Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2013 Apr 29;8(4):e62054. doi: 10.1371/journal.pone.0062054

A Universal Vector for High-Efficiency Multi-Fragment Recombineering of BACs and Knock-In Constructs

Karamjit Singh Dolt 1,2,#, Melanie L Lawrence 1,#, Eve Miller-Hodges 1, Joan Slight 1, Anna Thornburn 1, Paul S Devenney 1, Peter Hohenstein 1,2,*
Editor: Elias T Zambidis3
PMCID: PMC3639282  PMID: 23637962

Abstract

There is an increasing need for more efficient generation of transgenic constructs. Here we present a universal multi-site Gateway vector for use in recombineering reactions. Using transgenic mouse models, we show its use for the generation of BAC transgenics and targeting vectors. The modular nature of the vector allows for rapid modification of constructs to generate different versions of the same construct. As such it will help streamline the generation of series of related transgenic models.

Introduction

The generation of transgenic animals has become a central aspect of many biological, biomedical and agricultural projects. There are numerous examples of transgenic models currently being used in research, including ectopic overexpression, site-specific recombination (mainly Cre and CreERT2), reporter models as well as knock-in and knock-out lines. Using these types of models, virtually any question can now be answered in vivo in model organisms such as the mouse. However, this limitless potential makes the requirements for model design and generation increasingly strenuous. For instance, whereas conditional knockout experiments were previously achieved using simple Cre alleles, it is now becoming increasingly common to use a Cre driver for one project, a CreERT2 driver for the next, and even GFP-Cre and/or GFP-CreERT2 alleles which combine both reporter and recombinase activity in a single construct (see for instance [1]). There is little doubt that additional variants, for instance fusion constructs with other fluorescent reporters, 2A-based fusion constructs [2] or newly developed site-specific recombinase systems [3], [4] will further increase the need for more flexible cloning systems to generate overexpression or targeting vectors.

It has been shown by many studies that large genomic constructs like YACs, BACs and PACs provide the best option for physiologically-relevant expression of constructs [5]. The development of ‘recombineering’, efficient recombination-based cloning methods in E. coli [6], has made BAC vectors the optimal tool for the creation of transgenic models due to a combination of size and ease of manipulation. Moreover, if needed, parts from a (recombineered) BAC can be sub-cloned via a gap repair approach into a normal plasmid backbone for targeting of the corresponding locus [6]. Finally, BAC recombineering can be adapted to high-throughput pipelines for the generation of BAC transgenes and targeting vectors [7], [8]. Thus, improving the efficiency of making variant BAC constructs would have an impact on mouse model generation beyond BAC transgenics themselves.

Here we describe a universal BAC recombineering vector that utilizes Multisite Gateway® cloning technology [9]. The vector consists of Gateway entry cassettes followed by a combined prokaryotic and eukaryotic positive selectable marker. Up to 4 fragments consisting of ORFs, pA sites, IRES sequences or other functional elements can be inserted into or removed from this vector in a single reaction. Individual fragments can easily be replaced by other fragments in a modular fashion. We demonstrate the generation of specific BAC mini-targeting vectors, the efficient replacement of individual fragments and the use of these constructs as BAC transgenic vectors or as a basis for knock-in vectors.

Materials and Methods

Multisite Gateway Constructs

All Gateway reactions were done as described in the manual of the MultiSite Gateway® Pro Plus kit (Invitrogen). Gateway fragments were PCR amplified, cloned in the appropriate pDONR vector via a BP reaction and sequence verified. eGFP-Cre and eGFP-CreERT2 template vectors were a kind gift from Dr. Akio Kobayashi (Harvard Medical School). All primer sequences used for amplification and pDNOR vectors are given in table 1. We performed a four-fragment LR+ reaction with the pENTR eGFPCRE L1-R5, pENTR IRES L5-L4, pENTR puroR R4-R3, pENTR pA L3-L2 and pcDNA6.2/V5-pL-DEST vectors to make pcDNA6.2-GFPCre-IRES-puroR-pA. The combination of the four fragments was sub-cloned as an attB1/attB2 fragment into pDONR/Zeo to make pENTR/Zeo-GFPCre-IRES-puroR-pA via a reverse BP reaction. We cloned a Gateway ENTR cassette (Gateway® vector conversion system, Invitrogen) into the EcoRV site of PL451 [10] and sub-cloned the attB1/attB2 fragment from pENTR/Zeo-GFPCre-IRES-puroR-pA into this via a standard LR reaction. The resulting vector was designated pMULTIrec. All vectors and plasmids in this work can be obtained from Addgene or by request from the corresponding author.

