelatin matrix. Areas of enzymatic activity appeared as clear bands over the dark background.

Signal transduction pathways involved in LPS-induced MMP-3 expression in HGFs

Specific pharmacological inhibitors for NF-κB activity, IKK-β inhibitor (IKK-2 inhibitor IV), p38 MAPK activity (SB202190) and ERK activity (U1026) were used to investigate two major signaling pathways potentially involved in the expression and regulation of MMP-3 in HGFs in response to heterogeneous P. gingivalis LPS. Each inhibitor was first dissolved in dimethyl sulfoxide (DMSO) and diluted in DPBS. Cells were pretreated with kinase inhibitors, including 10 μmol/L of IKK-2 inhibitor IV (Merck, USA), 10 μmol/L of SB202190 (Calbiochem Biosciences Inc, La Jolla, CA, USA) and 15 μmol/L of U1026 (Cell Signaling, USA) respectively for one hour, prior to stimulation with LPS. Afterwards, 1 μg/ml of LPS was added to the medium and cells were incubated for another 12 h. Culture supernatants were collected for analyzing the MMP-3 expression by ELISA. Extracted RNA was subjected to real-time qPCR to detect the MMP-3 transcript expression. Positive controls were the supernatants from the cells treated with LPS alone, whereas the negative controls were incubated with the culture medium alone. In addition, the cells treated with DMSO alone were considered as the vehicle control (data not shown).

Statistical analysis

All experiments were repeated in three assays for real-time qPCR and two assays for ELISA. Results of the experiments were presented as the mean ± SD. The statistical significance of difference between the data sets from the dose-dependent assay was evaluated by student t-test, one-way analysis of variance (ANOVA) and post hoc testing with Bonferroni and LSD methods. Additionally, the repeated-measures of ANOVA were used to determine the differences between data sets from the time-dependent assay. A p-value < 0.05 was considered statistically significant. All statistical analysis was performed using a software program (SPSS 19.0, SPSS Inc, Chicago, IL, USA).

Abbreviations

Pg: P. gingivalis; LPS: Lipopolysaccharides; HGFs: Human gingival fibroblasts; MMPs: Matrix metalloproteinases; TIMP: Tissue inhibitors of metalloproteinases; qPCR: Quantitative PCR; ELISA: Enzyme linked immunosorbent assay; NF-κB: Nuclear factor-kappaB; MAPK: Mitogen-activated protein kinase.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

TDKH, CJS and LJJ conceived the study. RPD carried out the preparation, purification and identification of P. gingivalis LPS. TDKH and CJS performed the cell culture of HGFs, RNA extraction, cDNA synthesis and real-time qPCR, ELISA, Western blot, gelatin zymography, and detection of signal transduction pathways. RPD, CYW, YW and LJJ were involved in supervision of the experiments and provided reagents and materials. TDKH, CJS and LJJ analyzed the data, and wrote the manuscript. All authors read and approved the final manuscript.

Contributor Information

Thanuja D K Herath, Email: thanuja@hku.hk.

Yu Wang, Email: yuwanghk@hku.hk.

Chaminda J Seneviratne, Email: jaya@hku.hk.

Richard P Darveau, Email: rdarveau@u.washington.edu.

Cun-Yu Wang, Email: cunywang@ucla.edu.

Lijian Jin, Email: ljjin@hkucc.hku.hk.

Acknowledgements

The authors are grateful to Mr. Alan Wong and Ms. Becky Cheung from the Centralized Research Laboratory at the Faculty of Dentistry, The University of Hong Kong, for their technical assistance. This study was financially supported by the Hong Kong Research Grants Council (HKU766909 M, HKU768411 M and HKU767512 M to LJJ) and the Modern Dental Laboratory/HKU Endowment Fund to LJJ.

References

  1. Jin LJ, Armitage GC, Klinge B, Lang NP, Tonetti M, Williams RC. Global oral health inequalities: task group–periodontal disease. Adv Dent Res. 2011;23:221–226. doi: 10.1177/0022034511402080. [DOI] [PubMed] [Google Scholar]
  2. Darveau RP. Periodontitis: a polymicrobial disruption of host homeostasis. Nat Rev Microbiol. 2010;8:481–490. doi: 10.1038/nrmicro2337. [DOI] [PubMed] [Google Scholar]
  3. Dixon DR, Darveau RP. Lipopolysaccharide heterogeneity: innate host responses to bacterial modification of lipid a structure. J Dent Res. 2005;84:584–595. doi: 10.1177/154405910508400702. [DOI] [PubMed] [Google Scholar]
  4. Herath TD, Wang Y, Seneviratne CJ, Lu Q, Darveau RP, Wang CY, Jin L. Porphyromonas gingivalis lipopolysaccharide lipid a heterogeneity differentially modulates the expression of IL-6 and IL-8 in human gingival fibroblasts. J Clin Periodontol. 2011;38:694–701. doi: 10.1111/j.1600-051X.2011.01741.x. [DOI] [PubMed] [Google Scholar]
  5. Hosokawa I, Hosokawa Y, Ozaki K, Yumoto H, Nakae H, Matsuo T. Proinflammatory effects of muramyldipeptide on human gingival fibroblasts. J Periodontal Res. 2010;45:193–199. doi: 10.1111/j.1600-0765.2009.01217.x. [DOI] [PubMed] [Google Scholar]
  6. Mahanonda R, Sa-Ard-Iam N, Montreekachon P, Pimkhaokham A, Yongvanichit K, Fukuda MM, Pichyangkul S. IL-8 and IDO expression by human gingival fibroblasts via TLRs. J Immunol. 2007;178:1151–1157. doi: 10.4049/jimmunol.178.2.1151. [DOI] [PubMed] [Google Scholar]
  7. Phipps RP, Borrello MA, Blieden TM. Fibroblast heterogeneity in the periodontium and other tissues. J Periodontal Res. 1997;32:159–165. doi: 10.1111/j.1600-0765.1997.tb01398.x. [DOI] [PubMed] [Google Scholar]
  8. Birkedal-Hansen H, Moore WG, Bodden MK, Windsor LJ, Birkedal-Hansen B, DeCarlo A, Engler JA. Matrix metalloproteinases: a review. Crit Rev Oral Biol Med. 1993;4:197–250. doi: 10.1177/10454411930040020401. [DOI] [PubMed] [Google Scholar]
  9. Hannas AR, Pereira JC, Granjeiro JM, Tjaderhane L. The role of matrix metalloproteinases in the oral environment. Acta Odontol Scand. 2007;65:1–13. doi: 10.1080/00016350600963640. [DOI] [PubMed] [Google Scholar]
  10. Sorsa T, Tjaderhane L, Konttinen YT, Lauhio A, Salo T, Lee HM, Golub LM, Brown DL, Mantyla P. Matrix metalloproteinases: contribution to pathogenesis, diagnosis and treatment of periodontal inflammation. Ann Med. 2006;38:306–321. doi: 10.1080/07853890600800103. [DOI] [PubMed] [Google Scholar]
  11. Brew K, Dinakarpandian D, Nagase H. Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Biophys Acta. 2000;1477:267–283. doi: 10.1016/S0167-4838(99)00279-4. [DOI] [PubMed] [Google Scholar]
  12. Kubota T, Itagaki M, Hoshino C, Nagata M, Morozumi T, Kobayashi T, Takagi R, Yoshie H. Altered gene expression levels of matrix metalloproteinases and their inhibitors in periodontitis-affected gingival tissue. J Periodontol. 2008;79:166–173. doi: 10.1902/jop.2008.070159. [DOI] [PubMed] [Google Scholar]
  13. Seguier S, Gogly B, Bodineau A, Godeau G, Brousse N. Is collagen breakdown during periodontitis linked to inflammatory cells and expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in human gingival tissue? J Periodontol. 2001;72:1398–1406. doi: 10.1902/jop.2001.72.10.1398. [DOI] [PubMed] [Google Scholar]
  14. Sorsa T, Tjaderhane L, Salo T. Matrix metalloproteinases (MMPs) in oral diseases. Oral Dis. 2004;10:311–318. doi: 10.1111/j.1601-0825.2004.01038.x. [DOI] [PubMed] [Google Scholar]
  15. Lagente V, Boichot E. Role of matrix metalloproteinases in the inflammatory process of respiratory diseases. J Mol Cell Cardiol. 2010;48:440–444. doi: 10.1016/j.yjmcc.2009.09.017. [DOI] [PubMed] [Google Scholar]
  16. Agarwal S, Misra R, Aggarwal A. Induction of metalloproteinases expression by TLR ligands in human fibroblast like synoviocytes from juvenile idiopathic arthritis patients. Indian J Med Res. 2010;131:771–779. [PubMed] [Google Scholar]
  17. Marsh PD. Dental plaque as a biofilm and a microbial community - implications for health and disease. BMC Oral Health. 2006;6(Suppl 1):S14. doi: 10.1186/1472-6831-6-S1-S14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Moore WE, Moore LV. The bacteria of periodontal diseases. Periodontol. 1994;5:66–77. doi: 10.1111/j.1600-0757.1994.tb00019.x. [DOI] [PubMed] [Google Scholar]
  19. Kerrigan JJ, Mansell JP, Sandy JR. Matrix turnover. J Orthod. 2000;27:227–233. doi: 10.1179/ortho.27.3.227. [DOI] [PubMed] [Google Scholar]
  20. Pattamapun K, Tiranathanagul S, Yongchaitrakul T, Kuwatanasuchat J, Pavasant P. Activation of MMP-2 by Porphyromonas gingivalis in human periodontal ligament cells. J Periodont Res. 2003;38:115–121. doi: 10.1034/j.1600-0765.2003.01650.x. [DOI] [PubMed] [Google Scholar]
  21. Sakaki H, Matsumiya T, Kusumi A, Imaizumi T, Satoh H, Yoshida H, Satoh K, Kimura H. Interleukin-1beta induces matrix metalloproteinase-1 expression in cultured human gingival fibroblasts: role of cyclooxygenase-2 and prostaglandin E2. Oral Dis. 2004;10:87–93. doi: 10.1046/j.1354-523X.2003.00982.x. [DOI] [PubMed] [Google Scholar]
  22. Wang L, Zhang ZG, Zhang RL, Gregg SR, Hozeska-Solgot A, LeTourneau Y, Wang Y, Chopp M. Matrix metalloproteinase 2 (MMP2) and MMP9 secreted by erythropoietin-activated endothelial cells promote neural progenitor cell migration. J Neurosci. 2006;26:5996–6003. doi: 10.1523/JNEUROSCI.5380-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Domeij H, Yucel-Lindberg T, Modeer T. Signal pathways involved in the production of MMP-1 and MMP-3 in human gingival fibroblasts. Eur J Oral Sci. 2002;110:302–306. doi: 10.1034/j.1600-0722.2002.21247.x. [DOI] [PubMed] [Google Scholar]
  24. Ruwanpura SM, Noguchi K, Ishikawa I. Prostaglandin E2 regulates interleukin-1beta-induced matrix metalloproteinase-3 production in human gingival fibroblasts. J Dent Res. 2004;83:260–265. doi: 10.1177/154405910408300315. [DOI] [PubMed] [Google Scholar]
  25. Tewari DS, Qian Y, Tewari M, Pieringer J, Thornton RD, Taub R, Mochan EO. Mechanistic features associated with induction of metalloproteinases in human gingival fibroblasts by interleukin-1. Arch Oral Biol. 1994;39:657–664. doi: 10.1016/0003-9969(94)90091-4. [DOI] [PubMed] [Google Scholar]
  26. Letra A, Silva RM, Rylands RJ, Silveira EM, de Souza AP, Wendell SK, Garlet GP, Vieira AR. MMP3 and TIMP1 variants contribute to chronic periodontitis and may be implicated in disease progression. J Clin Periodontol. 2012;39:707–716. doi: 10.1111/j.1600-051X.2012.01902.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Garlet GP, Martins W Jr, Fonseca BA, Ferreira BR, Silva JS. Matrix metalloproteinases, their physiological inhibitors and osteoclast factors are differentially regulated by the cytokine profile in human periodontal disease. J Clin Periodontol. 2004;31:671–679. doi: 10.1111/j.1600-051X.2004.00545.x. [DOI] [PubMed] [Google Scholar]
  28. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL Jr. Microbial complexes in subgingival plaque. J Clin Periodontol. 1998;25:134–144. doi: 10.1111/j.1600-051X.1998.tb02419.x. [DOI] [PubMed] [Google Scholar]
  29. Hajishengallis G, Darveau RP, Curtis MA. The keystone-pathogen hypothesis. Nat Rev Microbiol. 2012;10:717–725. doi: 10.1038/nrmicro2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hajishengallis G, Liang S, Payne MA, Hashim A, Jotwani R, Eskan MA, McIntosh ML, Alsam A, Kirkwood KL, Lambris JD, Darveau RP, Curtis MA. Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe. 2011;10:497–506. doi: 10.1016/j.chom.2011.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Darveau RP, Hajishengallis G, Curtis MA. Porphyromonas gingivalis as a potential community activist for disease. J Dent Res. 2012;91:816–820. doi: 10.1177/0022034512453589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hajishengallis G. Porphyromonas gingivalis-host interactions: open war or intelligent guerilla tactics? Microbes Infect. 2009;11:637–645. doi: 10.1016/j.micinf.2009.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lamont RJ, Jenkinson HF. Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev. 1998;62:1244–1263. doi: 10.1128/mmbr.62.4.1244-1263.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ding PH, Wang CY, Darveau RP, Jin LJ. Porphyromonas gingivalis LPS stimulates the expression of LPS-binding protein in human oral keratinocytes in vitro. Innate Immun. 2013;19:66–75. doi: 10.1177/1753425912450348. [DOI] [PubMed] [Google Scholar]
  35. Lu Q, Darveau RP, Samaranayake LP, Wang CY, Jin LJ. Differential modulation of human β-defensins expression in human gingival epithelia by Porphyromonas gingivalis lipopolysaccharide with tetra- and penta-acylated lipid a structures. Innate Immun. 2009;15:325–335. doi: 10.1177/1753425909104899. [DOI] [PubMed] [Google Scholar]
  36. Andrian E, Grenier D, Rouabhia M. Porphyromonas gingivalis-epithelial cell interactions in periodontitis. J Dent Res. 2006;85:392–403. doi: 10.1177/154405910608500502. [DOI] [PubMed] [Google Scholar]
  37. Kou Y, Inaba H, Kato T, Tagashira M, Honma D, Kanda T, Ohtake Y, Amano A. Inflammatory responses of gingival epithelial cells stimulated with Porphyromonas gingivalis vesicles are inhibited by hop-associated polyphenols. J Periodontol. 2008;79:174–180. doi: 10.1902/jop.2008.070364. [DOI] [PubMed] [Google Scholar]
  38. Kraus D, Winter J, Jepsen S, Jager A, Meyer R, Deschner J. Interactions of adiponectin and lipopolysaccharide from Porphyromonas gingivalis on human oral epithelial cells. PLoS One. 2012;7:e30716. doi: 10.1371/journal.pone.0030716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Andrian E, Grenier D, Rouabhia M. Porphyromonas gingivalis lipopolysaccharide induces shedding of syndecan-1 expressed by gingival epithelial cells. J Cell Physiol. 2005;204:178–183. doi: 10.1002/jcp.20287. [DOI] [PubMed] [Google Scholar]
  40. Hyc A, Osiecka-Iwan A, Niderla-Bielinska J, Moskalewski S. Influence of LPS, TNF, TGF-ss1 and IL-4 on the expression of MMPs, TIMPs and selected cytokines in rat synovial membranes incubated in vitro. Int J Mol Med. 2011;27:127–137. doi: 10.3892/ijmm.2010.550. [DOI] [PubMed] [Google Scholar]
  41. Haglund L, Bernier SM, Onnerfjord P, Recklies AD. Proteomic analysis of the LPS-induced stress response in rat chondrocytes reveals induction of innate immune response components in articular cartilage. Matrix Biol. 2008;27:107–118. doi: 10.1016/j.matbio.2007.09.009. [DOI] [PubMed] [Google Scholar]
  42. Santangelo KS, Johnson AL, Ruppert AS, Bertone AL. Effects of hyaluronan treatment on lipopolysaccharide-challenged fibroblast-like synovial cells. Arthritis Res Ther. 2007;9:R1. doi: 10.1186/ar2104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Castaño JP, Faught WJ, Glavé EE, Russell BS, Frawley LS. Discordance of prolactin gene transcription, mRNA storage, and hormone release in individual mammotropes. Am J Physiol. 1997;272:390–396. doi: 10.1152/ajpendo.1997.272.3.E390. [DOI] [PubMed] [Google Scholar]
  44. Vogel C, Marcotte EM. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet. 2012;13:227–232. doi: 10.1038/nrg3185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Alpagot T, Bell C, Lundergan W, Chambers DW, Rudin R. Longitudinal evaluation of GCF MMP-3 and TIMP-1 levels as prognostic factors for progression of periodontitis. J Clin Periodontol. 2001;28:353–359. doi: 10.1034/j.1600-051x.2001.028004353.x. [DOI] [PubMed] [Google Scholar]
  46. Haerian A, Adonogianaki E, Mooney J, Manos A, Kinane DF. Effects of treatment on gingival crevicular collagenase, stromelysin and tissue inhibitor of metalloproteinases and their ability to predict response to treatment. J Clin Periodontol. 1996;23:83–91. doi: 10.1111/j.1600-051X.1996.tb00539.x. [DOI] [PubMed] [Google Scholar]
  47. Nomura T, Ishii A, Oishi Y, Kohma H, Hara K. Tissue inhibitors of metalloproteinases level and collagenase activity in gingival crevicular fluid: the relevance to periodontal diseases. Oral Dis. 1998;4:231–240. doi: 10.1111/j.1601-0825.1998.tb00286.x. [DOI] [PubMed] [Google Scholar]
  48. Tuter G, Kurtis B, Serdar M, Yucel A, Ayhan E, Karaduman B, Ozcan G. Effects of phase I periodontal treatment on gingival crevicular fluid levels of matrix metalloproteinase-3 and tissue inhibitor of metalloproteinase-1. J Clin Periodontol. 2005;32:1011–1015. doi: 10.1111/j.1600-051X.2005.00816.x. [DOI] [PubMed] [Google Scholar]
  49. Zhou J, Windsor LJ. Porphyromonas gingivalis affects host collagen degradation by affecting expression, activation, and inhibition of matrix metalloproteinases. J Periodont Res. 2006;41:47–54. doi: 10.1111/j.1600-0765.2005.00835.x. [DOI] [PubMed] [Google Scholar]
  50. Kawai T, Akira S. TLR signaling. Semin Immunol. 2007;19:24–32. doi: 10.1016/j.smim.2006.12.004. [DOI] [PubMed] [Google Scholar]
  51. Takeda K, Akira S. TLR signaling pathways. Semin Immunol. 2004;16:3–9. doi: 10.1016/j.smim.2003.10.003. [DOI] [PubMed] [Google Scholar]
  52. Cortez DM, Feldman MD, Mummidi S, Valente AJ, Steffensen B, Vincenti M, Barnes JL, Chandrasekar B. IL-17 stimulates MMP-1 expression in primary human cardiac fibroblasts via p38 MAPK- and ERK1/2-dependent C/EBP-beta, NF-kappaB, and AP-1 activation. Am J Physiol Heart Circ Physiol. 2007;293:H3356–H3365. doi: 10.1152/ajpheart.00928.2007. [DOI] [PubMed] [Google Scholar]
  53. Gao D, Bing C. Macrophage-induced expression and release of matrix metalloproteinase 1 and 3 by human preadipocytes is mediated by IL-1beta via activation of MAPK signaling. J Cell Physiol. 2011;226:2869–2880. doi: 10.1002/jcp.22630. [DOI] [PubMed] [Google Scholar]
  54. Lai WC, Zhou M, Shankavaram U, Peng G, Wahl LM. Differential regulation of lipopolysaccharide-induced monocyte matrix metalloproteinase (MMP)-1 and MMP-9 by p38 and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinases. J Immunol. 2003;170:6244–6249. doi: 10.4049/jimmunol.170.12.6244. [DOI] [PubMed] [Google Scholar]
  55. McCawley LJ, Li S, Wattenberg EV, Hudson LG. Sustained activation of the mitogen-activated protein kinase pathway. A mechanism underlying receptor tyrosine kinase specificity for matrix metalloproteinase-9 induction and cell migration. J Biol Chem. 1999;274:4347–4353. doi: 10.1074/jbc.274.7.4347. [DOI] [PubMed] [Google Scholar]
  56. Reunanen N, Westermarck J, Hakkinen L, Holmstrom TH, Elo I, Eriksson JE, Kahari VM. Enhancement of fibroblast collagenase (matrix metalloproteinase-1) gene expression by ceramide is mediated by extracellular signal-regulated and stress-activated protein kinase pathways. J Biol Chem. 1998;273:5137–5145. doi: 10.1074/jbc.273.9.5137. [DOI] [PubMed] [Google Scholar]
  57. Bond M, Baker AH, Newby AC. Nuclear factor kappaB activity is essential for matrix metalloproteinase-1 and −3 upregulation in rabbit dermal fibroblasts. Biochem Biophys Res Commun. 1999;264:561–567. doi: 10.1006/bbrc.1999.1551. [DOI] [PubMed] [Google Scholar]
  58. Bond M, Chase AJ, Baker AH, Newby AC. Inhibition of transcription factor NF-kappaB reduces matrix metalloproteinase-1, -3 and −9 production by vascular smooth muscle cells. Cardiovasc Res. 2001;50:556–565. doi: 10.1016/S0008-6363(01)00220-6. [DOI] [PubMed] [Google Scholar]
  59. Fukuda K, Fujitsu Y, Kumagai N, Nishida T. Inhibition of matrix metalloproteinase-3 synthesis in human conjunctival fibroblasts by interleukin-4 or interleukin-13. Invest Ophthalmol Vis Sci. 2006;47:2857–2864. doi: 10.1167/iovs.05-1261. [DOI] [PubMed] [Google Scholar]
  60. Kajanne R, Miettinen P, Mehlem A, Leivonen SK, Birrer M, Foschi M, Kähäri VM, Leppä S. EGF-R regulates MMP function in fibroblasts through MAPK and AP-1 pathways. J Cell Physiol. 2007;212:489–497. doi: 10.1002/jcp.21041. [DOI] [PubMed] [Google Scholar]
  61. Chase AJ, Bond M, Crook MF, Newby AC. Role of nuclear factor-kappa B activation in metalloproteinase-1, -3, and −9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo. Arterioscler Thromb Vasc Biol. 2002;22:765–771. doi: 10.1161/01.ATV.0000015078.09208.92. [DOI] [PubMed] [Google Scholar]
  62. Frisch SM, Ruley HE. Transcription from the stromelysin promoter is induced by interleukin-1 and repressed by dexamethasone. J Biol Chem. 1987;262:16300–16304. [PubMed] [Google Scholar]
  63. Al-Qutub MN, Braham PH, Karimi-Naser LM, Liu X, Genco CA, Darveau RP. Hemin-dependent modulation of the lipid A structure of Porphyromonas gingivalis lipopolysaccharide. Infect Immun. 2006;74:4474–4485. doi: 10.1128/IAI.01924-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Darveau RP, Pham TT, Lemley K, Reife RA, Bainbridge BW, Coats SR, Howald WN, Way SS, Hajjar AM. Porphyromonas gingivalis lipopolysaccharide contains multiple lipid a species that functionally interact with both toll-like receptors 2 and 4. Infect Immun. 2004;72:5041–5051. doi: 10.1128/IAI.72.9.5041-5051.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Manthey CL, Perera PY, Henricson BE, Hamilton TA, Qureshi N, Vogel SN. Endotoxin-induced early gene expression in C3H/HeJ (Lpsd) macrophages. J Immunol. 1994;153:2653–2663. [PubMed] [Google Scholar]
  66. Bainbridge BW, Coats SR, Pham TT, Reife RA, Darveau RP. Expression of a Porphyromonas gingivalis lipid a palmitylacyltransferase in Escherichia coli yields a Chimeric lipid a with altered ability to stimulate interleukin-8 secretion. Cell Microbiol. 2006;8:120–129. doi: 10.1111/j.1462-5822.2005.00605.x. [DOI] [PubMed] [Google Scholar]
  67. Di Domenico G, Del Vecchio L, Postiglione L, Ramaglia L. Immunophenotypic analysis of human gingival fibroblasts and its regulation by granulocyte-macrophage colony-stimulating factor (GM-CSF) Minerva Stomatol. 2003;52:87–91. [PubMed] [Google Scholar]
  68. Poggi P, Rodriguez Y, Baena R, Rizzo S, Rota MT. Mouthrinses with alcohol: cytotoxic effects on human gingival fibroblasts in vitro. J Periodontol. 2003;74:623–629. doi: 10.1902/jop.2003.74.5.623. [DOI] [PubMed] [Google Scholar]

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES