Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Apr 26.
Published in final edited form as: Food Chem Toxicol. 2012 Mar 4;50(6):2118–2122. doi: 10.1016/j.fct.2012.02.043

Capsaicin consumption, Helicobacter pylori CagA status and IL1B-31C > T genotypes: A host and environment interaction in gastric cancer

Lizbeth López-Carrillo a, M Constanza Camargo b, Barbara G Schneider b, Liviu A Sicinschi b,d, Raúl U Hernández-Ramírez a, Pelayo Correa b, Mariano E Cebrian c,*
PMCID: PMC3636974  NIHMSID: NIHMS459981  PMID: 22414649

Abstract

Gastric cancer (GC) has been associated with a complex combination of genetic and environmental factors. In contrast to most countries, available information on GC mortality trends showed a gradual increase in Mexico. Our aim was to explore potential interactions among dietary (chili pepper consumption), infectious (Helicobacter pylori) and genetic factors (IL1B-31 genotypes) on GC risk. The study was performed in three areas of Mexico, with different GC mortality rates. We included 158 GC patients and 317 clinical controls. Consumption of capsaicin (Cap), the pungent active substance of chili peppers, was estimated by food frequency questionnaire. H. pylori CagA status was assessed by ELISA, and IL1B-31 genotypes were determined by TaqMan assays and Pyrosequencing in DNA samples. Multivariate unconditional logistic regression was used to estimate potential interactions. Moderate to high Cap consumption synergistically increased GC risk in genetically susceptible individuals (IL1B-31C allele carriers) infected with the more virulent H. pylori (CagA+) strains. The combined presence of these factors might explain the absence of a decreasing trend for GC in Mexico. However, further research on gene–environment interactions is required to fully understand the factors determining GC patterns in susceptible populations, with the aim of recommending preventive measures for high risk individuals.

Keywords: Gastric cancer, Capsaicin, Chili pepper, Interleukin 1 beta polymorphism, Helicobacter pylori CagA+

1. Introduction

Gastric cancer (GC) is the world’s 5th most frequent cancer, is still the second most common cause of cancer-related death in the world, and is thought to be associated with a complex combination of genetic and environmental factors. In contrast to most countries, available information on the GC mortality trends showed a gradual increase in Mexico (Tovar-Guzman et al., 2001). Previous epidemiological studies have independently reported an increased GC risk due to chili pepper consumption (Lopez-Carrillo et al., 2003; Sipetic et al., 2003; Mathew et al., 2000), to Helicobacter pylori (H. pylori) CagA seropositivity (Eslick, 2006; Huang et al., 2003), or to interleukin 1 beta (IL1B) genotypes (IL1B-31C > T) (Kumar et al., 2009; Vincenzi et al., 2008; Lee et al., 2007b; Wang et al., 2007; Camargo et al., 2006; Kamangar et al., 2006).

Chili pepper consumption has been related to an increased risk of GC in studies performed in Spain (Goiriena de Gandarias et al., 1988), Serbia (Sipetic et al., 2003), Korea (Lee et al., 1995), and India (Mathew et al., 2000; Gajalakshmi and Shanta, 1996). Similar adjusted results have been obtained in México where high consumption of chili is also customary (Lopez-Carrillo et al., 1994, 2003). Capsaicin (Cap) is the pungent active substance of chili peppers, and experimental evidence suggests that Cap ingestion significantly increases the number of lymphocytes and produces exfoliation of the intestinal epithelium (Johnson, 2007; Diaz Barriga et al., 1995). Several studies using diverse initiation–promotion protocols have shown that chili extract has tumor promoting effects in rodent stomach, liver and colon (Johnson, 2007). In addition, Marques et al. (2002) reported that Cap (10–200 μM) significantly induced micronuclei and sister chromatid exchanges in cultured peripheral human blood lymphocytes. Both reports illustrated the carcinogenic and genotoxic properties of Cap.

H. pylori infection is considered a necessary but not sufficient cause of gastric adenocarcinoma (IARC, 1994), because less than 3% of infected patients develop this neoplasia (Uemura et al., 2001). H. pylori strain virulence, host genetic characteristics and variations in dietary patterns are considered concomitant risk factors for GC development (World Cancer Research Fund/American Institute for Cancer Research, 2007; Stewart and Kleihues, 2003; Gonzalez et al., 2002). The key pathophysiological event in H. pylori infection is the initiation of an inflammatory response (Hatakeyama, 2006). IL1B is a proinflammatory host gene up-regulated by H. pylori infection encoding IL1β, the cytokine which initiates and amplifies the inflammatory response to H. pylori infection, besides being the most powerful acid inhibitor known. Moreover, virulent H. pylori strains, such as those bearing the Cag pathogenicity island, produce more aggressive mucosal damage (El Omar et al., 2000).

Several IL1B gene polymorphisms, including IL1B-31C > T (IL1B-31), have been associated with increased expression of IL1β (Vilaichone et al., 2005; Hwang et al., 2002; Pociot et al., 1992). Inconsistent epidemiological evidence has related those single nucleotide polymorphisms (SNPs) with GC risk in Caucasian and Asian populations (Wang et al., 2007; Camargo et al., 2006; Kamangar et al., 2006). However, limited information is available for Mexican populations. Only two studies have been published and both reported an increased risk for GC among carriers of the IL1B-31C allele (Sicinschi et al., 2006; Garza-Gonzalez et al., 2005).

Our research group has previously evaluated the interaction between Cap consumption and H. pylori antibodies on GC risk and showed no significant interaction between these factors, probably because the virulence of H. pylori was not considered (Lopez-Carrillo et al., 2003). We later examined the interaction between H. pylori CagA positive infections and host IL1B-31 genotypes and showed a significantly adjusted increased risk of intestinal-type GC (OR 3.19; 95% CI 51.05–9.68) in CagA positive subjects with the IL1B-31CC genotype (Sicinschi et al., 2006). Therefore, our aim was to explore a potential interaction among dietary (Cap consumption), infectious (H. pylori) and genetic factors (IL1B-31C genotypes) on GC risk.

2. Materials and methods

2.1. Study population

In this report, we included 158 patients with GC and 317 clinical controls, who had serum samples available for DNA extraction and who had participated in a hospital-based case-control study performed in three geographical areas of Mexico, with low (Mexico City), medium (Puebla) and high (Yucatan) GC mortality rates (Lopez-Carrillo et al., 2003). In the original study (234 cases and 468 controls), undertaken between 1994 and 1996, we were able to identify approximately 75% of all new GC patients recorded by the Mexico National Cancer Registry during the period of recruitment in the study area from government hospitals.

2.1.1. Cases

All GC cases were histologically confirmed as adenocarcinoma of the stomach (with no other history of cancer), and classified by a single experienced cancer pathologist according to Lauren’s criteria (Lauren, 1965) as follows: 82 diffuse, 57 intestinal, and 19 mixed. From these 158 cases, 55 were from hospitals in Yucatan (34.8%), 38 patients were from Puebla (24.1%) and 65 patients from Mexico City (41.1%). Information regarding the anatomical site of tumor origin was not available.

2.1.2. Controls

At least two hospital controls were matched to each case by age (±5 years), sex, and city of residence. Inclusion criteria were as follows: no previous or current cancer, and absence of mental and immunosuppressive disorders. Individuals with evidence for past or present peptic ulcer disease, gastritis, cirrhosis, and diabetes mellitus were excluded. The most frequent diagnoses among controls (n = 317) were circulatory system disorders (18.3%); diseases of the nervous system and sensory organs, excepting psychiatric syndromes (15.5%); osteo-muscular and connective tissue disorders (11.0%); injuries and poisoning (10.4%); diseases of the respiratory tract (10.1%); diseases of the genitourinary system (10.4%) and the skin (7.3%); other subjects were healthy individuals attending the hospitals for preventive purposes such as vaccination or Pap smear (10.1%), and 6.9% had other illnesses that included infectious diseases, endocrine and metabolic disorders, complications of delivery and postpartum, or congenital anomalies.

Each subject provided informed consent before entering the study. The ethics committee of Mexico National Institute of Public Health approved the original study.

2.2. Capsaicin consumption

A detailed description of the method for estimating Cap consumption is described elsewhere (Lopez-Carrillo et al., 2003). Briefly, we used a validated semi-quantitative food questionnaire that comprised 133 food items in Mexico City (including 20 types of chili peppers and 6 dishes prepared with chili); 134 items in Puebla (including 14 types of chili peppers and 7 dishes prepared with chili); and 147 items in Yucatán (including 14 types of chili peppers and 3 dishes prepared with chili). The types of chilies and dishes prepared that were included in the questionnaire, were those more frequently consumed and were well known for each study area and were not necessarily the same in the three areas.

The frequency of consumption of pre-defined portions of chili peppers and dishes prepared with chilies reported by the subjects was further multiplied by its corresponding Cap content. The total individual amount of Cap consumption was estimated by adding up the Cap content for the daily reported consumption of each chili and chili-dish (Lopez-Carrillo et al., 2003).

2.3. H. pylori CagA status

H. pylori CagA status was determined by the presence of IgG antibodies against CagA protein in serum. Those antibodies were measured by a previously validated ELISA (97% sensitivity and 83% specificity). The cut-off value for this assay was ≥ 1.5 absorbance units (Camorlinga-Ponce et al., 1998).

2.4. Genotyping

DNA was isolated from 140 μl of serum using the Qiagen QIAmp Viral RNA Mini kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions, following the vacuum method. DNA was quantitated using the Picogreen Assay (Molecular Probes, Eugene, OR). Whole blood samples were not available for this purpose. Allele discrimination for IL1B-31 was performed using the 5′ Nuclease (TaqMan) assay and by Pyrosequencing. The Taqman assay was designed by the Assays-by-Design™ service (Applied Biosystems, Foster City, CA) and performed according to standardized conditions recommended by the manufacturer. Amplification primers were (forward) CCCCTTTCCTTTAACTTGATTGTGAAATC and (reverse) AGGTTTGGTATCTGCCAGTTTCTC. Alleles were distinguished by probes labeled with different dyes, as follows: VIC—CTGTTTTTATGGCTTTCA—NFQ for the C allele and FAM—CTGTTTTTATAGCTTTCA—NFQ for the T allele. If signals for both dyes were present, the individual was considered heterozygous.

PCR amplification was performed in a reaction consisting of 1–20 ng of genomic DNA, 1× TaqMan Universal Master Mix (Applied Biosystems) and 1× Assay Mix, containing 250 nM of each probe, and 900 nM of each primer. The amplification protocol was 10 min at 95 °C, followed by 60 cycles consisting of 92 °C for 15 s and 60 °C for 1 min. Amplification and sequence detection were performed using an ABI PRISM™ 7700 instrument, with Sequencing Detection System software (SDS 1.9.1).

The Pyrosequencing assay was designed using the SNP Assay Design Software version 1.0 (Biotage, Uppsala, Sweden). Primer sequences were (forward) TTTCTCAGCCTCCTACTTCTGC, (reverse) GTGCCTCGAAGAGGTTTGGTAT, and (sequencing) CCCTCGCTGTTTTTAT. PCR amplifications were performed with 1–15 ng of DNA from each serum sample, using 1.0 U/μl of HotStar Taq DNA polymerase (Qiagen, St. Louis, MO), 0.2 μM of the forward and reverse primers, and 0.125 mM of dNTP. The amplification protocol was 95 °C for 15 min, followed by 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min for 49 cycles, with a final extension of 72 °C for 10 min.

Biotinylated PCR products were captured using streptavidin-coated Sepharose beads (Streptavidin Sepharose HP, Amersham Biosciences), denatured to remove the non-biotinylated strand and hybridized to the sequencing primer, following the manufacturer’s specifications (Biotage/Qiagen). Pyrosequencing was performed using a PSQ HS 96 instrument, and genotyping calls were made by the PSQ HS 96A Software Version 1.2. In a small number of cases in which the genotype differed between TaqMan and Pyrosequencing assays, conventional sequencing was used to establish the genotype.

2.5. Statistical analysis

Selected sociodemographic characteristics, IL1B-31 genotype frequencies, Cap consumption and H. pylori CagA status were compared between cases and controls using Chi-square or student-t tests, as appropriate. Genotype and allele frequencies in the controls (overall and by geographic area) were tested for departures from Hardy–Weinberg equilibrium (HWE). Cap consumption was grouped in two categories due to the small sample size: the first category included individuals with low consumption (<30 mg/day, approximately equivalent to the Cap content in less than three jalapeño peppers/day), whereas the other represented moderate and high consumption, (ranging from 30 to 250 mg/day, equivalent to 3–25 jalapeño peppers/day).

The association between IL1B-31 genotypes and GC risk according to H. pylori CagA status and Cap consumption was evaluated by unconditional logistic regression models adjusting by age, sex, years of schooling, geographic area, smoking and methylenetetrahydrofolate reductase polymorphism (MTHFR 677C > T), that was associated with GC risk in this population (Lacasana-Navarro et al., 2006). The multiplicative terms between Cap consumption (moderate-high/low), H. pylori CagA status (positive/negative) and/or IL1B-31 (C/T alleles) were introduced in separate models to determine the statistical significance of the Wald χ2 test for the effect modification term (interaction). The Stata program version 9.0 was used to perform all statistical analyses (StataCorp LP, College Station, TX).

3. Results

3.1. General characteristics

The characteristics of study subjects are presented in Table 1. The proportion of individuals with a CagA seropositive status was significantly (p = 0.007) higher in cases (79.8%) than in controls (67.8%). By design, the distribution of age, sex, and geographic area were not significantly different between cases and controls. Other variables showing no significant crude differences between groups included genotype frequencies of IL1B-31, Cap consumption and smoking. In the total sample of controls, the genotype frequencies for IL1B-31 did not depart significantly from those expected under HWE, but a slight deficiency of heterozygotes was observed in the control group from Yucatan (data not shown).

Table 1.

General characteristics of the study population.

Characteristics Controls
(n = 317)		 Cases
(n = 158)		 p Valuea
Age in years, Mean ± SD 58.63 ±12.55 58.59 ±12.13 0.97
Male, n (%) 184 (58.04) 85 (53.80) 0.38
Geographic area, n (%)
Yucatan 111 (35.02) 55 (34.81) 0.43
Mexico City 114(35.96) 65 (41.14)
Puebla 92 (29.02) 38 (24.05)
Schooling years, Mean ± SD 4.42 ±4.15 4.38 ± 4.24 0.93
Current smokers, n (%) 143 (45.11) 68 (43.04) 0.67
H. pylori CagA positive, n (%) 215 (67.82) 126 (79.75) <0.01
IL1B-31, n (%) b
TT 49 (15.46) 25 (15.82) 0.91
TC 121 (38.17) 57 (36.08)
CC 147 (46.37) 76 (48.10)
C carrier 415 (65.46) 209 (66.14) 0.84
Capsaicin consumption in mg/day, n (%)
Low (<30) 201 (63.41) 94 (59.49) 0.41
Moderate/high (30–250) 116(36.59) 64(40.51)
Open in a new tab
a

p Values for difference from chi-square or t test.

b

p < 0.05 For HWE test among all controls.

3.2. Capsaicin, H. pylori, and IL1B-31 on gastric cancer risk

A significantly increased GC risk (OR = 3.41, IC95 = 1.12–10.43) was observed among individuals with moderate to high Cap consumption, who were both H. pylori CagA positive and IL1B-31C allele carriers, as compared to T carriers (Table 2). Cap consumption and IL1B-31C alleles synergistically increased GC risk (p for interaction = 0.04) but Cap did not interact with H. pylori CagA status. No association was found among moderate to high Cap consumers who were H. pylori CagA seronegative. No associations with GC risk were found among low Cap consumers not with standing their CagA or IL1B-31 genotype status. Non-significant interaction terms were further estimated between H. pylori CagA status and IL1B-31 genotypes with and without Cap consumption (Data not shown).

Table 2.

Interaction between capsaicin consumption, H. pylori CagA status and IL1B-31 genotypes on gastric cancer riska.

Genotypes of IL1B-31 Capsaicin consumption
Low (<30 mg/day)
 Moderate/high (30–250 mg/day)
CagA negative
 CagA positive
 CagA negative
 CagA positive
Controls/
Cases		 OR (95% CI) Controls/
Cases		 OR (95% CI) Controls/
Cases		 OR (95% CI) Controls/
Cases		 OR (95% CI)
TT 5/3 1.00 15/12 1.00 8/4 1.00 21/6 1.00
TC 31/4 0.16 (0.02–
1.62)		 53/30 0.78 (0.31–
1.98)		 14/7 0.81 (0.12–
5.70)		 23/16 3.48 (1.00–
12.04)
CC 30/9 0.69 (0.08–
5.72)		 67/36 0.67 (0.27–
1.63)		 14/5 0.19 (0.02–
1.65)		 36/26 3.37 (1.05–
10.85)
C carrier 61/13 0.39 (0.05–
2.88)		 120/66 0.71 (0.30–
1.67)		 28/12 0.43 (0.08–
2.45)		 59/42 3.41 (1.12–
10.43)
p for multiplicative
  interaction		 Cap consumption × H. pylori CagA status: 0.18b
Cap consumption × IL1B-31C carrier: 0.04c
Open in a new tab
a

Adjusted by age, sex, geographic location, years of schooling, smoking, and MTHFR 677C > T polymorphism.

b

Adjusted as in footnote a plus IL1B-31C carrier.

c

Adjusted as in footnote a plus H. pylori CagA status.

4. Discussion

The main findings of our study were that moderate to high Cap consumption synergistically increases the risk of GC in genetically susceptible individuals (IL1B-31C allele carriers) infected with the more virulent H. pylori (CagA positive) strains.

Although dietary, infectious and genetic factors may interact to increase GC risk, little information is available to explain their potential mechanisms of action and/or interaction. An increased inflammatory response and an altered gastric acidic environment may be a common pathway for Cap consumption, H. pylori infection, and IL1B-31 genotypes in gastric carcinogenesis. For example, subchronic and chronic Cap administration has been shown to increase gastrointestinal inflammatory response in experimental animals. Erosion of the mucosal layer of the gastrointestinal tract has been documented in Wistar rats fed Cap (0.5%, 1%, 2% and 5%) for 4–8 weeks (Srinivasan et al., 1980) whereas rats fed with a diet containing 10% of the dried chili pepper fruit for 8 weeks showed exfoliation of the intestinal epithelium into the lumen with lymphocytic accumulation (al Qarawi and Adam, 1999). In contrast, the acute administration of Cap (160 μM) has been reported to protect against aspirin-induced injury in the rat perfused stomach assay (Holzer et al., 1989) and also in humans administered with 20 g of chili followed by aspirin (600 mg) and assessed 6 h later (Yeoh et al., 1995). A related widely studied mechanism is the inflammatory action of H. pylori on the gastric mucosa, since it is likely that the chronic inflammatory process triggered by the presence of the bacteria on the gastric mucosa contributes to an environment conducive to neoplastic transformation given that many of the mediators and byproducts of inflammation are mitogenic and mutagenic (Lochhead and El Omar, 2007). In contrast, short term in vitro studies have reported that H. pylori CagA+ growth was inhibited by Cap (50–500 μg/ml) (Jones et al., 1997), whereas Lee et al. (2007a) reported that non-toxic doses of Cap (100 μmol/L) inhibited H. pylori (Vac A+, CagA+ wild-type)-induced interleukin-8 (IL-8) production by gastric epithelial cells (AGS or MKN45) by modulating the IκB, NF-κB, and IL-8 pathways, and suggested that the acute Cap administration has potential anti-inflammatory properties (Lee et al., 2007a). The results mentioned above suggest that Cap differentially affects the processes of inflammation and GC carcinogenesis depending on the dose and duration of exposure. The low doses and short term Cap exposures that have been used in most experimental studies contrast with the higher Cap daily consumptions (0.4–3.6 mg/kg/day) estimated from individuals classified in the moderate/high consumption category (~3.5 jalapeño peppers per day by a 70 kg adult) and longer periods of exposure estimated in our study.

Another mechanism by which Cap could indirectly increase GC risk is the induction of a less acidic gastric environment favoring H. pylori growth, since experimental studies have shown that Cap alters gastrin secretion, the main hormone regulating gastric acid secretion. Imatake et al. (2009) reported that Cap administration (50, 100, or 500 mg/ml) to lumen-perfused stomachs of Wistar rats inhibited the acid secretion resulting from vagal stimulation without significant effects on basal acid output (Imatake et al., 2009). Regarding studies performed on humans, Mozsik et al. (1999) reported that intragastric administration of low Cap doses (100–800 μg) to healthy human subjects reduced in a dose-dependent manner the volume of gastric juice and acid output (Mozsik et al., 1999). More recently, Ericson et al. (2009) showed that a chili-rich diet (1.4–4.2 mg Cap per day) consumed for 3-weeks by human volunteers decreased ex-vivo the secretion of gastrin by a suspension of antral glands obtained by gastric biopsies, whereas an increased secretion was observed when a single Cap dose was added in vitro to the isolated glands (Ericson et al., 2009).

The increased GC risk observed in IL1B-31C allele carriers infected with H. pylori CagA+ in this study was consistent with earlier studies showing a relationship between CagA seropositivity and GC (Eslick, 2006; Huang et al., 2003) and with previous reports showing a threefold increased GC risk in Chinese patients infected with H. pylori and carrying IL1B-511TT, as compared with CC carriers (Li et al., 2007). IL1B-511T is in near complete linkage disequilibrium with the IL1B-31C SNP (Rad et al., 2003; El Omar et al., 2000). These findings have been explained by the up-regulation of the proinflammatory cytokine IL1β, which in turn has been reported to play an important role in the inflammatory response and subsequent hypochlorhydria observed during chronic H. pylori infection, since it has been suggested that hosts carrying IL1B-511T/T and suffering H. pylori infection have increased IL1β production (Rad et al., 2003; El Omar et al., 2000).

Among the limitations of our study are that clinical controls may not adequately represent the prevalence of the independent variables in the general population, since some of them may be related to their diseases. However, regarding chili pepper intake, our estimates in clinical controls were congruent with data on per capita chili pepper consumption (~30 g/day) reported in Mexico (SIAP, 2012). In addition, the prevalence of CagA+ H. pylori in our controls (67.8%) was in good agreement with that reported (61.6%) for the Mexican population in a national survey (Torres et al., 1998). Moreover, the genotype distribution of IL1B did not depart from the expected values according to the Hardy Weinberg Equilibrium test. Hence, it is unlikely that the prevalence of the studied factors differed significantly from that of the target population. Another limitation was the use of a food frequency questionnaire to estimate chili pepper consumption, because recall bias may have been present. However, we have found that chili pepper consumption was not significantly related with beliefs about health outcomes among Mexicans (Lopez-Carrillo et al., 1995), and in the present investigation interviewers were blind to the study hypothesis. In this context, while the possibility of differential recall of chili pepper intake is low, a non-differential error that biased the results towards the null value should not be disregarded. Concerning H. pylori, it is known that many GC patients may have previously suffered severe atrophic gastritis and metaplasia, conditions contributing to decrease H. pylori colonization; therefore, near the date of diagnoses there may be an increase of false negative seropositivity to H. pylori among cases (Forman et al., 1994). This differential measurement error could have also biased our results towards the null value.

In Mexico, about 30% of the population are high consumers of chili pepper (Lopez-Carrillo et al., 2003), and about 62% are H. pylori CagA+ (Torres et al., 1998). Furthermore, the risk-associated IL1B-31C allele has been reported to have a frequency of 65% in our studies in central and southern Mexico (Sicinschi et al., 2006) and of 56% in northern Mexico (Garza-Gonzalez et al., 2005). This combination would increase the likelihood that the more virulent CagA+ H. pylori strains could elicit a more aggressive inflammatory response particularly among IL1B-31C carriers, therefore increasing GC risk. The combined presence of these factors might explain the absence of a decreasing trend in GC incidence in Mexico. However, further research on gene–environment interactions is required to fully understand the potential combination of factors determining GC patterns in the more susceptible populations, with the purpose of identification of preventive dietary measures for high risk populations.

Acknowledgments

The Mexican Council for Science and Technology (CONACYT: SALUD-2002-C01-7107) provided financial support for the conduct of this study and had no role in the study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the article for publication.

Abbreviations

GC

gastric cancer

Cap

capsaicin

ELISA

enzyme-linked immunosorbent assay

ILB1

interleukin 1 beta

SNPs

single nucleotide polymorphisms

HWE

Hardy-Weinberg equilibrium

MTHFR

methylenetetrahydrofolate reductase

Footnotes

Conflict of Interest

The authors declare that there are no conflict of interest.

References

  1. al Qarawi AA, Adam SE. Effects of red chilli (Capsicum frutescens L.) on rats. Vet. Hum. Toxicol. 1999;41:293–295. [PubMed] [Google Scholar]
  2. Camargo MC, Mera R, Correa P, Peek RM, Jr., Fontham ET, Goodman KJ, Piazuelo MB, Sicinschi L, Zabaleta J, Schneider BG. Interleukin-1beta and interleukin-1 receptor antagonist gene polymorphisms and gastric cancer: a meta-analysis. Cancer Epidemiol. Biomarkers Prev. 2006;15:1674–1687. doi: 10.1158/1055-9965.EPI-06-0189. [DOI] [PubMed] [Google Scholar]
  3. Camorlinga-Ponce M, Torres J, Perez-Perez G, Leal-Herrera Y, Gonzalez-Ortiz B, Madrazo d.l.G., Gomez A, Munoz O. Validation of a serologic test for the diagnosis of Helicobacter pylori infection and the immune response to urease and CagA in children. Am. J. Gastroenterol. 1998;93:1264–1270. doi: 10.1111/j.1572-0241.1998.00407.x. [DOI] [PubMed] [Google Scholar]
  4. Diaz Barriga AS, Madrigal-Bujaidar E, Calderon ME, Ramirez HL, Diaz Garcia BD. Genotoxic effects produced by capsaicin in mouse during subchronic treatment. Mutat. Res. 1995;345:105–109. doi: 10.1016/0165-1218(95)90046-2. [DOI] [PubMed] [Google Scholar]
  5. El Omar EM, Carrington M, Chow WH, McColl KE, Bream JH, Young HA, Herrera J, Lissowska J, Yuan CC, Rothman N, Lanyon G, Martin M, Fraumeni JF, Jr., Rabkin CS. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000;404:398–402. doi: 10.1038/35006081. [DOI] [PubMed] [Google Scholar]
  6. Ericson A, Nur EM, Petersson F, Kechagias S. The effects of capsaicin on gastrin secretion in isolated human antral glands: before and after ingestion of red chilli. Dig. Dis. Sci. 2009;54:491–498. doi: 10.1007/s10620-008-0400-1. [DOI] [PubMed] [Google Scholar]
  7. Eslick GD. Helicobacter pylori infection causes gastric cancer? A review of the epidemiological, meta-analytic, and experimental evidence. World J. Gastroenterol. 2006;12:2991–2999. doi: 10.3748/wjg.v12.i19.2991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Forman D, Webb P, Parsonnet J. H. pylori and gastric cancer. Lancet. 1994;343:243–244. [PubMed] [Google Scholar]
  9. Gajalakshmi CK, Shanta V. Lifestyle and risk of stomach cancer: a hospital-based case-control study. Int. J. Epidemiol. 1996;25:1146–1153. doi: 10.1093/ije/25.6.1146. [DOI] [PubMed] [Google Scholar]
  10. Garza-Gonzalez E, Bosques-Padilla FJ, El Omar E, Hold G, Tijerina-Menchaca R, Maldonado-Garza HJ, Perez-Perez GI. Role of the polymorphic IL-1B, IL-1RN and TNF-A genes in distal gastric cancer in Mexico. Int. J. Cancer. 2005;114:237–241. doi: 10.1002/ijc.20718. [DOI] [PubMed] [Google Scholar]
  11. Goiriena de Gandarias FJ, Santidrian MI, Barranquero AM. Etiopathogenic study of digestive cancer in Viscaya, with special emphasis on the role of diet and alcohol and tobacco use. Rev. Sanid. Hig. Publica (Madr.) 1988;62:1411–1430. [PubMed] [Google Scholar]
  12. Gonzalez CA, Sala N, Capella G. Genetic susceptibility and gastric cancer risk. Int. J. Cancer. 2002;100:249–260. doi: 10.1002/ijc.10466. [DOI] [PubMed] [Google Scholar]
  13. Hatakeyama M. Helicobacter pylori CagA—a bacterial intruder conspiring gastric carcinogenesis. Int. J. Cancer. 2006;119:1217–1223. doi: 10.1002/ijc.21831. [DOI] [PubMed] [Google Scholar]
  14. Holzer P, Pabst MA, Lippe IT. Intragastric capsaicin protects against aspirin-induced lesion formation and bleeding in the rat gastric mucosa. Gastroenterology. 1989;96:1425–1433. doi: 10.1016/0016-5085(89)90508-8. [DOI] [PubMed] [Google Scholar]
  15. Huang JQ, Zheng GF, Sumanac K, Irvine EJ, Hunt RH. Meta-analysis of the relationship between cagA seropositivity and gastric cancer. Gastroenterology. 2003;125:1636–1644. doi: 10.1053/j.gastro.2003.08.033. [DOI] [PubMed] [Google Scholar]
  16. Hwang IR, Kodama T, Kikuchi S, Sakai K, Peterson LE, Graham DY, Yamaoka Y. Effect of interleukin 1 polymorphisms on gastric mucosal interleukin 1beta production in Helicobacter pylori infection. Gastroenterology. 2002;123:1793–1803. doi: 10.1053/gast.2002.37043. [DOI] [PubMed] [Google Scholar]
  17. IARC . Schistosomes, Liver Flukes and Helicobacter pylori International Agency of Cancer Research. Lyon; France: 1994. [Google Scholar]
  18. Imatake K, Matsui T, Moriyama M. The effect and mechanism of action of capsaicin on gastric acid output. J. Gastroenterol. 2009;44:396–404. doi: 10.1007/s00535-009-0018-x. [DOI] [PubMed] [Google Scholar]
  19. Johnson W., Jr. Final report on the safety assessment of Capsicum annuum extract, Capsicum annuum fruit extract, Capsicum annuum resin, Capsicum annuum fruit powder, Capsicum frutescens fruit, Capsicum frutescens fruit extract, Capsicum frutescens resin, and capsaicin. Int. J. Toxicol. 2007;26(Suppl. 1):3–106. doi: 10.1080/10915810601163939. [DOI] [PubMed] [Google Scholar]
  20. Jones NL, Shabib S, Sherman PM. Capsaicin as an inhibitor of the growth of the gastric pathogen Helicobacter pylori. FEMS Microbiol. Lett. 1997;146:223–227. doi: 10.1111/j.1574-6968.1997.tb10197.x. [DOI] [PubMed] [Google Scholar]
  21. Kamangar F, Cheng C, Abnet CC, Rabkin CS. Interleukin-1B polymorphisms and gastric cancer risk—a meta-analysis. Cancer Epidemiol. Biomarkers Prev. 2006;15:1920–1928. doi: 10.1158/1055-9965.EPI-06-0267. [DOI] [PubMed] [Google Scholar]
  22. Kumar S, Kumar A, Dixit VK. Evidences showing association of interleukin-1B polymorphisms with increased risk of gastric cancer in an Indian population. Biochem. Biophys. Res. Commun. 2009;387:456–460. doi: 10.1016/j.bbrc.2009.07.033. [DOI] [PubMed] [Google Scholar]
  23. Lacasana-Navarro M, Galvan-Portillo M, Chen J, Lopez-Cervantes M, Lopez-Carrillo L. Methylenetetrahydrofolate reductase 677C > T polymorphism and gastric cancer susceptibility in Mexico. Eur. J. Cancer. 2006;42:528–533. doi: 10.1016/j.ejca.2005.10.020. [DOI] [PubMed] [Google Scholar]
  24. Lauren P. The two histological main types of gastric carcinoma: diffuse and so-called intestinal-type carcinoma. Acta Pathol. Microbiol. Scand. 1965;64:31–49. doi: 10.1111/apm.1965.64.1.31. [DOI] [PubMed] [Google Scholar]
  25. Lee IO, Lee KH, Pyo JH, Kim JH, Choi YJ, Lee YC. Anti-inflammatory effect of capsaicin in Helicobacter pylori-infected gastric epithelial cells. Helicobacter. 2007a;12:510–517. doi: 10.1111/j.1523-5378.2007.00521.x. [DOI] [PubMed] [Google Scholar]
  26. Lee JK, Park BJ, Yoo KY, Ahn YO. Dietary factors and stomach cancer: a case-control study in Korea. Int. J. Epidemiol. 1995;24:33–41. doi: 10.1093/ije/24.1.33. [DOI] [PubMed] [Google Scholar]
  27. Lee KA, Park JH, Sohn TS, Kim S, Rhee JC, Kim JW. Interaction of polymorphisms in the interleukin 1B-31 and general transcription factor 2A1 genes on the susceptibility to gastric cancer. Cytokine. 2007b;38:96–100. doi: 10.1016/j.cyto.2007.05.008. [DOI] [PubMed] [Google Scholar]
  28. Li C, Xia HH, Xie W, Hu Z, Ye M, Li J, Cheng H, Zhang X, Xia B. Association between interleukin-1 gene polymorphisms and Helicobacter pylori infection in gastric carcinogenesis in a Chinese population. J. Gastroenterol. Hepatol. 2007;22:234–239. doi: 10.1111/j.1440-1746.2006.04379.x. [DOI] [PubMed] [Google Scholar]
  29. Lochhead P, El Omar EM. Helicobacter pylori infection and gastric cancer. Best. Pract. Res. Clin. Gastroenterol. 2007;21:281–297. doi: 10.1016/j.bpg.2007.02.002. [DOI] [PubMed] [Google Scholar]
  30. Lopez-Carrillo L, Fernandez-Ortega MC, Costa-Dias R, Franco-Marina J, Alejandre-Badillo T. Beliefs about chili pepper consumption and health in Mexico City. Salud Publica Mex. 1995;37:339–343. [PubMed] [Google Scholar]
  31. Lopez-Carrillo L, Hernandez AM, Dubrow R. Chili pepper consumption and gastric cancer in Mexico: a case-control study. Am. J. Epidemiol. 1994;139:263–271. doi: 10.1093/oxfordjournals.aje.a116993. [DOI] [PubMed] [Google Scholar]
  32. Lopez-Carrillo L, Lopez-Cervantes M, Robles-Diaz G, Ramirez-Espitia A, Mohar-Betancourt A, Meneses-Garcia A, Lopez-Vidal Y, Blair A. Capsaicin consumption, Helicobacter pylori positivity and gastric cancer in Mexico. Int. J. Cancer. 2003;106:277–282. doi: 10.1002/ijc.11195. [DOI] [PubMed] [Google Scholar]
  33. MarqNues S, Oliveira NG, Chaveca T, Rueff J. Micronuclei and sister chromatid exchanges induced by capsaicin in human lymphocytes. Mutat. Res. 2002;517:39–46. doi: 10.1016/s1383-5718(02)00040-2. [DOI] [PubMed] [Google Scholar]
  34. Mathew A, Gangadharan P, Varghese C, Nair MK. Diet and stomach cancer: a case-control study in South India. Eur. J. Cancer Prev. 2000;9:89–97. doi: 10.1097/00008469-200004000-00004. [DOI] [PubMed] [Google Scholar]
  35. Mozsik G, Debreceni A, Abdel-Salam OM, Szabo I, Figler M, Ludany A, Juricskay I, Szolcsanyi J. Small doses of capsaicin given intragastrically inhibit gastric basal acid secretion in healthy human subjects. J. Physiol. Paris. 1999;93:433–436. doi: 10.1016/s0928-4257(99)00117-5. [DOI] [PubMed] [Google Scholar]
  36. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro. Eur. J. Clin. Invest. 1992;22:396–402. doi: 10.1111/j.1365-2362.1992.tb01480.x. [DOI] [PubMed] [Google Scholar]
  37. Rad R, Prinz C, Neu B, Neuhofer M, Zeitner M, Voland P, Becker I, Schepp W, Gerhard M. Synergistic effect of Helicobacter pylori virulence factors and interleukin-1 polymorphisms for the development of severe histological changes in the gastric mucosa. J. Infect. Dis. 2003;188:272–281. doi: 10.1086/376458. [DOI] [PubMed] [Google Scholar]
  38. SIAP . Cierre de la producción agrícola por cultivo, 1994, Agricultura: Producción anualizada. Servicio de Información Agroalimentaria y Pesquera; SAGARPA, Mexico, D.F.: 2012. Available from: < http://www.siap.gob.mx/index.php?option=com_wrapper&view=wrapper&Itemid=350>. [Google Scholar]
  39. Sicinschi LA, Lopez-Carrillo L, Camargo MC, Correa P, Sierra RA, Henry RR, Chen J, Zabaleta J, Piazuelo MB, Schneider BG. Gastric cancer risk in a Mexican population: role of Helicobacter pylori CagA positive infection and polymorphisms in interleukin-1 and -10 genes. Int. J. Cancer. 2006;118:649–657. doi: 10.1002/ijc.21364. [DOI] [PubMed] [Google Scholar]
  40. Sipetic S, Tomic-Kundakovic S, Vlajinac H, Jankovic S, Marinkovic J, Maksimovic J. Diet and gastric cancer. Vojnosanit. Pregl. 2003;60:697–705. doi: 10.2298/vsp0306697s. [DOI] [PubMed] [Google Scholar]
  41. Srinivasan MR, Sambaiah K, Satyanarayna MN, Rao MVL. Influence of red pepper and capsaicin on growth, blood constituents, and nitrogen balance in rats. Nutr. Rep. Int. 1980;21:455–467. [Google Scholar]
  42. Stewart BW, Kleihues P. World Cancer Report. IARC Press Lyon; France: 2003. [Google Scholar]
  43. Torres J, Perez-Perez GI, Leal-Herrera Y, Munoz O. Infection with CagA+ Helicobacter pylori strains as a possible predictor of risk in the development of gastric adenocarcinoma in Mexico. Int. J. Cancer. 1998;78:298–300. doi: 10.1002/(SICI)1097-0215(19981029)78:3<298::AID-IJC6>3.0.CO;2-Q. [DOI] [PubMed] [Google Scholar]
  44. Tovar-Guzman V, Hernandez-Giron C, Barquera S, Rodriguez-Salgado N, Lopez-Carrillo L. Epidemiologic panorama of stomach cancer mortality in Mexico. Arch. Med. Res. 2001;32:312–317. doi: 10.1016/s0188-4409(01)00290-9. [DOI] [PubMed] [Google Scholar]
  45. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med. 2001;345:784–789. doi: 10.1056/NEJMoa001999. [DOI] [PubMed] [Google Scholar]
  46. Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Gastric mucosal cytokine levels in relation to host interleukin-1 polymorphisms and Helicobacter pylori cag A genotype. Scand. J. Gastroenterol. 2005;40:530–539. doi: 10.1080/00365520510012299. [DOI] [PubMed] [Google Scholar]
  47. Vincenzi B, Patti G, Galluzzo S, Pantano F, Venditti O, Santini D, Ruzzo A, Schiavon G, Caraglia M, Marra M, Graziano F, Tonini G. Interleukin 1beta-511T gene (IL1beta) polymorphism is correlated with gastric cancer in the Caucasian population: results from a meta-analysis. Oncol. Rep. 2008;20:1213–1220. [PubMed] [Google Scholar]
  48. Wang P, Xia HH, Zhang JY, Dai LP, Xu XQ, Wang KJ. Association of interleukin-1 gene polymorphisms with gastric cancer: a meta-analysis. Int. J. Cancer. 2007;120:552–562. doi: 10.1002/ijc.22353. [DOI] [PubMed] [Google Scholar]
  49. World Cancer Research Fund/American Institute for Cancer Research . Food, Nutrition, Physical Activity, and the Prevention of Cancer: a Global Perspective. AICR; Washington, DC: 2007. [Google Scholar]
  50. Yeoh KG, Kang JY, Yap I, Guan R, Tan CC, Wee A, Teng CH. Chili protects against aspirin-induced gastroduodenal mucosal injury in humans. Dig. Dis. Sci. 1995;40:580–583. doi: 10.1007/BF02064374. [DOI] [PubMed] [Google Scholar]

RESOURCES