Table 1. Primers and pDONR vectors used in the generation of pENTR vectors.

Fragment Forward Reverse pDONR Result
eGFPCre GGGGACAAGTTTGTACAAAAAAGCAG GCTTAACCATGGTGAGCAAGGGCGAG GGGGACAACTTTTGTATACAAAGTTG TCTAATCGCCATCTTCCAG pDONRP1-P5r pENTReGFPCre L1-R5
mKate2 GGGGACAAGTTTGTACAAAAAAGCAG GCTTAATGGTGAGCGAGCTGATTA GGGGACAACTTTTGTATACAAAGTTG TCTATCTGTGCCCCAGTTTG pDONRP1-P5r pENTRmKate2 L1-R5
eGFP-CreERT2 GGGGACAAGTTTGTACAAAAAAGCAG GCTTAACCATGGTGAGCAAGGGCGAG GGGGACAACTTTTGTATACAAAGTTG TTCAAGCTGTGGCAGGGAA pDONRP1-P5r pENTReGFPCreERT2 L1-R5
mCherry GGGGACAAGTTTGTACAAAAAAGCAG GCTTAATGGTGAGCAAGGGCGAG GGGGACAACTTTTGTATACAAAGTTG TCTACTTGTACAGCTCGTCCATG pDONRP1-P5r pENTRmCherry L1-R5
IRES GGGGACAACTTTGTATACAAAAGTTG TGGTTATTTTCCACCATATTGCCGTC GGGGACAACTTTGTATAGAAAAGTTG GGTGTATTATCATCGTGTTTTT pDONRP5-P4 pENTR IRESL5-L4
puroR GGGGACAACTTTTCTATACAAAGTTG CTACCATGACCGAGTACAAGCCC GGGGACAACTTTATTATACAAAGTTG TTCAGGCACCGGGCTTGCG pDONRP4r-P3r pENTR puroRR4-R3
pA GGGGACAACTTTGTATAATAAAGTTG CTCTGTGCCTTCTAGTTGCCAGCC GGGGACCACTTTGTACAAGAAAGCTG GGTAATAGAGCCCACCGCATCC pDONRP3-P2 pENTR pAL3-L2

Recombineering

All recombineering reactions were done using the pSim17 plasmid [11] as described elsewhere [12]. The TK counter selection cassette was introduced via recombineering with PL611 as described [11]. BAC constructs used for microinjection were subjected to an additional recombineering step to remove the loxP site from the vector backbone. An AmpR selection cassette was amplified from pRosa26-DEST [13] using forward primer gcttatcgatgataagctgtcaaacatgagaattgatccggaacccttaatcttacaatttaggtggcact and reverse primer tccgatgcaagtgtgtcgctgtcgacggtgaccctatagtcgagggacctaatatgagtaaacttggtctga and recombineered into the BAC as described [12]. Correct integration in the BAC backbone was confirmed using PCR (LoxPtoAmptestF: gtgccgaggatgacgatgagc; LoxPtoAmptestR: ccgtgccggcacgttaacc).

BAC Microinjections

BAC constructs were isolated using the Large Construct kit (Qiagen). They were resuspended in BAC injection buffer (10 mM TRIS-HCl pH 7.5; 0.1 µM EDTA; 100 mM NaCl; 70 µM spermidine; 30 µM polyamines (freshly made) and injected in F1 CBA/C57BL/6J E0.5 fertilized oocytes at a concentration of 0.5 or 1 ng/µl using a Femtotip injection needle (Eppendorf) with an inner diameter of 0.2 um. Injected embryos were cultured overnight and transferred to pseudo-pregnant CD1 females. BACs used were bMQ317G18 (Nanog) and RPCI23-311C1 (Six2).

ES Cell Targeting

The retrieved Six2-GCiP targeting construct was linearized with NotI and electroporated into G4 ES cells [14] as described previously [15]. Clones were screened for correct homologous recombination by long range PCR using 3′ external primers and a nested PCR (F: TCGACTAGAGCTTGCGGAACC; R: ATGACTCGGAAGACACAGGCTACT; Fnested: CAAATAGTATAGGAACTCATGGTC; Rnested: GCAGAAGTGTGGGCTATG). Southern blot was performed to analyse the correct integration at the 5′ end in the clones selected by long range PCR. Genomic DNA was digested with EcoRI. A 500 nt PCR fragment (F: AGCACCGAAGTTGTATCTG; R: AATGCTGCTCCTTCTGTC) was used as probe. A correct targeted clone was used for the generation of mice using the diploid morula aggregation method [16].

iPS Reprogramming

iPS cells were generated using a piggyBac system expressing Oct4, Sox2, Klf4, c-Myc and Lin28 from a single vector as a 2A-linked polypeptide as described [17].

Mouse Models

All mouse models were genotyped via PCR with the following primers. Six2-GCiP BAC and Six2 +/GCiP knock-in (Cre/F: GCATTACCGGTCGATGCAACGAGTGATGAG; Cre/R: GAGTGAACGAACCTGGTCGAAATCAGTGCG); Nanog-KiP BAC (mKate2/F: TGACCGCTACCCAGGACACCA; mKate2/R: GACGCCGGGCATCTTGAGG); Rosa26 tdRFP (Gt(ROSA)26Sortm1Hjf) [18] (R26g2/F: TGTTATCAGTAAGGGAGCT; R26g2/Rmut: TGTTATCAGTAAGGGAGCT; R26g2/Rwt: CACACCAGGTTAGCCTTTA).

Kidney Organ Culture and Time-lapse Imaging

Embryonic kidneys from Six2 +/GCiP x Rosa26 +/tdRFP crosses were micro-dissected and were cultured on Transwell Multiwell polyester membrane 0.40 µm pore size inserts in six-well plates (Corning) in 10% Serum DMEM and left in a fully humidified 37°C incubator with 5% CO2 for an hour until the kidneys had attached to the membranes and the epithelial structures were flat enough for the microscope to be focused accurately. Kidneys were scanned every half hour for the 2 days’ period of culture using a Nikon TiE (Perfect Focus System) microscope with NIS-Elements 4.0 equipped with an incubation chamber at 37°C, 100% humidity, and 5% CO2. Cultures were started from E13.5 kidneys and followed for 48 hours. Antibody staining was done using primary anti-Cdh1 monoclonal antibodies (610182, BD Transduction laboratories) and secondary Alexa Fluor®647 Donkey-anti-Mouse IgG (A31571, Life Technologies).

Ethics statement

All animal work was approved by the ethical review committee of the University of Edinburgh and according to UK home office legislation (project license PPL 60/3788).

Results

As a basis for our modular recombineering construct (pMULTIrec) we generated a 4- fragment construct (eGFPCre-IRES-puromycinR-pA) upstream of a combined prokaryotic/eukaryotic selection cassette (Figure 1). Gateway fragments were PCR amplified, cloned into pDONR vectors and sequence verified (data not shown). Several sub-cloning steps were necessary due to antibiotic resistance incompatibility of the vectors. The resulting vector contains 5′ and 3′ multiple cloning sites to allow cloning of homologous arms for a recombineering reaction. Via recombineering, this construct can be targeted to the start codon of any gene of interest on a BAC to express an eGFPCre fusion protein under the control of the BAC gene promoter as well as puromycin resistance from the locus of interest. Additional flexibility of the construct can be obtained through reverse Gateway reactions (Figure 2).

Figure 1. Generation of pMULTIrec.

Figure 1

A. Four multisite Gateway compatible fragments (eGFPCre; IRES; puroR and pA) were PCR amplified and cloned into the appropriate pDONR vector to make four pENTR vectors. B. The four pENTR clones were combined into one four-fragment Gateway clone. C. The four-fragment cassette was moved to pDONR/Zeo to change antibiotic resistance and subsequently sub-cloned to a vector carrying a Gateway ENTR cassette upstream of a dual selection (Neo/Kan) cassette. D. The resulting pMULTIrec vector.

Figure 2. Additional flexibility in pMULTIrec.

Figure 2

A. Detailed schematic (not to scale) of att configuration and multiple cloning sites in pMULTIrec. B. Example of Gateway cassette exchange. Any cDNA of interest can be PCR-amplified cloned into the desired pDONR vector to generate a new pENTR clone. The same pDONR vector is used in a BP reaction with pMULTIrec, transformed in ccdB R bacteria and selected using Amp/Cam double selection. This generates a new DEST vector with the ENTR cassette in place of the desired fragment. This new cDNA is transferred to this new DEST vector via a standard LR reaction. C. Additional pMULTIrec variants we have generated.

Each of the four Gateway cassettes is flanked by a different combination of specific att sites (Figure 2a). Therefore, a BP reaction with any of the multi-fragment pDONR clones will result in the replacement of only the corresponding fragment by a new ENTR cassette; this can subsequently be replaced by a new functional element through a standard LR reaction (Figure 2b). In this way we could rapidly generate versions of the vector to express eGFP- CreERT2, mKate2 (far-red fluorescent protein) and mCherry together with the puromycin resistance gene (Figure 2c; Table 2). Other fragments can be exchanged the same way.

Table 2. Efficiency of the Gateway reactions used.

Constructs Gateway reaction Colonies tested Correct Digest pattern Resulting construct
pMULTIrec+pDONR P1-P5r BP 8 5 pDEST-IRES-puro-pA
pENTR mKate2 L1-R5+ pDEST-IRES-puro-pA LR 12 5 mKate2-IRES-puro-pA
pENTR eGFPCreERT2 L1-R5+ pDEST-IRES-puro-pA LR 12 5 eGFPCreERT2-IRES-puro-pA
pENTR mCherry L1-R5+ pDEST-IRES-puro-pA LR 3 3 mCherry-IRES-puro-pA

Kidney development is a dynamic process that starts with bidirectional communication between the mesenchymal cells from the metanephric mesenchyme and the epithelial cells from the invading ureteric bud; this results in the mesenchymal cells undergoing a mesenchyme-to-epithelial transition to form the nephrons, the filtering units in the adult kidney [19]. Expression of the Six2 gene labels the nephrogenic progenitor cells in the developing kidney, as was shown using extensive lineage tracing and based on several different targeting constructs for the same locus [1]. This provided us with a useful target locus to test our system. We first inserted 5′ and 3′ homologous arms to allow us to target the eGFPCre-IRES-puromycinR-pA recombineering vector (hereafter referred to as GCiP) to the start codon of the Six2 locus. The resulting construct was recombineered into a BAC carrying the complete Six2 locus (Figure 3a; Table 3) and was microinjected into oocytes to generate transgenic mice. The GFP expression pattern of embryos positive for the Six2-GCiP BAC (Figure 3b) was identical to the pattern described before [1], indicating no ectopic expression domains resulted from any site or copy number effects. Within the developing kidney GFP positive cells were found in the cap mesenchymal cells lining the ureteric bud (Figure 3c,d), the known location of the Six2-positive progenitor cells [1]. We therefore concluded that our universal BAC recombineering vector can faithfully express inserts via BAC transgenics.

Figure 3. The Six2-GCiP BAC construct made using pMULTIrec.

Figure 3

A. The four-fragment and dual selection cassette from pMULTIrec was cloned in a Six2 containing BAC replacing the start codon. B. GFP imaging of a E13.5 embryo carrying the Six2-GCiP BAC. C. GFP imaging of whole mount E13.5 kidneys. D. E13.5 Six2-GCiP BAC kidneys cultured for four days showing GFP expression in the cap mesenchyme and Cdh1 expression in the ureteric bud.

Table 3. Efficiency of the recombineering reactions used.

Constructs Colonies tested Correct 5′ and 3′ PCRbased test for integration Desired construct
Six2-eGFPCre-IRES-puro-pA+Six2-BAC 10 10 Six2-eGFPCre-IRES-puro-pA BAC
Nanog-mKate2-IRES-puro-pA+Nanog-BAC 6 6 Nanog-mKate2-IRES-puro-pA BAC

To determine if our universal construct allows expression from endogenous loci, we retrieved a targeting construct with 7 and 5 kb homologous arms from the Six2-GCiP BAC into a plasmid backbone, and added a TK counter selection gene through a second recombineering reaction (Figure 4a). This vector was used to target the endogenous Six2 locus in mouse embryonic stem (ES) cells (Figure 4b). A combined long-range PCR and Southern blot approach was used to identify correctly targeted clones. We tested 95 G418+ gancyclovir resistant clones via long-range PCR to detect correct integration at the 3′ end of the targeting construct, which yielded 22 candidate clones (data not shown). Eight of these candidate clones were tested via Southern blot screening, 6 of which were confirmed to be correctly targeted (Figure 4c), which we used to generate Six2 +/ GCiP knock-in mice. As shown for previous Six2 knockout and knock-in models [1], [20], heterozygous Six2 +/GCiP mice were viable, healthy and fertile (data not shown).

Figure 4. The Six2 +/GCiP allele based on the pMULTIrec system.

Figure 4

A. Retrival of the Six2-GCIP targeting vector. B. Targeting of the Six2 locus. C. Confirmation of correct targeting of the Six2 locus (restriction enzyme and probe indicated in figure 4B). D. Six2 +/GCiP Rosa26 tdRFP kidney in culture showing GFP and RFP signals. E. Six2 +/GCiP Rosa26 tdRFP kidney in culture showing GFP and RFP signals and Cdh1 antibody staining. CM: cap mesenchyme; UB: ureteric bud; N: nephron.

The Six2 +/GCiP allele was tested in kidney organ culture after crossing to a Rosa26 tdRFP Cre reporter allele [18] to follow the lineage of the Six2 positive cells and test the Cre moiety of the construct. We used time-lapse imaging of the brightfield, GFP and tdRFP signals to illustrate the dynamics of this lineage trace (Figure 4e and Movie S1). In accordance with the role of Six2-positive cells as nephrogenic progenitor cells, green cells (GFP-positive only) were found in the cap mesenchyme surrounding the ureteric bud. These cells rapidly became RFP-positive while remaining GFP-positive, due to the Cre-mediated activation of the tdRFP reporter allele. As Six2-positive cells go through the MET during nephron development they switch off Six2 expression [21], [22], and as a result the post-MET nephrons on the Six2 +/GCiP Rosa26 +/tdRFP kidneys were GFP-negative but remained RFP- positive (Figure 4f and Movie S1). These data confirm that our universal recombineering vector can be used for the generation of targeting vectors as well as the generation of transgenic BAC models.

To further illustrate the flexibility of our vector, we generated a mouse model that expresses the mKate2-IRES-puromycinR-pA (KiP) cassette from the Nanog locus using a BAC construct (Figure 5a). Nanog is an essential pluripotency gene in embryonic stem cells, and its activation is an important marker for full reprogramming of somatic cells into induced pluripotent stem (iPS) cells [23]. MEFs from the Nanog-KiP mouse model, as well as MEFs from wild type littermates, were used to generate iPS cells using a piggyBac-based reprogramming system [17]. Whereas MEFs from the wild type did not show any fluorescence, the Nanog-KiP BAC iPS cells showed a clear signal in the far-red channel (Figure 5b–e). We observed some degree of intercellular variation in the signal, which could be the result of the intraclonal fluctuations in Nanog expression [24].

Figure 5. The Nanog-KiP BAC made from a modified pMULTIrec vector.

Figure 5

A. Generation of the Nanog-KiP BAC. B, C. mKate2 (B) and brightfield signals of iPS clones derived from Nanog-KiP BAC MEFs. D, E. mKate2 (B) and brightfield signals of iPS clones derived from wild type MEFs.

Discussion

Here we describe a universal, high-efficiency vector, pMULTIrec, for the generation of multi-fragment expression constructs that is compatible with Gateway® cloning. Starting from a four-fragment construct, any of the inserts can efficiently be replaced by another fragment using a two-step Gateway reaction. Although so far we have only generated four- fragment constructs, using the commercially available MultiSite Gateway Pro Plus® system (Invitrogen) it will be possible to make 1, 2 and 3-fragment constructs as well, providing a truly universal vector system.

Our system has several features that make it a flexible and efficient starting point for the generation of transgenic animal models. First, through implementation of the MultiSite Gateway cloning system different variations of transgenic constructs can easily be generated. Here we demonstrate this flexibility by making variations of BAC targeting vectors, and modifying an existing targeting construct that was retrieved from a BAC recombineered with this construct should be equally efficient. In theory it should be possible to remodify recombineered BAC constructs generated with the pMULTIrec system; however this would require ccdB R bacteria suitable for maintaining BACs which to our knowledge are not available. Second, the 5′ and 3′ multiple cloning sites allow easy insertion of short homologous arms for use in the BAC recombineering steps. Here we have generated these arms through PCR using the target BAC as template. However, as prices for commercial gene synthesis services are continuously decreasing, this might be a viable option as well. Third, after integration of the construct into the mouse genome, FLP recombinase can be used to remove the dual selection cassette allowing it to be reused in another construct.

Other ways of generating recombineering cassettes include PCR approaches and DNA synthesis. However, vectors resulting from any PCR-based method must be sequence-verified for every construct or project. This is the case with commercially available systems, like In-Fusion® (Clontech) and non-commercial systems, like SLIC [25] and SLiCE [26]. Synthesis of DNA fragments of the sizes needed for the generation of complete expression cassettes is still financially challenging for many laboratories, and difficult sequences to synthesize, like high GC or repetitive sequences, will add additional costs and delays. The power of the pMULTIrec system over these alternatives lies in its modular nature. Once a fragment has been generated and sequence-verified, it can be re-used in unlimited configurations.

So far we have generated 4 different versions of the vector, each with a varying first fragment, and targeted them to four different BACs and/or endogenous genes. In our experience a variation of the pMULTIrec vector can be generated in a few days once the fragment is available in the appropriate Gateway ENTR clone. Our constructs have been knock-in constructs at the start codon of the gene of interest. However, with the correct design of the 5′ homologous arm it should also be possible to use our vector for C-terminal tagging of genes. In addition, although all our work has been focused on the mouse as experimental system, the vector presented here can just as easily be used for other model organisms for which ES cell- or BAC-mediated transgenesis is possible. Recent developments in the use of Zinc Finger Nuclease- and TAL Effector Nuclease-assisted homologous recombination with short homologous arms in many different cell types from different species [27], [28] could further extend the use of the vector described here; the same short homologous arms that are used here to target a BAC construct might be sufficient to target endogenous loci with the help of engineered nucleases. This would make the system described here a truly universal one.

Supporting Information

Movie S1

Time-lapse movie of 2-day culture of E13.5 Six2 +/GCiP Rosa26 tdRFP kidneys.

(MOV)

Funding Statement

KSD was supported by Kidney Research UK (RP23/2009). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Kobayashi A, Valerius MT, Mugford JW, Carroll TJ, Self M, et al. (2008) Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development. Cell Stem Cell 3: 169–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Szymczak AL, Workman CJ, Wang Y, Vignali KM, Dilioglou S, et al. (2004) Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat Biotechnol 22: 589–594. [DOI] [PubMed] [Google Scholar]
  • 3. Anastassiadis K, Fu J, Patsch C, Hu S, Weidlich S, et al. (2009) Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice. Dis Model Mech 2: 508–515. [DOI] [PubMed] [Google Scholar]
  • 4. Nern A, Pfeiffer BD, Svoboda K, Rubin GM (2011) Multiple new site-specific recombinases for use in manipulating animal genomes. Proc Natl Acad Sci U S A 108: 14198–14203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Giraldo P, Montoliu L (2001) Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Res 10: 83–103. [DOI] [PubMed] [Google Scholar]
  • 6. Copeland NG, Jenkins NA, Court DL (2001) Recombineering: a powerful new tool for mouse functional genomics. Nat Rev Genet 2: 769–779. [DOI] [PubMed] [Google Scholar]
  • 7. Poser I, Sarov M, Hutchins JR, Heriche JK, Toyoda Y, et al. (2008) BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals. Nat Methods 5: 409–415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, et al. (2011) A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474: 337–342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Sasaki Y, Sone T, Yoshida S, Yahata K, Hotta J, et al. (2004) Evidence for high specificity and efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system. J Biotechnol 107: 233–243. [DOI] [PubMed] [Google Scholar]
  • 10. Liu P, Jenkins NA, Copeland NG (2003) A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res 13: 476–484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Chan W, Costantino N, Li R, Lee SC, Su Q, et al. (2007) A recombineering based approach for high-throughput conditional knockout targeting vector construction. Nucleic Acids Res 35: e64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Sharan SK, Thomason LC, Kuznetsov SG, Court DL (2009) Recombineering: a homologous recombination-based method of genetic engineering. Nat Protoc 4: 206–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hohenstein P, Slight J, Ozdemir DD, Burn SF, Berry R, et al. (2008) High-efficiency Rosa26 knock-in vector construction for Cre-regulated overexpression and RNAi. Pathogenetics 1: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. George SH, Gertsenstein M, Vintersten K, Korets-Smith E, Murphy J, et al. (2007) Developmental and adult phenotyping directly from mutant embryonic stem cells. Proc Natl Acad Sci U S A 104: 4455–4460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Martinez-Estrada OM, Lettice LA, Essafi A, Guadix JA, Slight J, et al. (2010) Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet 42: 89–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Gertsenstein M, Nutter LM, Reid T, Pereira M, Stanford WL, et al. (2010) Efficient generation of germ line transmitting chimeras from C57BL/6N ES cells by aggregation with outbred host embryos. PLoS One 5: e11260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Yusa K, Rad R, Takeda J, Bradley A (2009) Generation of transgene-free induced pluripotent mouse stem cells by the piggyBac transposon. Nat Methods 6: 363–369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Luche H, Weber O, Nageswara Rao T, Blum C, Fehling HJ (2007) Faithful activation of an extra-bright red fluorescent protein in “knock-in” Cre-reporter mice ideally suited for lineage tracing studies. Eur J Immunol 37: 43–53. [DOI] [PubMed] [Google Scholar]
  • 19. Costantini F, Kopan R (2010) Patterning a complex organ: branching morphogenesis and nephron segmentation in kidney development. Dev Cell 18: 698–712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Self M, Lagutin OV, Bowling B, Hendrix J, Cai Y, et al. (2006) Six2 is required for suppression of nephrogenesis and progenitor renewal in the developing kidney. EMBO J 25: 5214–5228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Karner CM, Das A, Ma Z, Self M, Chen C, et al. (2011) Canonical Wnt9b signaling balances progenitor cell expansion and differentiation during kidney development. Development 138: 1247–1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Park JS, Ma W, O’Brien LL, Chung E, Guo JJ, et al. (2012) Six2 and Wnt Regulate Self-Renewal and Commitment of Nephron Progenitors through Shared Gene Regulatory Networks. Dev Cell 23: 637–651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Silva J, Nichols J, Theunissen TW, Guo G, van Oosten AL, et al. (2009) Nanog is the gateway to the pluripotent ground state. Cell 138: 722–737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chambers I, Silva J, Colby D, Nichols J, Nijmeijer B, et al. (2007) Nanog safeguards pluripotency and mediates germline development. Nature 450: 1230–1234. [DOI] [PubMed] [Google Scholar]
  • 25. Li MZ, Elledge SJ (2007) Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods 4: 251–256. [DOI] [PubMed] [Google Scholar]
  • 26. Zhang Y, Werling U, Edelmann W (2012) SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Res 40: e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, et al. (2011) Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29: 731–734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Urnov FD, Miller JC, Lee YL, Beausejour CM, Rock JM, et al. (2005) Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435: 646–651. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Movie S1

Time-lapse movie of 2-day culture of E13.5 Six2 +/GCiP Rosa26 tdRFP kidneys.

(MOV)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES