Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Activates Global and Heterogeneous Local Ca²⁺ Signals from NAADP- and Ryanodine Receptor-gated Ca²⁺ Stores in Pulmonary Arterial Myocytes

Background: NAADP activates Ca²⁺ release from endolysosomal organelles.

Results: NAADP activates two-pore channels in pulmonary arterial smooth muscle cells to elicit global and heterogeneous subcellular Ca²⁺ signals from NAADP- and ryanodine-sensitive Ca²⁺ stores, which contribute to the agonist-induced response.

Conclusion: NAADP mediates complex Ca²⁺ interactions between endolysosomes and the sarcoplasmic reticulum to regulate vascular reactivity and other cellular functions.

Significance: The results improve our understanding of NAADP-dependent regulation of pulmonary vascular functions.

Abstract

Nicotinic acid adenine dinucleotide phosphate (NAADP) is the most potent Ca²⁺-mobilizing messenger that releases Ca²⁺ from endolysosomal organelles. Recent studies showed that NAADP-induced Ca²⁺ release is mediated by the two-pore channels (TPCs) TPC1 and TPC2. However, the expression of TPCs and the NAADP-induced local Ca²⁺ signals have not been examined in vascular smooth muscle. Here, we found that both TPC1 and TPC2 are expressed in rat pulmonary arterial smooth muscle cells (PASMCs), with TPC1 being the major subtype. Application of membrane-permeant NAADP acetoxymethyl ester to PASMCs elicited a biphasic increase in global [Ca²⁺]_i, which was independent of extracellular Ca²⁺ and blocked by the NAADP antagonist Ned-19 or the vacuolar H⁺-ATPase inhibitor bafilomycin A₁, indicating Ca²⁺ release from acidic endolysosomal Ca²⁺ stores. The Ca²⁺ response was unaffected by xestospongin C but was partially blocked by ryanodine or thapsigargin. NAADP triggered heterogeneous local Ca²⁺ signals, including a diffuse increase in cytosolic [Ca²⁺], Ca²⁺ sparks, Ca²⁺ bursts, and regenerative Ca²⁺ release. The diffuse Ca²⁺ increase and Ca²⁺ bursts were ryanodine-insensitive, presumably arising from different endolysosomal sources. Ca²⁺ sparks and regenerative Ca²⁺ release were inhibited by ryanodine, consistent with cross-activation of loosely coupled ryanodine receptors. Moreover, Ca²⁺ release stimulated by endothelin-1 was inhibited by Ned-19, ryanodine, or xestospongin C, suggesting that NAADP-mediated Ca²⁺ signals interact with both ryanodine and inositol 1,4,5-trisphosphate receptors during agonist stimulation. Our results show that NAADP mediates complex global and local Ca²⁺ signals. Depending on the physiological stimuli, these diverse Ca²⁺ signals may serve to regulate different cellular functions in PASMCs.

Introduction

Ca²⁺ ion serves as a ubiquitous signal for numerous cellular functions ranging from muscle contraction to gene expression. Depending on the specific agonists and physiological stimuli, global and local Ca²⁺ signals with unique spatiotemporal properties are generated by a multitude of extracellular Ca²⁺ influx and intracellular Ca²⁺ release pathways to precisely regulate the specific effectors in various subcellular compartments (1). There are three Ca²⁺-mobilizing messengers, namely inositol 1,4,5-trisphosphate (InsP₃),³ cyclic ADP-ribose (cADPR), and nicotinic acid adenine dinucleotide phosphate (NAADP). NAADP is the most powerful Ca²⁺-mobilizing messenger of these three endogenous messengers and is capable of activating Ca²⁺ release at low nanomolar concentrations (2), but its action mechanism is the least understood.

NAADP is generated from inactive NADP by the multifunctional enzyme CD38, which is also known as ADP-ribosyl cyclase for its cyclase activity of converting ADP-ribose to cADPR (3). Unlike InsP₃ and cADPR, which activate InsP₃ receptors (InsP₃Rs) and ryanodine receptors (RyRs) of the sarcoplasmic (SR)/endoplasmic reticulum, NAADP targets specific Ca²⁺ release channels on acidic endolysosomes (4, 5). Recent studies have indicated that the two-pore channels (TPCs) TPC1 and TPC2 are the NAADP-activated Ca²⁺ release channels (6–8). TPC1 is expressed in all stages of endosomes and lysosomes, whereas TPC2 is present predominantly in late endosomes and lysosomes (6–10). Functional studies have shown that overexpression of TPC1 or TPC2 enhances the NAADP-induced Ca²⁺ response (6–8); reconstitution of TPCs in lipid bilayers exhibits NAADP-induced channel activity (11, 12); and knockdown of endogenous TPCs or deletion of the tpcn2 gene abbreviates NAADP-induced responses in intact native cells (7, 8, 12–14). These breakthrough discoveries have attracted unprecedented interest in the study of NAADP-dependent Ca²⁺ signaling mechanisms.

Increasing evidence suggests that NAADP plays important roles in vascular smooth muscle cell (VSMC) function, and NAADP-mediated Ca²⁺ release is linked to agonist-induced vasoconstriction. For example, application of NAADP to microsomes of aortic smooth muscle cells elicited Ca²⁺ release independent of InsP₃ and cADPR (15, 16). Endothelin-1 (ET-1) caused an increase in NAADP production and activated the Ca²⁺ response in coronary arterial myocytes (17). ET-1 and norepinephrine triggered the Ca²⁺ response and vasoconstriction in renal afferent arterioles, and these responses were attenuated by the vacuolar H⁺-ATPase inhibitors concanamycin A and bafilomycin A₁ and by the NAADP antagonist Ned-19 (18). In addition, a recent study showed that Fas ligand, an inducer of apoptosis, elicits NAADP-mediated lysosomal Ca²⁺ release in mouse coronary arterial myocytes, suggesting that NAADP may involve in the inflammatory/apoptotic response in VSMCs (19).

In pulmonary arterial smooth muscle cells (PASMCs), intracellular dialysis of NAADP triggered “bursts” of spatially restricted Ca²⁺ release and global Ca²⁺ waves, which were blocked by depleting lysosomal Ca²⁺ with bafilomycin A₁ or by inhibition of RyRs (20, 21). It has been suggested that lysosomes and the RyR-gated SR are coupled to form specialized “trigger zones,” at which NAADP-dependent Ca²⁺ signals are amplified by RyRs through Ca²⁺-induced Ca²⁺ release (21, 22). We have previously found that integrin-specific ligands mobilize Ca²⁺ in part through Ca²⁺ release from the acidic lysosomal Ca²⁺ stores in PASMCs (23), and the expression of integrins and their associated Ca²⁺ responses are altered during the development of pulmonary hypertension (24). These studies suggest that NAADP-dependent Ca²⁺ signals may be critically involved in the regulation of pulmonary circulation. However, the expression of NAADP channels and the properties of NAADP-dependent local Ca²⁺ signals have not been examined in VSMCs.

In this study, we examined systematically the NAADP-dependent Ca²⁺ signaling pathway in PASMCs by characterizing the expression of TPCs, identifying the associated Ca²⁺ sources, quantifying the spatiotemporal properties of local Ca²⁺ events activated by NAADP, and determining the contribution of NAADP in an agonist-induced Ca²⁺ response. These experiments provide essential information for our understanding of NAADP-dependent Ca²⁺ signaling in the pulmonary vasculature.

EXPERIMENTAL PROCEDURES

Isolation of Intralobar Pulmonary Arteries and Aortas

All animal procedures in this study were performed in accordance with the guidelines approved by The Johns Hopkins Animal Care and Use Committee. Pulmonary arteries (PAs) and aortas were isolated from male Wistar rats (150–250 g) anesthetized with sodium pentobarbital (130 mg/kg intraperitoneally). Lungs and thoracic aortas were removed after exsanguination and transferred to a Petri dish filled with HEPES-buffered salt solution (HBSS) containing 130 mm NaCl, 5 mm KCl, 1.2 mm MgCl₂, 1.5 mm CaCl₂, 10 mm HEPES, and 10 mm glucose (pH 7.4 adjusted with NaOH). Intralobar large PAs (lPAs; ∼300–800 μm), small PAs (sPAs; <300 μm), and descending thoracic aortas were isolated and cleaned free of connective tissue. The endothelium was removed by gently rubbing the luminal surface with a cotton swab.

Isolation and Transient Culture of PASMCs

PASMCs were enzymatically isolated and transiently cultured as described previously (25). In brief, endothelium-denuded PAs were allowed to recover for 30 min in cold (4 °C) HBSS, followed by 20 min in reduced Ca²⁺ (20 μm) HBSS at room temperature. The tissue was digested at 37 °C for 20 min in 20 μm Ca²⁺/HBSS containing collagenase (type I, 1750 units/ml), papain (9.5 units/ml), BSA (2 mg/ml), and dithiothreitol (1 mm). It was then washed with Ca²⁺-free HBSS to stop digestion, and PASMCs were dispersed gently by trituration with a small-bore pipette in Ca²⁺-free HBSS at room temperature. The dispersed PASMCs were placed on 25-mm glass coverslips and cultured transiently (16–24 h) in Ham's F-12 medium (with l-glutamine) supplemented with 0.5% FCS, 100 units/ml streptomycin, and 0.1 mg/ml penicillin under 21% O₂ and 5% CO₂ before use.

RNA Preparation and RT-PCR

Endothelium-denuded intralobar PAs, sPAs, and aortas were frozen in liquid nitrogen and then mechanically pulverized and homogenized with a mortar and pestle kept on dry ice. Total RNA was extracted using the RNeasy mini kit (Qiagen) following standard procedures. Genomic DNA contamination was removed by TURBO DNA-free^TM DNase (Ambion, Austin, TX). 1 μg of total RNA were used for first-strand cDNA synthesis with random hexamer primers and Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's protocol. The resulting first-strand cDNAs were directly used as templates for PCR amplification. Sense and antisense primers specific for TPC1 and TPC2 (listed in Table 1) were used. Reactions were carried out using PCR SuperMix (Invitrogen) with the following parameters: denaturation at 94 °C for 30 s, annealing at 60 °C for 45 s, and extension at 72 °C for 90 s. A total of 35 cycles were performed. This was followed by a final extension at 72 °C for 10 min and then storage at 4 °C. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide, and the sequences of PCR products were determined for verification. Parallel reactions were run for each RNA sample in the absence of Superscript III to access the degree of genomic DNA contamination.

TABLE 1.

Primers for conventional and real-time RT-PCR experiments

Gene	NCBI accession no.	Primer	Sequence (5′–3′)	Nucleotide position	Predicted size in bp
Rat tpc1	NM_139332.3	Sensea	GTGCGAGTCACCCGCTGTCC	375–394	122
		Antisensea	GGAAGCCCAGCCACCGCAAT	496–477
		Sense	TCCCTGCGCTCAAGCTCCGA	392–411	309
		Antisense	TGAAAGGCGGCAGCGACTGG	700–681
Rat tpc2	NM_001107566.1	Sensea	GCCCCCTGTCGCTTTGGGAC	1487–1506	107
		Antisensea	GGTGCTGGCTACCACAGCCG	1593–1574
		Sense	TACTCCGGCCCGTGGTCGAT	1870–1889	262
		Antisense	TGCACAGATGCAAGTGTGGATGC	2131–2109

^a Primers used in real-time PCR.

Quantitative Real-time RT-PCR

Gene-specific real-time PCR primers for TPC1 and TPC2 were designed (Table 1). PCRs were set up with iQ^TM SYBR Green PCR Supermix (Bio-Rad) using 1 μl of cDNA as the template in each 20-μl reaction mixture. The PCR protocol consisted of an initial step at 95 °C for 5 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 1 min and was performed using an iQ5 multicolor real-time PCR detection system (Bio-Rad). Using the same protocol, we generated standard curves from serial dilutions of purified PCR products with known copy numbers measured by absorbance at 260 nm. The absolute copy number of the mRNA of interest was determined by interpolation of the standard curve with the threshold cycle value of each sample. To confirm the specificity of the PCR products, a melting curve was obtained at the end of each run. Standard gel electrophoresis was also performed to ensure the end product generated a single band with the predicted size (100–150 bases). Data were normalized with the quantity of 18 S rRNA in individual samples to correct for sample variability.

Western Blotting

PAs frozen in liquid nitrogen were crushed and homogenized using a mortar and pestle and resuspended in ice-cold lysis buffer containing 50 mm Tris-Cl (pH 7.4), 150 mm NaCl, 1% deoxycholic acid, 0.1% SDS, 0.5% Nonidet P-40, and protease inhibitor mixture (Roche Applied Science). The homogenate was centrifuged at 1000 × g for 5 min at 4 °C, the supernatant was collected, and the protein concentration was estimated using the BCA assay. 20 μg of protein sample was resolved on an 8% SDS-polyacrylamide gel and electrotransferred onto a PVDF membrane (Millipore). The membrane was blocked with 5% (w/v) nonfat dry milk in PBS containing 0.02% Tween 20 for 1 h at room temperature, followed by overnight incubation at 4 °C with a specific primary antibody. The primary antibodies were polyclonal rabbit anti-TPC1 (1:500 dilution) from Abcam (Cambridge, MA) and anti-TPC2 (1:2500 dilution) from Alomone Labs (Jerusalem, Israel). The actin level was also determined and used as a loading control. The membrane was washed and incubated with peroxidase-conjugated goat anti-rabbit secondary antibody (Bio-Rad) at 1:2500 dilution at room temperature for 1 h. Protein bands were detected by enhanced chemiluminescence (Pierce) and imaged using a Gel Logic 200 image system (Kodak). Deglycosylation assays were performed on some samples to verify the double bands detected by the anti-TPC1 and anti-TPC2 antibodies. Protein samples (10 μg) were incubated in the absence or presence of peptide:N-glycosidase F (New England Biolabs) according to the manufacturer's instruction. Protein denaturation was performed at 45 °C for 10 min, and enzyme incubation was carried out at 37 °C for 1 h. Protein samples were resolved and analyzed by immunoblotting as described above.

Measurement of Global [Ca²⁺]_i

[Ca²⁺]_i was monitored using the membrane-permeable Ca²⁺-sensitive fluorescent dye fluo 3-AM. PASMCs were loaded with 5–10 μm fluo 3-AM (dissolved in Me₂SO with 20% pluronic acid) for 45 min at room temperature (∼23 °C) in normal Tyrode's solution containing 137 mm NaCl, 5.4 mm KCl, 2 mm CaCl₂, 1 mm MgCl₂, 10 mm HEPES, and 10 mm glucose (pH 7.4 adjusted with NaOH). Cells were then washed and rested for 15–30 min to allow complete de-esterification of the cytosolic dye. fluo 3 was excited at 488 nm, and emission light at >515 nm was detected from cells in a microscopic field using a Nikon Diaphot microscope (objective, Fluor 40×/1.3 numerical aperture) equipped with a photomultiplier tube-based microfluorometer. Protocols were executed and data were collected on-line with a Digidata analog-to-digital interface and a pCLAMP software package (Axon Instruments, Inc., Foster City, CA). [Ca²⁺]_i was calibrated using the equation [Ca²⁺]_i = K_D·(F − F_bg)/(F_max − F) (26), where K_D is 1.1 μm for fluo 3, F_bg is the background fluorescence, and F_max is the maximum fluorescence determined in situ in cells superfused with 10 μm 4-bromo-A23187 after each experiment.

Measurement of Local Ca²⁺ Events

Ca²⁺ events were visualized using fluo 3-AM as described previously (25). Confocal images were acquired using a Zeiss LSM 510 inverted confocal microscope with a Zeiss Plan-Neofluar 40×/1.3 oil immersion objective. The confocal pinhole was set to render a spatial resolution of 0.4 μm in the x-y axis and 1.7 μm in the z axis. fluo 3-AM was excited by the 488 nm light of an argon laser, and fluorescence was measured at >505 nm. Images were acquired in the line scan mode (digital zoom rendering a 38-μm scan line), scanning at 0.075 μm/pixel and 512 pixels/line at 2-ms intervals. Photobleaching and laser damage to the cells were minimized by attenuating the laser to ∼1% of its maximum power (25 milliwatts) with an acousto-optical tunable filter, and each cell was imaged for <20 s. Images were processed and Ca²⁺ sparks were analyzed by custom-written algorithms using the IDL software package (27) or the SparkMaster plug-in of ImageJ software (28).

Statistical Analysis

Data are expressed as means ± S.E. Statistical significance (p < 0.05) of the changes was assessed by paired or unpaired Student's t tests, non-parametric Mann-Whitney U tests, or one- or two-way analysis of variance with Tukey's range test for post hoc analysis, wherever applicable.

RESULTS

Expression of TPC1 and TPC2 mRNAs and Proteins

To study the NAADP-dependent Ca²⁺ response, the expression of the NAADP channels TPC1 and TPC2 was first characterized in sPAs, lPAs, and aortas using conventional RT-PCR. Fig. 1 (A and B) shows the amplified PCR products generated after 35 cycles from endothelium-denuded sPAs, lPAs, and aortas. TPC1 and TPC2 transcripts were detected in all three types of vascular tissues. The PCR-amplified products had sizes corresponding to the predicted values (309 bp for TPC1 and 262 bp for TPC2) and matched the predicted sequences. The relative expression of TPC1 and TPC2 was quantified by real-time RT-PCR. The TPC1 mRNA level was ∼4–5-fold higher than the TPC2 mRNA level in all three vascular tissues, with the values of individual samples normalized with 18 S rRNA. In addition, TPC1 and TPC2 mRNA expression in lPAs was the highest of the three vascular tissues, with the order lPAs > sPAs > aortas.

FIGURE 1.

Expression of TPC1 and TPC2 mRNAs and proteins in rat PAs and aortas. A and B, conventional (upper panels) and real-time (lower panels) RT-PCR quantification of TPC1 and TPC2 mRNAs in endothelium-denuded sPAs, intralobar lPAs, and aortas. Values were normalized to those of 18 S rRNA and were averaged from five rats for each channel subtype. C and D, Western blot analysis of TPC1 and TPC2 proteins. The upper panels show TPC protein bands resolved from lPA samples with (+) and without (−) incubation with peptide:N-glycosidase F (PNGase). Deglycosylation of TPC1 or TPC2 protein with peptide:N-glycosidase F reduced the double band signals to a single band (upper panels). The middle panels show representative blots of TPC1 and TPC2 proteins in samples of sPAs, lPAs, and aortas. The lower panels show averaged values measured from samples of five rats for TPC1 and seven rats for TPC2.

TPC1 and TPC2 proteins in sPAs, lPAs, and aortas were detected by immunoblotting (Fig. 1, C and D). Specific anti-TPC1 antibodies detected two clear bands at ∼100 and ∼75 kDa; double bands were also detected at ∼75 and ∼60 kDa using anti-TPC2 antibody. The double bands were related to N-glycosylation of TPC1 and TPC2 proteins as previously described (6). Pretreatment of samples with peptide:N-glycosidase F to remove the N-glycan chains converted the blots to a single band of ∼75 kDa for TPC1 and ∼60 kDa for TPC2. The disappearance of the higher molecular mass bands after peptide:N-glycosidase F treatment indicated that they were the mature glycosylated proteins, whereas the lower bands were the core proteins. TPC1 and TPC2 protein levels were similar in sPAs, lPAs, and aortas (TPC1, n = 7; and TPC2, n = 7), with α-actin used as the internal standard for normalization. These results clearly show that the two types of NAADP-sensitive Ca²⁺ channels are expressed in pulmonary arterial smooth muscle.

NAADP-induced Mobilization of Global Ca²⁺ in PASMCs

The presence of functional NAADP-sensitive Ca²⁺ channels in PASMCs was examined using the cell-permeant NAADP analog NAADP-AM (ISIS Innovation Ltd., Oxford, United Kingdom). Application of NAADP-AM activated a concentration-dependent increase in [Ca²⁺]_i (Fig. 2, A and B). NAADP-AM at 0.25 and 0.5 μm elicited sustained increases in [Ca²⁺]_i, whereas 1 μm activated a biphasic response with an initial transient rise, followed by a sustained increase in [Ca²⁺]_i. The 1 μm NAADP-AM-induced response was unaffected by exchanging Ca²⁺-free solution (with 1 mm EGTA) 1 min prior to NAADP application (Fig. 2, C and D). The peak and sustained Ca²⁺ responses were 216 ± 13 and 91 ± 6 nm (n = 5), respectively, in the presence of Ca²⁺ and 185 ± 86 and 86 ± 16 nm (n = 5), respectively, in the absence of extracellular Ca²⁺. These results indicate that the NAADP-induced Ca²⁺ response is solely dependent on Ca²⁺ mobilization from intracellular Ca²⁺ stores.

FIGURE 2.

NAADP-AM-induced concentration-dependent Ca²⁺ response in PASMCs. A, mean traces showing the change in [Ca²⁺]_i (Δ[Ca²⁺]_i) evoked by different concentrations of NAADP-AM. B, mean values of peak Δ[Ca²⁺]_i activated by 0.25, 0.50, and 1.00 μm NAADP-AM. Values are mean data from six experiments for each concentration. *, significantly different (p < 0.05) from the control; #, significantly different between 0.50 and 1.00 μm. C, mean traces of Ca²⁺ transients activated by 1 μm NAADP-AM in the absence and presence of extracellular Ca²⁺. D, mean values of the peak and sustained increases in [Ca²⁺]_i activated by NAADP-AM (n = 5 for each condition). Values of the sustained response were measured at 500 s.

There is substantial evidence suggesting that NAADP-sensitive channels are expressed mainly in the acidic endolysosomal organelles (29, 30). To examine the importance of endolysosomal Ca²⁺ stores in the NAADP-activated Ca²⁺ response, acidic Ca²⁺ stores were depleted by inhibiting the vacuolar H⁺-ATPase to disrupt the lysosomal H⁺ gradient for Ca²⁺ entry via Ca²⁺/H⁺ exchange. Preincubation of PASMCs for 1 h with bafilomycin A₁ (3 μm), a specific vacuolar H⁺-ATPase inhibitor (31), significantly inhibited the peak and completely abolished the sustained phase of the Ca²⁺ response activated by NAADP-AM (1 μm) (Fig. 3A). The peak Ca²⁺ response was 164 ± 15 nm (n = 5) in the control PASMCs and 50 ± 11 nm (n = 5; p < 0.05) in the bafilomycin A₁-pretreated PASMCs (Fig. 3B). The specificity of the NAADP-AM-induced Ca²⁺ responses was further verified using the selective NAADP receptor antagonist Ned-19 (Enzo Life Sciences, Ann Arbor, MI) (Fig. 3, C and D) (32). Pretreatment of PASMCs with Ned-19 (1 μm) for 20 min eliminated the initial transient peak and significantly reduced the sustained phase of the NAADP-AM-activated Ca²⁺ response (control, 97 ± 12 nm (n = 6), and Ned-19, 52 ± 4 nm (n = 6); p < 0.01). The NAADP-AM-activated Ca²⁺ response was completely abolished by further increasing the concentration of Ned-19 to 100 μm. The significant inhibition of the Ca²⁺ response by bafilomycin A₁ and Ned-19 indicates that NAADP-AM mobilizes Ca²⁺ mainly through the activation of specific NAADP receptors of the acidic endolysosomal organelles in PASMCs.

FIGURE 3.

Effects of bafilomycin A₁ and Ned-19 on Ca²⁺ release induced by NAADP-AM in PASMCs. A, averaged Ca²⁺ transients activated by 1 μm NAADP-AM with or without preincubation with the vacuolar H⁺-ATPase inhibitor bafilomycin A₁ (3 μm) for 1 h. B, mean values of the peak and sustained increases in [Ca²⁺]_i activated by 1 μm NAADP-AM in the absence and presence of bafilomycin A₁ (n = 5). C, mean Ca²⁺ transients activated by 1 μm NAADP-AM in the absence and presence of the NAADP antagonist Ned-19 (1 and 100 μm; 25-min incubation). D, mean values of the peak and sustained increases in [Ca²⁺]_i activated by 1 μm NAADP-AM in PASMCs with or without pretreatment with Ned-19 (n = six experiments for each group). *, significantly different compared with the control.

Previous studies in other cell types suggest that NAADP-induced Ca²⁺ release is amplified by cross-activation of InsP₃Rs and RyRs (20, 33). To examine the possible interactions between NAADP-induced Ca²⁺ signals and the InsP₃R- and RyR-gated Ca²⁺ stores, InsP₃R- and RyR-dependent Ca²⁺ release were either blocked separately using xestospongin C and ryanodine, respectively, or disabled simultaneously using the SERCA (sarco/endoplasmic reticulum Ca²⁺-ATPase) inhibitor thapsigargin. A 15-min pretreatment of PASMCs with 10 μm xestospongin C had no significant effect on the peak and sustained Ca²⁺ responses activated by NAADP-AM (Fig. 4A), suggesting that InsP₃R does not contribute to NAADP-dependent Ca²⁺ release in PASMCs. In contrast, inhibition of RyR with 50 μm ryanodine caused a significant reduction in the initial transient Ca²⁺ release (control, 244 ± 31 nm (n = 6), and ryanodine, 151 ± 15 nm (n = 7); p < 0.05) but did not affect the sustained phase of the Ca²⁺ response (Fig. 4B). Similar to RyR inhibition, depletion of the SR Ca²⁺ store with thapsigargin (10 μm) also attenuated the peak Ca²⁺ response (control, 278 ± 33 nm (n = 5), and ryanodine, 116 ± 17 nm (n = 6); p < 0.05), whereas the sustained Ca²⁺ increase elicited by NAADP-AM was unaltered (Fig. 4C). These results suggest that the initial transient increase in [Ca²⁺]_i was mediated by the cross-activation of RyRs on the SR and that the sustained Ca²⁺ response came from the NAADP-sensitive Ca²⁺ stores independent of SR Ca²⁺ release.

FIGURE 4.

Inhibition of SR Ca²⁺ stores upon Ca²⁺ release induced by NAADP-AM in PASMCs. A and B, mean traces of Ca²⁺ transients and mean values of Ca²⁺ responses activated by 1 μm NAADP-AM in PASMCs with (n = 6) or without (n = 7) pretreatment with xestospongin C (10 μm) for 15 min. C and D, mean traces of Ca²⁺ transients and mean values of Ca²⁺ responses activated by 1 μm NAADP-AM in PASMCs with (n = 6) or without (n = 7) pretreatment with ryanodine (50 μm) for 20 min. E and F, mean traces of Ca²⁺ transients and mean values of Ca²⁺ responses activated by 1 μm NAADP-AM in PASMCs with (n = 5) or without (n = 5) pretreatment with thapsigargin (10 μm) for 30 min. *, significantly different compared with the control.

NAADP-induced Local Ca²⁺ Events in PASMCs

Local Ca²⁺ signals were further examined at the subcellular level using confocal Ca²⁺ fluorescence microscopy in the line scan mode. Application of NAADP-AM to quiescent PASMCs activated robust local and global Ca²⁺ events. The Ca²⁺ response was heterogeneous, usually led by a diffuse increase in basal [Ca²⁺]_i, followed by an upsurge of Ca²⁺ sparks, which fused to generate a global increase in [Ca²⁺]_i, where Ca²⁺ sparks were no longer discernible (Fig. 5A, upper and middle panels). Repetitive local Ca²⁺ events were observed in some subcellular sites, and large repetitive non-inactivating Ca²⁺ bursts were also occasionally observed (Fig. 5A, lower panel). These Ca²⁺ bursts had a higher amplitude, a larger spatial spread, and a much longer duration compared with Ca²⁺ sparks (Fig. 6, A and B). However, they were not always associated with a regenerative global release. In 23 cells, NAADP-AM (0.5 μm) caused an average increase in the frequency of discernible sparks (excluding clusters) from 1.01 ± 0.26 to 2.81 ± 0.39 sparks/100 μm/s and an increase in global Ca²⁺ fluorescence of 0.99 ± 0.17 (ΔF/F₀) at the end of a 20-s recording. Consistent with observations in global Ca²⁺ transients, the NAADP-induced Ca²⁺ sparks and regenerative global Ca²⁺ release were significantly suppressed by 50 μm ryanodine (spark frequency of 0.68 ± 0.14 sparks/100 μm/s (n = 22 cells), p < 0.05; ΔF/F₀ = 0.45 ± 0.13, p < 0.05) (Fig. 7), indicating that the RyR-gated Ca²⁺ stores contributed significantly to both the local and global Ca²⁺ signals. However, the diffuse increase in basal [Ca²⁺]_i and Ca²⁺ bursts persisted in ryanodine-treated PASMCs (Fig. 7A, middle and lower panels), suggesting that they were Ca²⁺ signals originating from the TPCs.

FIGURE 5.

Activation of local Ca²⁺ events by NAADP-AM in PASMCs. A, representative confocal line scan images from three different cells showing local and global Ca²⁺ events elicited by NAADP-AM (0.5 μm). The upper and lower panels show the progressive increase in cytosolic [Ca²⁺], spark frequency, localized Ca²⁺ bursts, and global Ca²⁺ release. The lower panel illustrates a solitary Ca²⁺ burst that was not associated with global Ca²⁺ release. Blue circles denote the positions of discernible local Ca²⁺ events, red bars denote repetitive burst, and yellow bars indicate diffuse increases in cytosolic [Ca²⁺]. B, a combined figure showing the spark frequency (number of sparks/100 μm/cell) distribution and the averaged global Ca²⁺ transient (F/F₀; red line and symbols) generated from 23 different cells. The asterisk indicates the value is significantly lower (p < 0.05) than that of NAADP alone.

FIGURE 6.

Ca²⁺ sparks and Ca²⁺ bursts activated by NAADP-AM in PASMCs. A, the upper panel is a surface plot of Ca²⁺ fluorescence immediately after the addition of NAADP-AM showing Ca²⁺ sparks originating from two separate sites (marked 1 and 2) and the diffuse increase in cytosolic [Ca²⁺]. The lower panel shows the time course of ΔF/F₀ recorded at sites 1 and 2 and the mean ΔF/F₀ across the image. B, the upper panel is a surface plot of a Ca²⁺ burst activated by NAADP in a different cell. The lower panel shows the time course of ΔF/F₀ recorded at site 3.

FIGURE 7.

Activation of local Ca²⁺ events by NAADP-AM in ryanodine-treated PASMCs. A, representative confocal line scan images from three different cells. The upper and lower panels show the suppression of NAADP-induced Ca²⁺ sparks in the presence of ryanodine. The lower panel shows the occurrence of repetitive Ca²⁺ events in a single site, leading to a burst in a ryanodine-treated cell. B, a combined figure showing the spark frequency (number of sparks/100 μm/cell) distribution and the averaged global Ca²⁺ transient (F/F₀; red line and symbols) generated from 22 different cells. C, bar graph showing the averaged spark frequency recorded after the application of NAADP in PASMCs with (n = 22) or without (n = 23) pretreatment with ryanodine. D, bar graph showing the averaged global ΔF/F₀ recorded in PASMCs with (n = 22) or without (n = 23) pretreatment with ryanodine at the end of the line scan image (20 s).

The spatiotemporal characteristics of local Ca²⁺ events activated by NAADP-AM were further examined under steady-state conditions in a separate set of experiments in which Ca²⁺ sparks were recorded in either the absence or continuous presence of 1 μm NAADP-AM. The spark frequency was significantly higher in PASMCs continuously exposed to NAADP-AM compared with the control cells (control, 0.56 ± 0.08 sparks/100 μm/s (n = 71 cells), and NAADP, 2.18 ± 0.24 sparks/100 μm/s (n = 58 cells); p < 0.001). However, the spark amplitude (ΔF/F₀; control, 0.58 ± 0.01 (n = 436), and NAADP, 0.61 ± 0.02 (n = 438)), full duration at half-maximum (control, 59.9 ± 4.3 ms (n = 436), and NAADP, 46.0 ± 2.68 ms (n = 438)), and the spatial spread or full-width at half-maximum (control, 1.76 ± 0.14 μm (n = 436), and NAADP, 1.5 ± 0.04 μm (n = 438)) were not significantly different between the control and NAADP-AM-treated cells (Fig. 8). Hence, the spatiotemporal properties of local Ca²⁺ events activated by NAADP were indistinguishable from spontaneous Ca²⁺ sparks recorded under resting conditions. Our results therefore suggest that NAADP-dependent Ca²⁺ signaling in PASMCs consists of heterogeneous Ca²⁺ events, some of which are mediated by direct activation of NAADP receptors and others by cross-activation of RyRs.

FIGURE 8.

Frequency distribution of spatiotemporal properties of Ca²⁺ sparks recorded under steady-state conditions in the absence and presence of NAADP-AM (1 μm). The number of events is expressed as a function of amplitude (F/F₀) (A and B), duration (full duration at half-maximum (FDHM)) (C and D), and spatial spread (full-width at half-maximum (FWHM)) (E and F). The control group consisted of 424 sparks recorded from 71 cells, and the NAADP group consisted of 434 sparks recorded from 58 cells. The box plots show the median and range of each parameter.

NAADP-dependent Agonist-induced Ca²⁺ Response in PASMCs

To further examine the contribution of NAADP to the agonist-induced response, we compared the effects of NAADP receptor, RyR, and InsP₃R antagonists on the ET-1-induced Ca²⁺ response. ET-1 (10 nm) activated a biphasic Ca²⁺ response in PASMCs (peak Δ[Ca²⁺]_i = 265 ± 55 nm and sustained Δ[Ca²⁺]_i = 120 ± 16 nm, n = 8). Pretreatment of PASMCs with various concentrations of Ned-19 (0.01–1 μm) inhibited the peak Ca²⁺ response in a concentration-dependent manner without altering the sustained Ca²⁺ response (Fig. 9, A and B), suggesting that the peak Ca²⁺ response is mediated by a NAADP-dependent mechanism. Consistent with cross-activation of RyRs by Ca²⁺ signals from NAADP-sensitive channels, the peak Ca²⁺ response activated by ET-1 was significantly reduced by ryanodine (50 μm), and the remaining peak Ca²⁺ response was further inhibited by 1 μm Ned-19 (Fig. 9, C and D). It is well established in VSMCs that ET-1 binds to ET-A receptors, leading to activation of phospholipase C and production of InsP₃ to activate Ca²⁺ release. Inhibition of InsP₃R with 10 μm xestospongin C almost completely abolished the peak Ca²⁺ response of ET-1. The addition of Ned-19 did not further reduce the Ca²⁺ signal (Fig. 9, E and F). These results suggest that both functional NAADP receptors and InsP₃Rs are required for Ca²⁺ release triggered by ET-1. In contrast, the sustained Ca²⁺ response of ET-1 was mediated primarily by extracellular Ca²⁺ influx, which was unaffected by Ned-19, ryanodine, or xestospongin C (Fig. 9, B, D, and F) but was completely abolished by removing extracellular Ca²⁺ 100 s prior to the application of ET-1 (Fig. 10, A and B). Removal of extracellular Ca²⁺ did not affect the ET-1-induced peak Ca²⁺ response.

FIGURE 9.

Effects of the NAADP antagonist Ned-19, ryanodine, and xestospongin C on ET-1-induced Ca²⁺ response in PASMCs. A and B, mean traces and mean values of peak and sustained Ca²⁺ responses activated by ET-1 (10 nm) in the presence of various concentrations of Ned-19. The sustained Ca²⁺ response is the averaged value between 700 and 800 s. There were six to nine experiments in each group. C and D, mean traces and mean values of Ca²⁺ responses activated by ET-1 (10 nm) in the absence and presence of 50 μm ryanodine (Ryan; red trace) alone or with 1 μm Ned-19 (green trace). There were eight experiments in each group. E and F, mean traces and mean values of Ca²⁺ responses activated by ET-1 (10 nm) in the absence and presence of 10 μm xestospongin C (Xes; red trace) alone or with 1 μm Ned-19 (green trace). There were six to eight experiments in each group. *, significantly different (p < 0.05) from control cells.

FIGURE 10.

A and B, effect of removing extracellular Ca²⁺ on the ET-1-induced Ca²⁺ response in PASMCs. Shown are the mean traces and mean values of peak and sustained Ca²⁺ responses activated by ET-1 (10 nm) in 2 mm Ca²⁺-containing solution or in Ca²⁺-free solution (with 1 mm EGTA) (n = eight experiments for each group), which was added 100 s prior to the application of ET-1. C, mean peak of the change in the Ca²⁺ response elicited by 60 mm KCl in the absence (n = 6) and presence (n = 7) of 10 μm Ned-19. D, mean peak of the change in SOCE elicited by readmission of extracellular Ca²⁺ (2 mm) to PASMCs exposed to 10 μm thapsigargin for 20 min under Ca²⁺-free conditions in the absence (n = 9) and presence (n = 9) of 10 μm Ned-19. E, mean peak of the change in the Ca²⁺ response elicited by rapid application of 10 mm caffeine in the absence (n = 7) and presence (n = 7) of 10 μm Ned-19. F, mean peak of the change in [Ca²⁺]_i elicited by Bt₃-InsP₃/AM (20 μm) in the absence (n = 9) and presence (n = 8) of 10 μm Ned-19. The asterisk indicates significant difference from 2 mm Ca²⁺.

The specificity of Ned-19 was further verified by examining its effect on voltage-gated Ca²⁺ entry, store-operated Ca²⁺ entry (SOCE), and RyR- and InsP₃R-dependent Ca²⁺ release in PASMCs. Application of 60 mm KCl caused a significant increase in [Ca²⁺]_i through the activation of voltage-gated Ca²⁺ channels by membrane depolarization. The Ca²⁺ response was unchanged in PASMCs treated with Ned-19 (10 μm) for 20 min (control, 89 ± 19 nm (n = 6), and Ned-19, 69 ± 19 nm (n = 7)) (Fig. 10C). SOCE was evaluated by reintroduction of extracellular Ca²⁺ to PASMCs after SR Ca²⁺ stores were depleted with thapsigargin (10 μm) for 20 min in the absence of Ca²⁺ (34). The peak values of SOCE elicited in control and Ned-19 (10 μm)-treated cells were essentially the same (control, 229 ± 36 nm (n = 9), and Ned-19, 289 ± 59 nm (n = 9)) (Fig. 10D). The amplitudes of Ca²⁺ release activated by rapid application of caffeine (10 mm) were identical in the absence and presence of 10 μm Ned-19 (control, 1104 ± 167 nm (n = 7), and Ned-19, 996 ± 120 nm (n = 7)( (Fig. 10E), indicating that RyR-gated Ca²⁺ release was unaltered. Moreover, Ca²⁺ release activated by a membrane-permeant InsP₃ analog, 2,3,6-tri-O-butyryl-myo-inositol 1,4,5-triphosphate hexakis(acetoxymethyl) ester (Bt₃-InsP₃/AM; 20 μm; AG Scientific, Inc., San Diego, CA), was unaffected after a 20-min pretreatment with 10 μm Ned-19 (control, 119 ± 17 μm (n = 9), and Ned-19, 113 ± 20 μm (n = 8)) (Fig. 10F). These results confirm that Ned-19 is a highly specific NAADP antagonist and support our findings that the NAADP-dependent Ca²⁺ signaling pathway contributes significantly to the ET-1-induced Ca²⁺ response in PASMCs.

DISCUSSION

Recent studies have demonstrated that TPCs are the endolysosomal NAADP-sensitive channels, and they are widely expressed in major organs, including the brain, heart, kidney, liver, lung, intestine, spleen, thymus, ovary, and testis (6, 8). Here, we detected the mRNAs and proteins of TPC1 and TPC2 in endothelium-denuded rat sPAs, lPAs, and aortas. Preliminary screening also showed TPC1 and TPC2 expression in rat mesenteric, cerebral, and tail arteries (data not shown), suggesting that TPCs are expressed ubiquitously in VSMCs and may play essential roles in vascular functions. Quantitative RT-PCR data showed that the level of the TPC1 transcript is severalfold higher compared with TPC2 in PAs and aortas, indicating that TPC1 is the major endogenous NAADP channel in PASMCs. This is congruent with the observation that TPC1 is the predominant TPC subtype expressed in native human endothelial cells (35) and rat PC12 cells (7), as well as in the human cell lines SKBR3 and HEK293 (7, 12). TPC1 also accounts for most of the NAADP-induced Ca²⁺ response in SKBR3 and HEK293 cells (7, 12). In this study, both N-glycosylated and non-glycosylated TPC1 and TPC2 were found in native PASMCs. This is similar to heterologously expressed TPCs in several cell lines (6, 8, 36, 37). The different N-glycosylated forms of TPCs may reflect different stages of post-translational processing, but they could also be related to the regulation of TPC functions. It has been shown that the N-glycosylation sites of TPCs are located luminally, close to the pore-forming region in domain II (6, 37). Removal of N-glycosylation residues of TPC1 had no effect on its subcellular localization but greatly enhanced the NAADP-induced Ca²⁺ response (37). Because TPC1 is expressed in all stages of endolysosomes (including the recycling endosomes, early and late endosomes, and lysosomes) and TPC2 is confined more to the late endosomes and lysosomes (6–10), the different glycosylated forms of TPCs in PASMCs may be related to specific types of endolysosomal organelles, which have different luminal environments, such as pH and [Ca²⁺].

Cell-permeable NAADP-AM activates a robust biphasic global Ca²⁺ response in PASMCs. Both the initial transient and sustained components of the NAADP-induced Ca²⁺ response were independent of extracellular Ca²⁺ but were inhibited by depleting Ca²⁺ in acidic organelles with bafilomycin A₁ or using the specific NAADP antagonist Ned-19. This is consistent with endolysosomal Ca²⁺ release via TPCs (11, 17, 18, 21, 32). The initial component of the Ca²⁺ response is due to cross-activation of RyRs because it could be blocked by ryanodine and thapsigargin but not by xestospongin C. This supports the assertion that the NAADP-mediated Ca²⁺ signal is amplified by Ca²⁺-induced Ca²⁺ release in PASMCs (20–22). However, the presence of a prominent sustained component of the thapsigargin-insensitive but bafilomycin-sensitive Ca²⁺ release clearly suggests that endolysosomes are capable of generating sizable Ca²⁺ signals independent of SR Ca²⁺ release. The NAADP-mediated sustained Ca²⁺ release corresponds nicely with the sustained bafilomycin-sensitive Ca²⁺ transient activated by the integrin ligand GRGDSP peptide reported previously in PASMCs (23).

The heterogeneous local Ca²⁺ events activated by NAADP provide a close-up glimpse of the dynamic interactions of the NAADP-dependent Ca²⁺ signaling pathways. At least four distinctive Ca²⁺ events, namely the small diffuse rise in cytosolic [Ca²⁺], the spatially discernible Ca²⁺ sparks, the repetitive large localized Ca²⁺ bursts, and the regenerative Ca²⁺ releases, have been identified. The small diffuse increase in [Ca²⁺] activated by NAADP is the initial Ca²⁺ release directly from NAADP channels because it is insensitive to ryanodine and usually precedes the other Ca²⁺ events. The diffuse nature of the Ca²⁺ signal suggests that it arises from asynchronous TPCs and/or from Ca²⁺ stores with a low Ca²⁺ capacity. It has been shown that spatially discernible Ca²⁺ events, such as Ca²⁺ sparks, require concerted activation of multiple RyRs (38), whereas Ca²⁺ signals from individual RyRs (Ca²⁺ quarks) are submicroscopic (39, 40). Because the single channel conductance of TPCs (∼15 picosiemens) (11) is significantly smaller than that of RyRs (∼120 picosiemens) (41) and the Ca²⁺ content of endosomes and early lysosomes is lower than in the SR, Ca²⁺ release via individual asynchronous TPCs from endosomes is unlikely to be resolved by confocal imaging. NAADP also activates discernible local Ca²⁺ events, which are sensitive to ryanodine and have spatiotemporal properties indistinguishable from spontaneous Ca²⁺ sparks (25, 27, 42, 43). The gradual increase in spark frequency during the slow initial rise in cytosolic [Ca²⁺] could be related to an increase in SR Ca²⁺ loading as the result of continuous uptake of Ca²⁺ released from the acidic stores. This scenario has been demonstrated in guinea pig ventricular and atrial myocytes (44, 45).

Previous studies using conventional Ca²⁺ fluorescence microscopy showed that intracellular dialysis of NAADP into PASMCs activated bursts of Ca²⁺ release over a sizable region close to the perimeter of the cell (20–22). These Ca²⁺ bursts either stopped or eventually triggered global Ca²⁺ waves that could be blocked by ryanodine or thapsigargin. It was later proposed that lysosomes localized around the nucleus are closely associated with the perinuclear SR, where NAADP-sensitive channels and RyR3 form a highly organized trigger zone for NAADP-mediated Ca²⁺ signaling (21, 22). In this study, we observed repetitive localized Ca²⁺ bursts activated by NAADP. These Ca²⁺ bursts were insensitive to ryanodine, thus unrelated to cross-activation of RyRs. However, the spatiotemporal profile of these Ca²⁺ bursts is similar to the non-inactivation Ca²⁺ events we reported previously in the perinuclear regions of PASMCs (42), where lysosomes are abundant (21–23). The robust Ca²⁺ signal of these bursts suggests that a large number of NAADP channels are being activated simultaneously and that the Ca²⁺ content of the store is high. Because the Ca²⁺ content of mature lysosomes is the highest among endolysosomal organelles (46) and TPC2 is preferentially expressed in lysosomes (8), it is possible that Ca²⁺ bursts are Ca²⁺ signals coming primarily from TPC2 (and TPC1) of mature lysosomes. However, it is unclear how multiple TPCs are coordinated to generate repetitive Ca²⁺ bursts. There is no information on Ca²⁺-induced activation of TPCs as in the case of RyRs, besides evidence for TPC regulation by voltage, luminal pH, and Ca²⁺ (11, 12). The diffuse increase in cytosolic [Ca²⁺], Ca²⁺ sparks, and Ca²⁺ bursts activated by NAADP generally triggered regenerative global Ca²⁺ release, which could be abolished by ryanodine. However, the occurrence of Ca²⁺ bursts was not always associated with regenerative Ca²⁺ release. In fact, solitary Ca²⁺ bursts were frequently observed (Fig. 5A, middle and lower panels). This suggests that even though NAADP-induced Ca²⁺ signals are amplified by RyRs, the coupling between lysosomes and SR Ca²⁺ stores in PASMCs is loose, for example, compared with the coupling of L-type Ca²⁺ channels and RyRs in cardiac myocytes (47, 48) and the coupling of RyRs and Ca²⁺-activated K⁺ channels in cerebral arteries (49, 50).

Previous studies in systemic and pulmonary arteries suggested significant contributions of NAADP and lysosomal Ca²⁺ stores to the agonist-induced Ca²⁺ response (17, 18, 21, 23). This notion is supported by our finding that Ned-19 inhibits dose-dependently the initial transient phase of the ET-1-induced Ca²⁺ response. trans-Ned-19 is a highly specific NAADP antagonist. It inhibits NAADP-mediated Ca²⁺ release with an IC₅₀ of 10–70 nm (32, 51) and completely antagonizes the single channel activity of TPC2 at 1 μm (11), but it does not affect InsP₃- or cADPR-induced Ca²⁺ release at concentrations up to 100 μm (32, 51). Ned-19 at 10 μm also has no apparent effect on Ca²⁺ influx through voltage-gated Ca²⁺ channels activated by KCl, SOCE induced by thapsigargin, RyR-gated Ca²⁺ release triggered by caffeine, or Ca²⁺ release activated by Bt₃-InsP₃/AM in PASMCs. Complete inhibition of the transient Ca²⁺ response by a low concentration of Ned-19 (1 μm) therefore indicates that NAADP is a major mechanism for ET-1-induced Ca²⁺ release.

In contrast to the biphasic Ca²⁺ response activated by NAADP-AM, endogenous NAADP generated by ET-1 stimulation contributes predominantly to the initial peak Ca²⁺ response. The sustained phase of the ET-1-induced response is supported solely by extracellular Ca²⁺ influx because it is insensitive to Ned-19, ryanodine, and xestospongin C but is completely abolished by the removal of extracellular Ca²⁺. The transient nature of NAADP-dependent Ca²⁺ release could be related to the kinetics of ET-1-induced CD38 activation, production, and metabolism of NAADP, as well as desensitization of ET-1 receptors and inactivation of NAADP channels (52, 53), such that endogenously produced NAADP is no longer available or effective after prolonged ET-1 exposure. It is interesting that the initial Ca²⁺ release activated by ET-1 requires all three Ca²⁺ stores. The interdependence of RyR- and NAADP-gated Ca²⁺ stores is consistent with cross-activation of RyRs by Ca²⁺ released from NAADP channels, as demonstrated by the earlier NAADP-AM experiments. However, the complete inhibition of the peak Ca²⁺ response by xestospongin C suggests that InsP₃R also plays a permissive role in ET-1-induced Ca²⁺ release. Interactions between the three types of Ca²⁺ stores are very complex. First, InsP₃Rs are Ca²⁺-sensitive. They can be activated by Ca²⁺-induced Ca²⁺ release, and this process is modulated by InsP₃ binding (54). It has been shown in other cells that NAADP-mediated Ca²⁺ signals can be amplified by triggering further Ca²⁺ release from InsP₃Rs by Ca²⁺ priming of the SR (8, 10, 33, 55, 56). We have demonstrated previously that Ca²⁺ release from the InsP₃R can cross-activate RyRs in PASMCs (27), in a manner similar to NAADP and RyRs observed in this study. Furthermore, recent evidence obtained with HEK cells shows that lysosomes are closely associated with the InsP₃-gated SR, and they can selectively sequester released Ca²⁺ from InsP₃Rs (57). This process may facilitate lysosomal Ca²⁺ loading for subsequent release. All of these mechanisms may be operating in PASMCs during agonist stimulation when InsP₃Rs are sensitized by an increased level of InsP₃ and may allow InsP₃Rs to play a much larger role in the integrated Ca²⁺ release process compared with Ca²⁺ release activated by NAADP-AM alone. However, it is unclear whether InsP₃ or NAADP is the primary trigger for the integrated Ca²⁺ release event. The intricate interactions between these interdependent Ca²⁺ stores during agonist stimulation require further investigations.

It is also interesting that exogenously applied NAADP-AM activates a sustained component of Ca²⁺ release. The fact that the sustained response is not associated with RyR-mediated Ca²⁺ release and is relatively insensitive to Ned-19 suggests that these NAADP-sensitive stores are not coupled to RyRs. They are perhaps gated by NAADP channels with properties different from those activated by ET-1. This group of NAADP-sensitive stores could be endo/lysosomes gated by TPC1 or maybe even gated by channels other than TPCs. It has been suggested that the transient receptor potential channel TRPML1 is a NAADP-sensitive lysosomal Ca²⁺ release channel (58–60), but its role as a NAADP-sensitive channel is currently under dispute (61). Nevertheless, this group of NAADP-sensitive stores may participate in other signaling pathways serving different cellular functions. In fact, NAADP-dependent signaling is involved in many endolysosomal functions, such as regulation of lysosomal pH, endocytosis, lipid transport and storage, and autophagy (46, 56, 62), in addition to contributions to vascular reactivity.

In conclusion, we have characterized the expression of TPCs and the global and local Ca²⁺ signals mediated by NAADP in PASMCs. We found that TPC1, which is widely expressed in endosomes and lysosomes, is the major NAADP channel in PASMCs. Moreover, NAADP-induced subcellular Ca²⁺ signals are heterogeneous, reflecting Ca²⁺ release from different endolysosomal organelles cross-activating loosely coupled RyRs of the SR. NAADP also plays a crucial role in the agonist-stimulated Ca²⁺ release response through complex interactions with RyRs and InsP₃Rs. Depending on the physiological stimuli and conditions, these heterogeneous NAADP-mediated Ca²⁺ signals serve to regulate different endolysosomal functions in PASMCs.