Skip to main content
PLOS One logoLink to PLOS One
. 2013 Apr 23;8(4):e61814. doi: 10.1371/journal.pone.0061814

The Mitochondrial Genome of Elodia flavipalpis Aldrich (Diptera: Tachinidae) and the Evolutionary Timescale of Tachinid Flies

Zhe Zhao 1,2, Tian-juan Su 2, Douglas Chesters 2, Shi-di Wang 1, Simon Y W Ho 3, Chao-dong Zhu 2,*, Xiao-lin Chen 2,*, Chun-tian Zhang 1,*
Editor: Daniel Doucet4
PMCID: PMC3634017  PMID: 23626734

Abstract

Tachinid flies are natural enemies of many lepidopteran and coleopteran pests of forests, crops, and fruit trees. In order to address the lack of genetic data in this economically important group, we sequenced the complete mitochondrial genome of the Palaearctic tachinid fly Elodia flavipalpis Aldrich, 1933. Usually found in Northern China and Japan, this species is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees. The 14,932-bp mitochondrial genome was typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes. However, its control region is only 105 bp in length, which is the shortest found so far in flies. In order to estimate dipteran evolutionary relationships, we conducted a phylogenetic analysis of 58 mitochondrial genomes from 23 families. Maximum-likelihood and Bayesian methods supported the monophyly of both Tachinidae and superfamily Oestroidea. Within the subsection Calyptratae, Muscidae was inferred as the sister group to Oestroidea. Within Oestroidea, Calliphoridae and Sarcophagidae formed a sister clade to Oestridae and Tachinidae. Using a Bayesian relaxed clock calibrated with fossil data, we estimated that Tachinidae originated in the middle Eocene.

Introduction

Since the first insect mitochondrial genome (mitogenome) sequence was reported by Clary and Wolstenholme in 1985 [1], Diptera has remained the primary model system for mitogenomic research. This has included such diverse topics as species identification [2], [3], molecular evolution and phylogenetic inference [4]–[7], population structure and phylogeography [8]–[12], and genome structure and rearrangement [13]–[19]. Because of its small size and relative ease of sequencing, the number of mitogenome sequences has grown rapidly. As of January 2013, there are 64 complete or near-complete dipteran mitogenome sequences in GenBank, accounting for about 17.5% of the 365 insect mitogenomes that have been sequenced. In addition to the model organism Drosophila, most studies of Diptera have focused on taxa of medical and economic importance, such as the anopheline mosquitoes (Culicidae), which are vectors of malaria [20], [21]; the fruit flies Ceratitis capitata and Bactrocera spp. (Tephritidae), which are serious agricultural pests [11], [22]; the blowflies (Calliphoridae) and oestrid flies (Oestridae), which can cause myiasis [23], [24]; and leaf-miners (Agromyzidae), which are vegetable and horticultural pests [16], [25].

Tachinid flies have a worldwide distribution and comprise nearly 10,000 described species [29]. Despite Tachinidae being the second-largest dipteran family, the mitogenomes of only two species have been sequenced completely: Exorista sorbillans (Exoristinae, Exoristini) and Rutilia goerlingiana (Dexiinae; Rutiliini) [26], [27], [28]. They are natural enemies of many lepidopteran and coleopteran pests of forests, agricultural crops, and fruit trees, and thus are of economic importance. The Palaearctic tachinid fly, Elodia flavipalpis Aldrich, 1933 (Exoristinae, Goniini), is usually found in Northern China and Japan and is in the same subfamily, Exoristinae, as Ex. sorbillans [30], [31]. It is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees [32], [33]. The monophyly of Tachinidae is broadly supported by phylogenetic studies, but questions remain about its place in the superfamily Oestroidea, particularly the relationship between Tachinidae and several large families of Oestroidea [27], [28], [34]–[36]. There have been various studies of the divergence times of different groups of flies [7], [11], [12], [37], with a recent study placing the rapid radiation of Schizophora 65 mya in the Paleocene [28]. However, owing to the uncertain taxonomic position of Tachinidae in Oestroidea, the evolutionary timescale of tachinid flies has not been well studied.

Here we describe the complete mitochondrial genome of El. flavipalpis. The mitogenome contributes to discussion on the evolutionary relationships and taxonomic positions of the Tachinidae, puts forward a bold hypothesis regarding the timescale in which the family originated, and will aid further molecular research of related taxa through the findings on primer selection for atypical regions and the optimization of PCR experiments.

Materials and Methods

Specimen Collection, DNA Extraction, and DNA Amplification

Adult individuals of Elodia flavipalpis Aldrich, 1933 were collected directly from the pupae of their host species, the leaf-roller moth Spilonota lechriaspis Meyrick (Tortricidae). Moth pupae were collected at an organic apple orchard in Beijing, China, and hatched in the laboratory. The specimens were preserved in 99.5% ethanol and stored at −20°C for preservation of nucleic acids. DNA extraction from a single specimen was performed using the DNeasy Tissue kit (QIAGEN) following the manufacturer’s instructions.

The fragments were first amplified with the universal PCR primers from Simon et al. [38] and some dipteran-specific primers from Han [39] and Weigl et al. [24] (Table 1). Primer pairs for amplification of the mitochondrial control region were modified according to Lessinger et al. [40] and Oliveira et al. [41]. Species-specific primers were designed using Primer Premier 6.0 software [42], based on the initial fragments aligned with sequences from three closely related species, Ex. sorbillans, Calliphoridae spp., and Oestridae spp. (Table 2). PCR products covering the remaining regions of the mitogenome were amplified using universal and species-specific primers (Table 1). The entire genome of El. flavipalpis was amplified in 21 fragments. All of the primers were synthesized by Shanghai Sangon Bio-technology Co., Ltd (Beijing, China).

Table 1. Details of mitogenome sequencing protocols used in this study.

Region Primer pairs (F/R) Sequence (forward and reverse) 5′→3′ Size (bp) PCR conditions (annealing/extension)
ND2 TM-J-206a/N2-N-732a GCTAA-ATAAAGCTAACAGGTTCAT/GAAGTTTGGTTTAAACCTCC ∼500 49°C, 45 s/72°C, 1 min
ND2-CO1 N2-J-283d/C1-N-1740d CATGACTAGGAACTTGAATAGG/AGAACTAAAGCAGGAGGTAA ∼1500 47°C, 45 s/68°C, 4 min
CO1 TY-J-1460a/C1-N-2191a TACAATTTATCGCCTAAA-CTTCAGCC/CCCGGTAAAATTAAAATATAAACTTC ∼700 49°C, 45 s/72°C, 1 min
CO1 C1-J-1751a/TL2-N-3014a GGATCACCTGATATAGCATTCCC/TCCAATGCACTAATCTGCCATATTA ∼1200 52°C, 30 s/72°C, 1 min
CO1-CO3 Cl-J-2183a/C3-N-5460a CAACATTTATTTTGATTTTTTGG/TCAACAAAGTGTCAGTATCA ∼3200 44.5°C, 45 s/68°C, 5 min
ATP8 C2-J-3530d/A6-N-4493d AAGTTGATGGAACTCCTGGA/GTAAGTCGAACTGCTAATGT ∼950 49°C, 45 s/72°C, 1 min, 50 s
CO3-ND3 C3-J-5005d/E-revb CTCCATCAGTTGAATTAGGTGCTA/AGTGATAAGCCTCTTTTTGGCTTC ∼1050 49°C, 45 s/72°C, 1 min, 50 s
ND5 F-fwb/N5-N-7707d CATTTGATTTGCATTCAAAAAGTATTG/AGGATGAGATGGATTAGGAT ∼1800 45°C, 45 s/68°C, 3 min
ND5-ND4 H-fwb/N4-N-8718a GAAACAGGAGTAGGAGCTGCTATAGC/GCTTATTCATCGGTTGCTCA ∼1200 53°C, 45 s/72°C, 1 min, 50 s
ND4 I-fwb/N4-N-8924a CAATTCTATTAATTAAAGAAATTTCTCC/AAAGCTCATGTTGAAGCTCC ∼550 48°C, 45 s/72°C, 1 min, 50 s
ND4 N4-J-8614d/N4-N-9061d TGAGCAACAGAAGAATAAGC/ATCAACCAGAACGATTACAAG ∼400 47°C, 45 s/72°C, 1 min, 50 s
ND4-ND6 N4-J-8944a/I-revb GGAGCTTCAACATGAGCTTT/CTTATTTTTGATTTACAAGACCAATG ∼850 49°C, 45 s/72°C, 1 min, 20 s
ND4- CYTB N4-J-9511d/CB-N-11218d CTAAAATTGATAACCCTAAAGC/TCAGGTTGAATGTGAATTGG ∼1700 45°C, 45 s/68°C, 3 min
CYTB-ND1 CB-J-10933a/N1-N-12051a TATGTACTACCATGAGGACAAATATC/GATTTTGCTGAAGGTGAATCAGA ∼1100 50.5°C, 45 s/72°C, 1 min, 50 s
ND1- lrRNA N1-J-11891d/16S-N-12855d ATCCTCCTCTTCTATATTCAAT/GATTGCGACCTCGATGTT ∼950 48°C, 45 s/72°C, 1 min, 30 s
lrRNA LR-J-12883c/LR-N-13398a CTCCGGTTTGAACTCAGATC/CGCCTGTTTATCAAAAACAT ∼550 47°C, 45 s/72°C, 2 min
lrRNA - srRNA LR-J-12888d/SR -N-14373d ACGCTGTTATCCCTAAAGTA/AATCCACGATGAACCTTACT ∼1500 45°C, 45 s/68°C, 3 min
srRNA SR-J-14233a/SR-N-14756a AAGAGCGACGGGCGATGTGT/GACAAA-ATTCGT-GCCAGCAGT ∼500 50°C, 45 s/72°C, 1 min, 30 s
srRNA SR-J-14612a/SR-N-14922a AGGGTATCTAATCCTAGTTT/AAGTTTTATT-TTGGCTTA ∼300 43°C, 45 s/72°C, 1 min
srRNA-ND2 SR-J-14646e/N2-N-757d GCTGGCACAAATTAAATC/GCTGCAAGTATTCAACTTAAATG ∼1150 43°C, 1 min/68°C, 6 min
Control region SR-J-14646e/N2-N-309f GCTGGCACAAATTAAATC/CTAAACCTATTCAAGTTCC ∼650 42°C, 1 min/68°C, 6 min

Note: CO1, CO2, CO3: cytochrome c oxidase subunit 1, 2, and 3 genes; CYTB: cytochrome b gene; ATP6, ATP8: ATP synthase subunit 6 and 8 genes; ND1, ND2, ND3, ND4, ND4L, ND5, ND6: NADH dehydrogenase subunit 1–6 and 4L genes. lrRNA, srRNA: large and small ribosomal RNA.

a

Primers from Simon et al. [27].

b

Primers from Weigl et al. [21].

c

Primers from Han [28].

d

Primers designed specially for this genome, using the nomenclature of Simon et al. [27].

e

Primers modified from Lessinger et al. [29]. f Primers modified from Oliveira et al. [30].

Table 2. Summary of mitogenome sequences from Diptera and an outgroup species from Lepidoptera.

Species Family Length (bp) Accession Number Reference
Elodia flavipalpis Tachinidae 14932 NC_018118 Present study
Exorista sorbillans Tachinidae 14960 NC_014704 Shao et al., 2012
Dermatobia hominis Oestridae 16360 NC_006378 Azeredo-Espin et al.,2004
Hypoderma lineatum Oestridae 16354 NC_013932 Weigl et al., 2010
Chrysomya putoria Calliphoridae 15837 NC_002697 Junqueira et al., 2004
Cochliomyia hominivorax Calliphoridae 16022 NC_002660 Lessinger et al., 2000
Lucilia sericata Calliphoridae 15939 NC_009733 Stevens et al., 2008
Sarcophaga impatiens Sarcophagidae 15169 NC_017605 Nelson et al., 2012
Haematobia irritans Muscidae 16078 NC_007102 Oliveira et al., 2008
Drosophila littoralis Drosophilidae 16017 NC_011596 Sorokina et al., 2010
Drosophila sechellia Drosophilidae 14950 NC_005780 Ballard, 2000 a
Drosophila simulans Drosophilidae 14927 NC_005781 Ballard, 2000 a
Drosophila mauritiana Drosophilidae 14964 NC_005779 Ballard, 2000 b
Drosophila melanogaster Drosophilidae 19517 NC_001709 Lewis et al., 1995
Drosophila yakuba Drosophilidae 16019 NC_001322 Clary & Woolstenholme, 1985
Drosophila pseudoobscura Drosophilidae 14914 NC_018348 Torres et al., 2009
Liriomyza sativae Agromyzidae 15551 NC_015926 Yang et al., 2011
Liriomyza trifolii Agromyzidae 16141 NC_014283 Wang, 2010
Liriomyza bryoniae Agromyzidae 16183 NC_016713 Yang et al. unpublished
Liriomyza huidobrensis Agromyzidae 16236 NC_016716 Yang et al. unpublished
Fergusonina taylori Fergusoninidae 16000 NC_016865 Nelson et al., 2011
Ceratitis capitata Tephritidae 15980 NC_000857 Spanos et al. 2000
Bactrocera carambolae Tephritidae 15915 NC_009772 Ye et al., 2010
Bactrocera dorsalis Tephritidae 15915 NC_008748 Yu et al., 2007
Bactrocera minax Tephritidae 16043 NC_014402 Zhang et al.,2010
Bactrocera oleae Tephritidae 15815 NC_005333 Nardi et al.,2003
Bactrocera papayae Tephritidae 15915 NC_009770 Ye et al., 2010
Bactrocera philippinensis Tephritidae 15915 NC_009771 Ye et al.,2010
Bactrocera tryoni Tephritidae 15925 NC_014611 Nardi et al.,2010
Bactrocera cucurbitae Tephritidae 15825 NC_016056 Wu,P.-F. unpublished
Simosyrphus grandicornis Syrphidae 16141 NC_008754 Cameron et al., 2007
Trichophthalma punctata Nemestrinidae 16396 NC_008755 Cameron et al., 2007
Cydistomyia duplonotata Tabanidae 16247 NC_008756 Cameron et al., 2007
Rhopalomyia pomum Cecidomyiidae 14503 NC_013063 Beckenbach and Joy, 2009
Mayetiola destructor Cecidomyiidae 14759 NC_013066 Beckenbach and Joy, 2009
Culicoides arakawae Ceratopogonidae 18132 NC_009809 Matsumoto et al.,2009
Aedes aegypti Culicidae 16655 NC_010241 Behura et al., 2011
Aedes albopictus a Culicidae 16665 NC_006817 Ho, C.-M. et al. unpublished
Anopheles darlingi Culicidae 15386 NC_014275 Moreno et al., 2010
Anopheles funestusb Culicidae – NC_008070 Krzywinski et al., 2006
Anopheles gambiae Culicidae 15363 NC_002084 Beard et al., 1993
Anopheles quadrimaculatus Culicidae 15455 NC_000875 Mitchell et al., 1993
Anopheles albitarsis Culicidae 15413 HQ_335344 Krzywinski et al., 2011
Anopheles deaneorum Culicidae 15424 HQ_335347 Krzywinski et al., 2011
Anopheles janconnae Culicidae 15425 HQ_335348 Krzywinski et al., 2011
Anopheles oryzalimnetes Culicidae 15422 HQ_335345 Krzywinski et al., 2011
Culex pipiens Culicidae 14856 NC_015079 Atyame et al., 2011
Culex quinquefasciatus Culicidae 15587 NC_014574 Behura et al., 2011
Chironomus tepperi Chironomidae 15652 NC_016167 Beckenbach, 2012
Trichocera bimacula Trichoceridae 16140 NC_016169 Beckenbach, 2012
Paracladura trichoptera Trichoceridae 16143 NC_016173 Beckenbach, 2012
Sylvicola fenestralis Anisopodidae 16234 NC_016176 Beckenbach, 2012
Bittacomorphella fenderiana Ptychopteridae 15609 JN_861745 Beckenbach, 2012
Ptychoptera sp. Ptychopteridae 15214 NC_016201 Beckenbach, 2012
Protoplasa fitchii Tanyderidae 16154 NC_016202 Beckenbach, 2012
Cramptonomyia spenceri Pachyneuridae 16274 NC_016203 Beckenbach, 2012
Arachnocampa flava Keroplatidae 16923 NC_016204 Beckenbach, 2012
Tipula abdominalis Tipulidae 14566 JN_861743 Beckenbach, 2012
Spilonota lechriaspis Tortricidae (Lepidoptera) 15368 NC_014294 Zhao et al., 2010

Note ‘−’ not available (unknown or incomplete data).

In order to reduce time required for sequencing and walking, we used both standard and nested PCR techniques. The PCR conditions for all of the fragments are shown in Table 1. The control region was amplified using a nested PCR approach. The “external” primers SR-J-14646 and N2-N-757 were used for the first step of the PCR (long target), followed by nested amplification (specific target) with the “internal” primers SR-J-14646 and N2-N-309. All of the fragments were amplified using TaKaRa LA Taq (Takara Co., Dalian, China), and performed on an Eppendorf Mastercycler gradient in 50 µl reaction volumes. The reaction volume consisted of 25.5 µl of sterilized distilled water, 5 µl of 10× LA PCR Buffer II (Takara), 5 µl of 25 mM MgCl2, 8 µl of dNTPs Mixture, 1.5 µl of each primer (10 µM), 3 µl of DNA template, and 0.5 µl (1.25 U) of TaKaRa LA Taq polymerase (Takara).

Sequence Assembly and Annotation

The PCR products were detected via electrophoresis in 1% agarose gel, purified using the 3S Spin PCR Product Purification Kit, and sequenced directly with the ABI-377 automatic DNA sequencer. All amplified products were sequenced directly using upstream and downstream primers from both directions. Sequencing was performed using ABI BigDye ver 3.1 dye-terminator sequencing technology and run on ABI PRISM 3730 × 1 capillary sequencers. Raw sequences were manually checked and assembled using the software BioEdit version 7.0.9.0 [43] and SeqMan (DNAStar, Steve ShearDown, 1998–2001 version reserved by DNASTAR Inc., Madison, Wisconsin, USA).

Protein-coding and ribosomal RNA genes and gene boundaries were identified by BLAST search (http://www.ncbi.nlm.nih.gov/BLAST) and by comparison with sequences from other brachyceran species. The genomic positions and secondary structures of 20 of the 22 transfer RNAs (tRNAs) were identified by tRNAscan-SE software v.1.21 [44], with the remaining two (tRNAArg and tRNASer(AGN)) identified by visual inspection of genome sequence followed by inference using RNAstructure Ver.5.3 [45] (Table 3). Nucleotide composition was calculated using MEGA 4.1 [46]. Sequence data have been deposited in the NCBI database [GenBank: NC_018118].

Table 3. Organization of the mitogenome of Elodia flavipalpis Aldrich.

Gene Strand Locationa Length(bp) IGNb CodonStart/Anti Stop AT%
tRNAIle + 1–65 65 −3 GAT 77.0
tRNAGln − 63–131 69 6 TTG 86.2
tRNAMet + 138–206 69 0 CAT 71.0
ND2 + 207–1217 1011 −2 ATT TAA 83.4
tRNATrp + 1216–1283 68 −8 TCA 80.9
tRNACys − 1276–1342 67 2 GCA 74.6
tRNATyr − 1344–1408 65 6 GTA 80.0
CO1 + 1415–2953 1539 −5 TCG TAA 72.9
tRNALeu(UUR) + 2949–3014 66 4 TAA 77.3
CO2 + 3019–3706 688 0 ATG T 77.0
tRNALys + 3707–3777 71 −1 CTT 69.0
tRNAAsp + 3777–3847 71 0 GTC 87.4
ATP8 + 3848–4012 165 −7 ATT TAA 86.8
ATP6 + 4006–4683 678 −1 ATG TAA 78.4
CO3 + 4683–5471 789 6 ATG TAA 73.0
tRNAGly + 5478–5542 65 0 TCC 83.1
ND3 + 5543–5896 354 0 ATT TAA 82.2
tRNAAla + 5897–5963 67 0 TGC 79.1
tRNAArg + 5966–6027 62 11 TCG 72.6
tRNAAsn + 6039–6103 65 0 GTT 78.5
tRNASer(AGN) + 6104–6171 68 0 GCT 75.0
tRNAGlu + 6172–6233 62 18 TTC 92.0
tRNAPhe − 6252–6316 65 0 GAA 80.0
ND5 − 6317–8036 1720 15 ATT T 80.9
tRNAHis − 8052–8115 64 1 GTG 84.4
ND4 − 8117–9455 1339 −7 ATG T 81.4
ND4L − 9449–9745 297 2 ATG TAA 84.5
tRNAThr + 9748–9812 65 0 TGT 86.1
tRNAPro − 9813–9877 65 2 TGG 81.5
ND6 + 9880–10404 525 −1 ATT TAA 86.7
CYTB + 10404–11540 1137 −2 ATG TAG 75.9
tRNASer(UCN) + 11539–11605 67 16 TGA 82.1
ND1 − 11622–12569 948 1 TTG TAA 81.1
tRNALeu(CUN) − 12571–12635 65 0 TAG 81.6
lrRNA − 12636–13972 1337 0 84.6
tRNAVal − 13973–14044 72 0 TAC 80.6
srRNA − 14045–14827 783 0 81.7
Control region − 14828–14932 105 0 92.4

Note:

a

Gene positions with parentheses indicate the genes encoded by major strand; plus (+) and minus (−) symbols represent major and minor strands, respectively.

b

IGN: Intergenic nucleotide, minus indicates overlapping between genes. tRNAX: where X is the abbreviation of the corresponding amino acid.

Phylogenetic Analysis

We conducted a phylogenetic analysis using all of the mitogenomes of Diptera that were available as of August 2012 (58 species from 33 genera and 23 families), along with a lepidopteran outgroup species (Spilonota lechriaspis) (Table 2). To assess the impact of saturation at third codon positions, we constructed two mitochondrial sequence alignments. The first dataset consisted of all 13 protein-coding genes and the 2 ribosomal RNA genes. The second dataset was the same, except for the exclusion of the third codon sites from the protein-coding genes. Sequences of protein-coding genes were translated into amino acid sequences, aligned using ClustalX v2.0.9 [47], then back-translated. Ribosomal RNA genes were also aligned using ClustalX, and refined by eye to account for their secondary structures. The GTR+I+G model was selected by the Akaike information criterion for both datasets in MODELTEST v.3.7 [48]. Maximum likelihood (ML) and Bayesian methods were used for phylogenetic analysis. For the ML analyses, we used RAxML v7.0.4 [49] with 1000 bootstrap replicates. The Bayesian phylogenetic analysis was performed using MrBayes v3.1.2. [50], with posterior distributions estimated using Markov chain Monte Carlo (MCMC) sampling. We conducted two independent runs, each with one cold and three heated chains. Samples were drawn every 100 MCMC steps over a total of 2 million steps. The first 25% of steps were discarded as burn-in.

Divergence times were estimated using the Bayesian phylogenetic method implemented in BEAST v.1.6.2 [51]. Rate variation among lineages was modelled using an uncorrelated lognormal relaxed clock [52], with the tree prior generated using a Yule speciation model. Based on previous research on divergence times in Diptera [7], [11], [12], [28], [37], we implemented fossil-based minimum ages for three clades and added one maximum age constraint. The origin of Diptera was assumed to be between 270 and 230 million years ago (mya) [28], [53]. We also specified minimum age constraints of 195 mya for Brachycera and 64 mya for Schizophora [53]–[55]. Posterior estimates of parameters were obtained by MCMC sampling. Samples were drawn every 1000 steps over a total of 10 million steps. Tracer v1.5 [56] was used to confirm that the effective sample size of each parameter exceeded 100. The maximum-clade-credibility tree was calculated using TreeAnnotator v1.6.2, with the node times scaled to match mean posterior estimates.

Results and Discussion

Genome Organization

The 14932 bp mitogenome of El. flavipalpis contained all 37 genes usually present in bilaterians: 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes (Figure 1, Table 3). The gene order corresponds to the typical pattern of brachyceran flies, such as Drosophila spp. [1], [22], [57]. Gene order is typically conserved in brachyceran flies, except for a few species in which additional tRNAs have been detected in the control region (Liriomyza trifolii, Chrysomya spp., and Cydistomyia duplonotata), and Dermatobia hominis, in which an additional tRNAVal is found on the minor strand. In contrast, there is an elevated number of tRNA rearrangements in nematoceran flies [13], [14], [20], [21].

Figure 1. Mitochondrial genome map of Elodia flavipalpis.

Figure 1

Numbers indicate non-coding nucleotides between genes (positive values) or gene overlap (negative values). Arrows indicate orientation on (+) strand (clockwise) or (−) strand (counterclockwise).

In total, there were 37 overlapping nucleotides between neighboring genes at 10 locations, with the length of overlapping sequence ranging from 1 to 7 bp. Excluding the control region, there were 90 intergenic nucleotides at 12 locations, in stretches ranging from 1 to 18 bp (Table 3).

As with other insects, the nucleotide composition of the El. flavipalpis mitogenome was biased towards A and T. The overall A+T content was 79.97%, slightly higher than that of Ex. sorbillans (78.4%) and R. goerlingiana (77.7%), and is among the highest of the sequenced dipteran species (67.2%–85.2%; Table S1). A detailed comparison of nucleotide composition, AT-skew, and GC-skew between the two closely related species, El. flavipalpis, Ex. sorbillans and R. goerlingiana, is given in Table 4.

Table 4. Comparison of mitochondrial nucleotide composition in three tachinid flies.

Region A+T % G+C % AT-skew GC-skew
El. fla Ex. sor R. goe El. fla Ex. sor R. goe El. fla Ex. sor R. goe El. fla Ex. sor R. goe
Whole mitogenome 79.9 78.4 77.7 20.1 21.5 22.3 0.00 0.02 0.04 −0.15 −0.17 −0.23
Protein-coding genes 79.1 77.7 76.2 20.9 22.3 23.8 −0.14 −0.15 −0.15 0.04 0.00 0.00
1st codon position 71.2 70.4 70.1 28.8 29.6 29.9 −0.19 −0.18 −0.07 0.12 0.09 0.22
2nd codon position 79.1 78.0 67.0 20.9 22.0 33.0 −0.19 −0.20 −0.08 −0.17 −0.16 −0.16
3rd codon position 87.1 84.7 91.2 12.9 15.3 8.8 −0.07 −0.07 −0.04 0.19 0.07 −0.16
tRNA genes 79.8 76.8 77.2 20.2 23.2 22.8 0.03 0.02 0.02 −0.11 −0.11 −0.12
lrRNA 84.6 83.2 82.6 15.5 16.8 17.4 0.00 0.05 0.05 −0.30 −0.30 −0.34
srRNA 81.7 79.4 80.5 18.3 20.5 19.5 −0.04 0.01 0.00 −0.30 −0.30 −0.28
Control region 92.4 98.1 92.6 7.7 1.9 7.4 0.11 −0.05 0.11 0.74 1.00 −0.71

Note: El. fla indicates Elodia flavipalpis, Ex. sor indicates Exorista sorbillans and R. goe indicates Rutilia goerlingiana. The A+T and G+C biases of protein-coding genes were calculated by AT-skew = [A−T]/[A+T] and GC-skew = [G−C]/[G+C], respectively.

Protein-coding Genes and Nucleotide Composition

Thirteen protein-coding genes were identified in the mitogenome of El. flavipalpis, with characteristics similar to those of other dipteran species (Table S1). The average A+T content across all protein-coding genes was 79.1%, similar to that of Ex. sorbillans (77.7%) and R. goerlingiana (76.2%). Table 4 shows the AT-skews and CG-skews of the three codon positions for El. flavipalpis, Ex. sorbillans and R. goerlingiana. In all three of these species, the A+T content of the third codon positions (87.1%, 84.7%, and 91.2%, for El. flavipalpis, Ex. sorbillans, and R. goerlingiana, respectively) was higher than those of the first (71.2%, 70.4%, and 70.1) and second codon positions (79.1%, 78.0%, and 67%). This result is in agreement with studies of other dipteran taxa (Table S1). AT-skew and GC-skew were used to analyse the biases in nucleotide composition. The A content was slightly lower than the T content at all three codon positions, but almost equal over the whole genome.

Except for CO1 and ND1, all of the protein-coding genes have one of the common start codons for mitochondrial DNA, ATG, ATA, or ATT (Table 3). The start codon TCG (Serine) in CO1 is also found in Ex. sorbillans, R. goerlingiana, and other Oestroidea species (Table 2). CO1 commonly uses nonstandard start codons in many other flies [5], [16], [20], [58], [59]. Within Diptera, the start codon TTG (Leucine) in ND1 of El. flavipalpis is same as that in Dermatobia hominis (Oestroidea). Of the 13 protein-coding genes, CO2, ND4, and ND5 have incomplete stop codons and terminate with only a single thymine. Similar structural features have also been described for the mitogenomes of other dipteran taxa [4], [5]. In addition, CYTB terminates with a complete stop codon TAG, whereas TAA or only a single thymine is utilized in some other fly species.

Other Regions of the Mitogenome

The mitogenome of El. flavipalpis bears all of the 22 standard tRNAs found in metazoan mitogenomes (Figure 1, Table 3). The total length of the tRNA genes is 1463 bp, with individual genes ranging from 62 to 71 bp and with A+T contents from 71% (tRNAMet) to 92% (tRNAGlu). With the exception of tRNASer (AGN), all tRNAs possess the typical clover-leaf secondary structure (Figure 2). The DHU-arm of tRNASer (AGN) is entirely absent, as observed in other insects [20], [24], [33], [60]. In the secondary structures, the lengths of the amino acid acceptor arms (7 bp), anticodon arms (5 bp), and loops (7 bp) are relatively conserved, while the TψC loop (3–10 bp) is more variable. There are 21 mismatched base pairs in the tRNA genes, 14 of which are weak G–U matches (nine sites in DHU arms, three sites in amino acid acceptor arms, and two sites in anticodon arms). The other seven include U–U (5 bp), C–U (1 bp), and A–A (1 bp).

Figure 2. Putative secondary structures of tRNAs found in the mitochondrial genome of Elodia flavipalpis.

Figure 2

All tRNAs can be folded into the usual clover-leaf secondary structure.

The lengths of the lrRNA and srRNA genes are 1337 bp and 783 bp, respectively. Both are encoded on the minor strand and the ends of those genes were assumed to be at the boundaries of the flanking genes [61]. As in other dipteran species, the lrRNA gene is flanked by tRNALeu (CUN) and tRNAVal, while the srRNA gene is between tRNAVal and the control region. Their A+T contents were 84.6% for lrRNA and 81.7% for srRNA, which are within the range of other dipteran species (Table S1).

The length of the control region of El. flavipalpis is identical to that of Ex. sorbillans (105 bp), the shortest among the sequenced dipteran mitogenomes. It has an A+T content of 92.38%, which is lower than that of Ex. sorbillans (98.1%) and R. goerlingiana (92.6%) but higher than those of most other dipteran species. Owing to its short length, there is no distinct duplicate fragment found in this region. It should be noted that all three of the sequenced tachinid mitogenomes bear a control region that is shorter than those of most known in flies [62], [63].

Phylogenetic Analysis

The phylogenies estimated using likelihood and Bayesian approaches were similar for both of the datasets that were analysed (Figures 3, 4, 5 and 6). Various higher-level relationships were consistent across the analyses. The monophyly of Brachycera, Cyclorrhapha, and Calyptratae were consistently supported (posterior probability = 1.00, ML bootstrap = 100), as was the monophyly of Schizophora (posterior probability = 1.00, ML bootstrap = 55, 66). The monophyly of superfamily Oestroidea has been widely accepted and has traditionally received good support from morphological characters [64]–[67]. Here we add support from the Bayesian analysis of mitochondrial DNA sequences that Oestroidea is a sister group of Muscidae (posterior probability = 1.00). However, our ML analyses of both datasets placed the family Muscidae within Oestroidea, although support was not high (bootstrap = 70, 60).

Figure 3. Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

Figure 3

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Figure 4. Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

Figure 4

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees.

Figure 5. Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

Figure 5

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Figure 6. Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

Figure 6

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees.

In Oestroidea, all four families are monophyletic, and Calliphoridae+Sarcophagidae was inferred as a sister group to Oestridae+Tachinidae. This result is similar to that obtained in analyses of morphology [34] and of 18S and 16S ribosomal DNAs [35]. The tree topology is broadly similar to that inferred from whole mitogenomes by Nelson et al. [27], except that Oestridae and a subfamily of Calliphoridae (Polleninae) are nested within Tachinidae. However, Nelson et al. [27] focused on the relationships within Calliphoridae, while species from other families of Oestroidea were only used as an outgroup in the analysis.

Our phylogenetic estimate differs from that obtained by Kutty et al. [36] in their analysis of four nuclear and four mitochondrial genes. They inferred the relationships (((Tachinidae, Oestridae), Calliphoridae), Sarcophagidae), with both Calliphoridae and Tachinidae paraphyletic (Oestridae is nested within Tachinidae, as are some calliphorid subfamilies). In contrast, Wiegmann et al. [28], considered Tachinidae to be more closely related to Calliphoridae, and as a sister taxon to Oestridae and Sarcophagidae. Owing to the morphological similarities shared by these four families, it is difficult to distinguish among these phylogenetic hypotheses using morphological data. The disparities among the molecular estimates are probably due to differences in the taxa sampled and the data being analysed. Kutty et al. [36] and Wiegmann et al. [28] used both nuclear and mitochondrial DNA sequences, but most were only partial sequences. Moreover, most of the Oestroidea species analysed by Wiegmann et al. [28] were represented by only two or three genes. Given that our analysis involved a larger and more complete data set, we believe that our results are more strongly supported.

The primary difference among the four phylogenetic trees here is in the placement of the superfamily Opomyzoidae, which consists of the families Furgusoninidae and Agromyzidae. It is closer to Drosophoridae in the Bayesian analysis (posterior probability = 1.00), but its position is unstable in the ML analysis (bootstrap = 55, 27). A similar result was obtained by Wiegmann et al. [28]. Another difference is seen in the placement of Bibionomorpha (Nematocera), which is the closest group to Brachycera in both of the trees inferred without third codon positions, but is unstable in the tree inferred from all three gene positions. It is even non-monophyletic in the Bayesian analysis, hinting at the possible negative phylogenetic effects of including third codon sites. The placement of Cecidomyiidae is problematic, which is also indicated by the long branch leading to this group. The two Cecidomyiidae species have undergone substantial reduction in mitogenome size, which results in their apparent distinctiveness and causes problems for sequence alignment. With additional sampling in Cecidomyiidae, future studies will be better equipped to reconstruct the molecular evolution of these mitochondrial genomes.

Estimates of Divergence Times

We used a Bayesian relaxed clock to estimate the evolutionary timescale of Brachycera (Figure 7). Our analysis suggests that the last common ancestor of extant Brachycera existed in the early Jurassic (∼199 mya) (95% credibility interval: 195.9–206.7 mya). The schizophoran radiation took place during the late Cretaceous (∼84 mya), and the clade Calyptratae containing Oestroidea and Muscidae (nested in Acalyptrata) split in the early Eocene (∼60 mya) (95% credibility interval: 45.6–91.1 mya). These results are consistent with evidence from a number of amber specimens from Acalyptrata and Calyptratae [68]. Subsequently, Oestroidea divided into two groups in the middle Palaeocene (∼56 mya) (95% credibility interval (CI): 42.7–85.0 mya). The split of Tachinidae with Oestridae is estimated to have occurred in the early Eocene (∼48 mya) (95% CI: 37.8–77.9 mya), with this clade becoming the most speciose in Brachycera. Finally, the two tachinid flies El. flavipalpis and Ex. sorbillans are estimated to have separated in the early Oligocene (∼33 mya) (95% CI: 15.5–60.1 mya).

Figure 7. Evolutionary timescale for Diptera inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

Figure 7

Numbers at nodes indicate mean estimated divergence times (in mya) and node bars indicate 95% credibility intervals. Red circles indicate the three nodes used for calibration. The yellow circle indicates the hypothesised origin of tachinid flies. In the geological time scale: Pala indicates Palaeocene; Eoce indicates Eocene; Oligo indicates Oligocene; Mioc indicates Miocene; P indicates Pliocene; Q indicates Quaternary.

Our estimates suggest that the most recent common ancestor of tachinid flies existed between 33 and 48 mya. The two tachinid samples used in this study are from the same subfamily Exoristinae, but are in separate tribes Goniini (El. flavipalpis) and Exoristini (Ex. sorbillans). Among the four subfamilies of Tachinidae, Exoristinae was probably the latest to emerge [69]–[71]. Therefore, the time of origin of tachinid flies should be in the earlier half of the time interval described above. We speculate that the most recent common ancestor of tachinid flies existed in the middle Eocene (∼42–48 mya). Tachinid flies have a worldwide distribution, but are mainly found in Palaearctic and Nearctic regions. For a globally distributed family with significant differences in distribution between northern and southern continents, the relevant split is between the supercontinents Laurasia and Gondwana in the mid-Mesozoic. Our estimates for the origin of Tachinidae is much more recent than this. However, given that most tachinid species are distributed throughout the Holarctic Region, we suggest that the evolutionary history of tachinid flies is probably tied to the split of Laurasia in the Eocene rather than that between Laurasia and Gondwana.

We have shown that the availability of additional mitogenomes can make a valuable contribution to our understanding of the phylogeny and divergence times of Diptera. Our study serves as a useful primer for the evolution of tachinid flies, but the accuracy of divergence-time estimates can be improved by denser sampling of tachinid mitogenomes, a greater number of fossil calibrations, and combination with nuclear genes or morphological data. In addition, we suggest that the stable gene order among brachyceran species might be due to their comparatively short evolutionary timeframe.

Supporting Information

Table S1

Nucleotide composition of all available mitogenome sequences from Diptera.

(DOC)

Acknowledgments

We are grateful to to Jin-liang Zhao (Institute of Zoology, Chinese Academy of Sciences, Beijing) for his arduous collection, to Fang Yu, Xiao-he Wang (Institute of Zoology, Chinese Academy of Sciences, Beijing), and Xiu-wei Liu (Northeast Forestry University, Harbin) for assistance with analysis and experiments. Special thanks are due to Prof. H. Shima (Kyushu University, Fukuoka, Japan), who generously provided the valuable materials for identification.

Funding Statement

This work was supported mainly by a grant from the Knowledge Innovation Program of Chinese Academy of Sciences (grant KSXC2-EW-B-02), Public Welfare Project from the Ministry of Agriculture, China (grant 201103024), and the National Science Foundation, China (grants 30870268, 31172048, J0930004) to Chao-dong Zhu; the National Science Foundation, China (grants 31093430, 31272279) to Chun-tian Zhang; National Special Science and Technology Foundation of China (2012FY111100) to Xiao-lin Chen and Chao-dong Zhu. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No additional external funding received for this study.

References

  • 1. Clary DO, Wolstenholme DR (1985) The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J Mol Evol 22: 252–271. [DOI] [PubMed] [Google Scholar]
  • 2. Ye J, Fang R, Yi JP, Zhou GL, Zheng JZ (2010) The complete sequence determination and analysis of four species of Bactrocera mitochondrial genome. Plant Quarantine 24(3): 11–14. [Google Scholar]
  • 3. Krzywinski J, Li C, Morris M, Conn JE, Lima JB, et al. (2011) Analysis of the evolutionary forces shaping mitochondrial genomes of a Neotropical malaria vector complex. Mol Phylogenet Evol 58(3): 469–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Junqueira AC, Lessinger AC, Torres TT, Da Silva FR, Vettore AL, et al. (2004) The mitochondrial genome of the blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene 339: 7–15. [DOI] [PubMed] [Google Scholar]
  • 5. Oliveira MT, Barau JG, Martins-Junqueira AC, Feijão PC, da Rosa AC, et al. (2008) Structure and evolution of the mitochondrial genomes of Haematobia irritans and Stomoxis calcitrans: the Muscidae (Diptera: Calyptratae) perspective. Mol Phylogenet Evol 48: 850–857. [DOI] [PubMed] [Google Scholar]
  • 6. Cameron SL, Lambkin CL, Barker SC, Whiting MF (2007) A mitochondrial genome phylogeny of Diptera: whole genome sequence data accurately resolve relationships over broad timescales with high precision. Syst Entom 32(1): 40–59. [Google Scholar]
  • 7. Moreno M, Marinotti O, Krzywinski J, Tadei WP, James AA, et al. (2010) Complete mtDNA genomes of Anopheles darlingi and an approach to anopheline divergence time. Malaria J 9: 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Mousson L, Dauga C, Garrigues T, Schaffner F, Vazeille M, et al. (2005) Phylogeography of Aedes (Stegomyia) aegypti (L.) and Aedes (Stegomyia) albopictus (Skuse) (Diptera: Culicidae) based on mitochondrial DNA variations. Genet Res 86: 1–11. [DOI] [PubMed] [Google Scholar]
  • 9. ScheVer SJ, Lewis ML (2006) Mitochondrial phylogeography of the vegetable pest Liriomyza trifolii (Diptera: Agromyzidae): diverged clades and invasive populations. Ann Entomol Soc Am 99: 991–998. [Google Scholar]
  • 10. Chatterjee S, Taraphdar T, Mohandas TP (2005) Molecular analysis of divergence in tachinid uzi (Exorista sorbillans) populations in India. Genetica 125: 1–15. [DOI] [PubMed] [Google Scholar]
  • 11. Nardi F, Carapelli A, Boore JL, Roderick GK, Dallai R, et al. (2010) Domestication of olive fly through a multi-regional host shift to cultivated olives: Comparative dating using complete mitochondrial genomes. Mol Phylogenet Evol 57: 678–686. [DOI] [PubMed] [Google Scholar]
  • 12. Beckenbach AT (2012) Mitochondrial Genome Sequences of Nematocera (Lower Diptera): Evidence of Rearrangement following a Complete Genome Duplication in a Winter Crane Fly Genome Biol Evol. 4(2): 89–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Matsumoto Y, Yanase T, Tsuda T, Noda H (2009) Species-specific mitochondrial gene rearrangements in biting midges and vector species identification. Med Vet Entomol 23: 47–55. [DOI] [PubMed] [Google Scholar]
  • 14. Beckenbach AT, Joy JB (2009) Evolution of the mitochondrial genomes of gall midges (Diptera: Cecidomyiidae): rearrangement and severe truncation of tRNA genes. Genome Biol Evol 1: 278–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Behura SK, Lobo NF, Haas B, deBruyn D, Lovin DD, et al. (2011) Complete sequences of mitochondria genomes of Aedes aegypti and Culex quinquefasciatus and comparative analysis of mitochondrial DNA fragments inserted in the nuclear genomes. Insect Biochem Mol Biol 41: 770–777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Yang F, Du YZ, Wang LP, Cao JM, Yu WW (2011) The complete mitochondrial genome of the leafminer Liriomyza sativae (Diptera: Agromyzidae): Great difference in the A+T-rich region compared to Liriomyza trifolii . Gene 485: 7–15. [DOI] [PubMed] [Google Scholar]
  • 17. Torres TT, Dolezal M, Schlotterer C, Ottenwalder B (2009) Expression profiling of Drosophila mitochondrial genes via deep mRNA sequencing. Nucleic Acids Res 37(22): 7509–7518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Nelson LA, Cameron SL, Yeates DK (2011) The complete mitochondrial genome of the gall-forming fly, Fergusonina taylori Nelson and Yeates (Diptera: Fergusoninidae). Mitochondrial DNA 22(3): 197–199. [DOI] [PubMed] [Google Scholar]
  • 19. Nelson LA, Cameron SL, Yeates DK (2012 ) The complete mitochondrial genome of the flesh fly, Sarcophaga impatiens Walker (Diptera: Sarcophagidae) Mitochondrial DNA. 23(2): 42–43. [DOI] [PubMed] [Google Scholar]
  • 20. Beard CB, Hamm DM, Collins FH (1993) The mitochondrial genome of the mosquito Anophele gambiae, DNA sequence, genome organization, and comparisons with mitochondrial sequences of other insects. Insect Mol Biol 2(2): 103–124. [DOI] [PubMed] [Google Scholar]
  • 21. Mitchell SE, Cockburn AF, Seawright JA (1993) The mitochondrial genome of Anopheles quadrimaculatus species A: complete nucleotide sequence and gene organization. Genome 36: 1058–1073. [DOI] [PubMed] [Google Scholar]
  • 22. Spanos L, Koutroumbas G, Kotsyfakis M, Louis C (2000) The mitochondrial genome of the mediterranean fruit fly, Ceratitis capitata . Insect Mol Biol 9(2): 139–144. [DOI] [PubMed] [Google Scholar]
  • 23. Lessinger AC, Junqueira ACM, Lemos TA, Kemper EL, da Silva FR, et al. (2000) The mitochondrial genome of the primary screwwormfly Cochliomyia hominivorax (Diptera: Calliphoridae). Insect Mol Biol 9: 521–529. [DOI] [PubMed] [Google Scholar]
  • 24. Weigl S, Testini G, Parisi A, Dantas-Torres F, Traversa D, et al. (2010) The mitochondrial genome of the common cattle grub, Hypoderma lineatum . Med Vet Entomol 24: 329–335. [DOI] [PubMed] [Google Scholar]
  • 25. Wang S, Lei Z, Wang H, Dong B, Ren B (2009) The complete mitochondrial genome of the leafminer Liriomyza trifolii (Diptera: Agromyzidae). Mol Biol Rep 38: 687–692. [DOI] [PubMed] [Google Scholar]
  • 26. Shao YJ, Hu XQ, Peng GD, Wang RX, Gao RN, et al. (2012) Structure and evolution of the mitochondrial genome of Exorista sorbillans: the Tachinidae (Diptera: Calyptratae) perspective. Mol Biol Rep 39: 11023–11030. [DOI] [PubMed] [Google Scholar]
  • 27. Nelson LA, Lambkin CL, Batterham P, Wallman JF, Dowton M, et al. (2012) Beyond barcoding: A mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae). Gene 511: 131–142. [DOI] [PubMed] [Google Scholar]
  • 28. Wiegmann BM, Trautwein MD, Winkler IS, Barr NB, Kim JW, et al. (2011) Episodic radiations in the fly tree of life. PNAS 108(14): 5690–5695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.O’Hara JE (2010) World genera of the Tachinidae (Diptera) and their regional occurrence. Version 5.0. PDF document, 74 pp. Available: http://www.nadsdiptera.org/Tach/Genera/Gentach_ver5.pdf.
  • 30. Aldrich JM (1933) Notes on the Tachinid genus Elodia R. D., with three new species of Elodia and Phorocera (Diptera) from Japan. Proceedings of the Entomological Society of Washington 35: 21–22. [Google Scholar]
  • 31.Chao CM, Liang EY, Zhou SX (2009) Tachinidae, 555–816. In: Yang D, eds. Fauna of Hebei Province (Diptera) [In Chinese]. Beijing: China Agricultural Science and Technology Press. 1–863.
  • 32.Liu YQ, Li GW (2002) Fauna sinica, insect vol.27, Lepidoptera, Tortricidae. Beijing: Science Press. 315–316.
  • 33. Zhao JL, Zhang YY, Luo AR, Jiang GF, Cameron SL, et al. (2010) The complete mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae). Mol Biol Rep 38: 3757–3764. [DOI] [PubMed] [Google Scholar]
  • 34. McAlpine JF (1989) Phylogeny and classification of the Muscomorpha. In: McAlpine JF, ed. Manual of Nearctic Diptera, Research Branch, Agriculture Canada. Monograph 32, Vol. 3: 1397–1518. [Google Scholar]
  • 35. Nirmala X, Hypša V, Žurovec M (2001) Molecular phylogeny of Calyptratae (Diptera: Brachycera): the evolution of 18S and 16S ribosomal rDNAs in higher dipterans and their use in phylogenetic inference. Insect Mol Biol 10: 475–485. [PubMed] [Google Scholar]
  • 36. Kutty SN, Pape T, Wiegmann BM, Meier R (2010) Molecular phylogeny of the Calyptratae (Diptera: Cyclorrhapha) with an emphasis on the superfamily Oestroidea and the position of Mystacinobiidae and McAlpine’s fly. Syst Entom 35: 614–635. [Google Scholar]
  • 37. Wiegmann BM, Yeates DK, Thorne JL, Kishino H (2003) Time flies, a new molecular time scale for brachyceran fly evolution without a clock. Syst Biol 52: 745–756. [PubMed] [Google Scholar]
  • 38. Simon C, Frati F, Beckenbach AT, Crespi B, Liu H, et al. (1994) Evolution, weighting and Phylogenetics utility of mitochondrial gene sequences and compilation of conserved polymerase chain reaction Primers. Ann Entomol Soc Am 87(6): 651–701. [Google Scholar]
  • 39. Han H (2000) Molecular phylogenetic study of the tribe Trypetini (Diptera: Tephritidae), using mitochondrial 16S ribosomal DNA sequences. Biochem Syst Ecol 28(6): 501–513. [DOI] [PubMed] [Google Scholar]
  • 40. Lessinger AC, Junqueira AC, Conte FF, Azeredo-Espin AM (2004) Analysis of a conserved duplicated tRNA gene in the mitochondrial genome of blowflies. Gene 339: 1–6. [DOI] [PubMed] [Google Scholar]
  • 41. Oliveira MT, da Rosa AC, Azeredo-Espin AML, Lessinger AC (2006) Improving access to the control region and tRNA gene clusters of dipteran mitochondrial DNA. J Med Entomol 43: 636–639. [DOI] [PubMed] [Google Scholar]
  • 42. Singh VK, Mangalam AK, Dwivedi S, Naik S (1998) Primer premier: program for design of degenerate primers from a protein sequence. Biotechniques 24: 318–319. [DOI] [PubMed] [Google Scholar]
  • 43. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95–98. [Google Scholar]
  • 44. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25: 955–964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Zuker M, Stiegler P (1981) Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res 9(1): 133–148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. [DOI] [PubMed] [Google Scholar]
  • 47. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
  • 48. Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14: 817–818. [DOI] [PubMed] [Google Scholar]
  • 49. Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22(21): 2688–2690. [DOI] [PubMed] [Google Scholar]
  • 50. Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. [DOI] [PubMed] [Google Scholar]
  • 51. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7: 214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Drummond AJ, Ho SYW, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PLoS Biology 4: e88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Grimaldi D, Engel MS (2005) Evolution of the Insects. New York: Cambridge Univ Press.
  • 54. Krzeminski W, Krzeminska E, Papier F (1994) Grauvogelia arzvilleriana sp. n.–The oldest Diptera species (Lower/Middle Triassic of France). Acta Zool Cracov 37: 95–99. [Google Scholar]
  • 55. Winkler IS, Labandeira C, Wappler T, Wilf P (2010) Distinguishing Agromyzidae (Diptera: Schizophora) leaf mines in the fossil record: New taxa from the Paleogene of North America and Germany and their evolutionary implications. J Paleontol 84: 935–954. [Google Scholar]
  • 56.Rambaut A, Drummond AJ (2007) Tracer V1.4. Available: http://beast.bio.edsac.uk/Tracer.
  • 57. Lewis DL, Farr CL, Kaguni LS (1995) Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons. Insect Mol Biol 4: 263–278. [DOI] [PubMed] [Google Scholar]
  • 58. Krzywinski J, Grushko OG, Besansky NJ (2006) Analysis of the complete mitochondrial DNA from Anopheles funestus: an improved dipteran mitochondrial genome annotation and a temporal dimension of mosquito evolution. Mol Phylogenet Evol 39: 417–423. [DOI] [PubMed] [Google Scholar]
  • 59. Yu DJ, Xu L, Nardi F, Li JG, Zhang RJ (2007) The complete nucleotide sequence of the mitochondrial genome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Gene 396(1): 66–74. [DOI] [PubMed] [Google Scholar]
  • 60. Jiang ST, Hong GY, Yu M, Li N, Yang Y, et al. (2009) Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae). Int J Biol Sci 5(4): 351–365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Boore JL, Macey JR, Medina M (2005) Sequencing and comparing whole mitochondrial genomes of animals. Methods Enzymol 395, 311–348. [DOI] [PubMed]
  • 62. Lessinger AC, Azeredo-Espin AML (2000) Evolution and structural organization of mitochondrial DNA control region of myiasis-causing flies. Med Vet Entom 14: 71–80. [DOI] [PubMed] [Google Scholar]
  • 63. Oliveira MT, Azeredo-Espin AML, Lessinger AC (2007) The mitochondrial DNA control region of Muscidae flies: evolution and structural conservation in a dipteran context. J Mol Evol 64: 519–527. [DOI] [PubMed] [Google Scholar]
  • 64. Griffiths GCD (1972) The phylogenetic classification of Diptera Cyclorrhapha, with special reference to the structure of the male postabdomen. Ser Entomologica 8: 1–340. [Google Scholar]
  • 65. Hennig W (1976) Das Hypopygium von Lonchoptera lutea Panzer und die phylogenetischen Verwandtschaftsbeziehungen der Cyclorrhapha (Diptera). Stuttgarter Beitr¨age zur Naturkunde. Ser A (Biologie) 283: 1–63. [Google Scholar]
  • 66. Pape T (1992) Phylogeny of the Tachinidae family-group (Diptera: Calyptratae). Tijdschrift voor Entomologie 135: 43–86. [Google Scholar]
  • 67.Yeates DK, Wiegmann BM, Courtney GW, Meier R, Lambkin C et al. (2007) Phylogeny and systematics of Diptera: Two decades of progress and prospects Zootaxa 1668: 565–590. In: Zhang, Z.-Q. & Shear, W.A. (Eds) Linnaeus Tercentenary: Progress in Invertebrate Taxonomy. Zootaxa, 1668, 1–766.
  • 68. von Tschirnhaus M, Hoffeins C (2009) Fossil flies in Baltic amber–Insights in the diversity of Tertiary Acalyptratae (Diptera, Schizophora), with new morphological characters and a key based on 1000 collected inclusions. Denisia 26: 171. [Google Scholar]
  • 69. Stireman JO 3rd (2002) Phylogenetic relationships of tachinid flies in subfamily Exoristinae (Tachinidae: Diptera) based on 28S rDNA and elongation factor 1-α. Syst Entom 27: 409–435. [Google Scholar]
  • 70. O’Hara JE, Shima H, Zhang CT (2009) Annotated catalogue of the Tachinidae (Insecta: Diptera) of China. Zootaxa 2190: 1–236. [Google Scholar]
  • 71. Tachi T, Shima H (2009) Molecular phylogeny of the subfamily Exoristinae (Diptera, Tachinidae), with discussions on the evolutionary history of female oviposition strategy. Syst Entom 35: 148–163. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

Nucleotide composition of all available mitogenome sequences from Diptera.

(DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES