Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 May 7.
Published in final edited form as: J Immunol. 2010 Jul 16;185(4):2020–2031. doi: 10.4049/jimmunol.0902566

c-Met and its ligand HGF regulate mature B cell survival in a pathway induced by CD741

Maya Gordin 1, Melania Tesio 1, Sivan Cohen 1, Yael Gore 1, Frida Lantner 1, Lin Leng 2, Richard Bucala 2, Idit Shachar 1,*
PMCID: PMC3646513  NIHMSID: NIHMS451962  PMID: 20639480

Abstract

The signals regulating the survival of mature splenic B cells have become a major focus in recent studies of B cell immunology. Durable B-cell persistence in the periphery is dependent on survival signals that are transduced by cell surface receptors. Here, we describe a novel biological mechanism involved in mature B cell homeostasis, the HGF/c-Met pathway. We demonstrate that c-Met activation by hepatocyte growth factor / scatter factor (HGF) leads to a survival cascade, while its blockade results in induction of mature B cell death. Our results emphasize a unique and critical function for c-Met signaling in the previously described MIF/CD74-induced survival pathway. Migration inhibitory factor (MIF) recruits c-Met to the CD74/CD44 complex and thereby enables the induction of a signaling cascade within the cell. This signal results in HGF secretion, which stimulates the survival of the mature B cell population in an autocrine manner. Thus, the CD74 - HGF/c-Met axis defines a novel physiologic survival pathway in mature B cells, resulting in the control of the humoral immune response.

Introduction

During their development, B cells encounter various checkpoints that control cell survival. Under steady state conditions, the number and distribution of B cells is under homeostatic control maintained by a balance between survival and apoptosis.

Regulation of mature B cell survival involves multiple mechanisms. The B cell receptor (BCR) provides survival signals essential for maintaining the mature B cell pool. Deletion of the Igh gene (1) or conditional deletion of either Igh or the signal-transducing Cd79a (Igα) genes (2) leads to a loss of B cells. In addition, survival of mature naive B cells depends on signals delivered by the ligand-receptor pair, BAFF and BAFF-receptor (BAFF-R) (3, 4). Mice that lack BAFF expression, or that are subjected to treatments designed to block the action of BAFF, fail to produce or to maintain a mature B cell pool (5-7).

Recently, we described an additional mechanism that regulates B cell survival, which depends on CD74 (invariant chain, Ii). CD74 is a type II integral membrane protein, containing a short N-terminal cytoplasmic tail of 28 amino acids (aa), followed by a single 24-aa transmembrane region, and an approximately 150-aa lumenal domain. The CD74 chain was originally thought to function mainly as an MHC class II chaperone, promoting the exit of MHC class II molecules from the endoplasmic reticulum (ER), directing them to endocytic compartments, preventing peptide binding within the ER, and contributing to peptide editing in the MHC class II compartment (8).

In addition to its chaperone function, CD74 was shown to have a role as an accessory-signaling molecule. A small proportion of CD74 is modified by the addition of chondroitin sulfate (CD74-CS), and this form of CD74 is expressed on the surface of antigen presenting cells, including monocytes and B cells. Antibody blocking studies have shown that CD74-CS interacts with CD44 (9, 10). In addition, it was shown that macrophage migration inhibitory factor (MIF) binds to the CD74 extracellular domain on macrophages, a process that results in initiation of a signaling pathway in these cells (11).

Our studies have shown that CD74 expressed on B cells is directly involved in shaping the peripheral B cell populations by regulating mature B cell survival (12), through a pathway leading to the activation of transcription mediated by the NF-κB p65/RelA homodimer and its co-activator, TAFII105 (13, 14). CD74 stimulation by MIF activates the Syk and PI3K/Akt pathways, leading to NF-κB activation, enabling entry of the stimulated B cells into the S phase, an increase in DNA synthesis, cell division, and augmented expression of anti-apoptotic proteins in a CD44-dependent manner. These findings confirmed that surface CD74 functions as a survival receptor (15-17).

Interestingly, the cell surface receptor, CD44, has also been implicated in the regulation of the signaling of the tyrosine kinase receptor, c-Met (18-20), although the precise mechanism of this interaction is unknown.

c-Met is a unique disulfide linked α –β heterodimeric receptor tyrosine kinase with versatile role in regulating numerous biological functions in response to its natural ligand, hepatocyte growth factor/scatter factor (HGF). HGF is a multifunctional cytokine with a domain structure and proteolytic mechanism of activation similar to that of the serine protease, plasminogen. Activation of the HGF/c-Met signaling pathway, which requires phosphorylation of various specific tyrosine residues on c-Met itself, leads to cellular responses including increased motility, proliferation, morphogenesis, and cell survival (21-27).

Little is known about the role of c-Met/HGF in the regulation of lymphopoiesis in general and specifically that of B cells. HGF has been reported to regulate hematopoiesis in mouse fetal liver and in adult bone marrow (28, 29), and was found to have a stimulatory effect on immunoglobulin secretion in cultures of mouse splenocytes (30).

Based on the known interactions between c-Met and CD44, we wished to determine whether c-Met is expressed in naïve B cells, and whether it is involved in the regulation of their survival. Here, we demonstrate that naïve murine B cells express both c-Met and its ligand, HGF, which regulate peripheral B cell survival. In addition, our study shows that c-Met participates in controlling MIF-induced signaling by forming a survival complex together with CD74 and CD44 in B cells. These findings establish a key and novel role for HGF/c-Met pair in the regulation of B-cell survival, demonstrating an additional level of control of the humoral immune response.

Materials and Methods

Cells

Spleen cells were obtained from C57BL/6, CD44−/− (31) or CD74−/− (32) mice. All animal procedures were approved by the Animal Research Committee at the Weizmann Institute.

Cells and B cell separation

Spleen cells were obtained from the indicated mice at 6-8 weeks of age, as previously described (33). B cells then were purified from each mouse strain using CD45R beads (BD Biosciences). The purity of the isolated cells (between 96-99%) was confirmed by FACS (using the B220+ marker) following each experiment. Isolation of AA4+

Cells

Purified splenocytes were stained with anti-AA4 Ab conjugated to PE, as previously described (16). Separation of cells was performed using PE-conjugated beads (BD Bioscience). The purity of the isolated cells (between 96-99%) was confirmed by FACS (using the IgD marker (eBioscience)) following each experiment.

Isolation of IgD+ cells: Control IgD+ cells were separated from total splenocytes as previously described (34).

Sorting of the T1, T2, MZ and mature populations was performed using anti-CD45R/B220, anti-CD21 (CR2/CR), anti-CD24 (HSA) and anti-CD23 (all from eBioscience) as previously described (35).

T1 B cells were obtained from 1 week old mice, as previously described (36).

MIF and HGF stimulation

Recombinant murine MIF was prepared in native sequence and purified from an expression system as previously described (37). Contaminating endotoxin was removed by C8 affinity chromatography prior to protein renaturation, and the experimental preparations contained 1800 EU/mg MIF. For MIF stimulation, 1×107 primary B cells were incubated in RPMI medium containing 0.1% (v/v) FCS at 37°C for 3 h. Next, cells were resuspended in medium containing 100 ng/ml of recombinant MIF and incubated at 37° C for various periods. For HGF stimulation, 1×107 primary B cells were incubated in RPMI medium containing 1% (v/v) FCS at 37°C for 3h. Cells were then resuspended in medium containing 10 ng/ml of recombinant HGF (R&D systems) and incubated at 37° C for the indicated periods.

CD74 stimulation

First, 1 × 107 primary B cells were suspended in 1 mL RPMI medium containing 10% (vol/vol) FCS. Next, 5 μg antibody specific for the extracellular domain of both murine and human CD74 (C-16; Santa Cruz Technologies, Santa Cruz, CA) or an isotype control (Santa Cruz) was added to cells and incubated at 37° C for various periods.

HGF and c-Met blocking

For HGF blocking, 1 × 107 B cells were incubated in 1 ml of RPMI medium containing 0.1% (v/v) FCS in the presence of 3μg/ml anti-murine HGF (R&D systems) and 3μg/ml anti-isotype control antibody for 8h at 37°C. For c-Met blocking, 1 × 107 B cells were incubated in 1ml of RPMI medium containing 0.1% (v/v) FCS in the presence of 0.3 μg/ml c-Met inhibitor, PH-665752 (a kind gift from Pfizer) at 37°C.

RNA isolation and reverse transcription

Total RNA was isolated from cells using the Tri Reagent kit (MRC). Reverse transcription was carried out using Superscript II RT (Gibco-BRL). Primers that were used included:

c-Met: 5′ GACTTCAGCCATCCCAATGT

3′ GGTGAACTTCTGCGTTTGC

HGF: 5′ AGC GCT CTC CCT TCT TCT TT

3′ TCA CAC AGA ATC AGG CAA GA

Bcl-2: 5′ CAGGGCGATGTTGTCC

3′ CTGGCATCTTCTCCTTCC

Cyclin E: 5′ GAAAATCAGACCACCCAGAGCC

3′ GAAATGATACAAAGCAGAAGCAGCG

HPRT: 5′ GAGGGTAGGCTGGCCTATGGCT

3′ GTTGGATACAGGCCAGACTTTGTTG

Real-time reverse transcription –PCR analysis

Levels of mRNA of Actin, c-Met and Bcl-2 were analyzed by quantitative real-time RT-PCR using a Light-Cycler instrument (Roche Diagnostics, Mannheim, Germany). Total RNA was isolated from cells using the Tri Reagent Kit (MRC). Reverse transcription was carried out using Superscript II RT (Gibco-BRL). The reaction volume (10 ml) contained 3 mM MgCl2, LightCycler HotStart DNA SYBR Green I mix (Roche Diagnostics), specific primer pairs, and 2.5 μg of cDNA. Conditions for PCR were as follows: 10 minutes at 95°C followed by 40-50 cycles of 15 seconds at 95°C, 15 seconds at 60°C, and 15 seconds at 72°C. PCR was performed in duplicates, as previously described (38). Primer sequences were as follows:

β-Actin, as previously described (39)

c-Met 5′- ~GTGCCAAGCTACCAGT-3′

5′-CTTCGTACAAGGCGTCT-3′

Bcl-2 5′-GCTACCGTCGTGACTT-3′

5′-GCCGGTTCAGGTACTC-3′.

β-actin levels were used to normalize samples for calculation of the relative expression levels of all the genes (c-Met and Bcl-2). The results were evaluated for significance using the t test, and the p value was less than .05.

ELISA

B cells from C57BL/6 mice were incubated for 8h in the presence or absence of MIF (100 ng/ml). Cell supernatants were collected, and the HGF levels were determined by enzyme-linked immunosorbent assay (ELISA) kit (R&D system), according to the manufacturer’s instructions.

HGF intracellular staining

Total splenocytes (107 cells/mL) from control mice were used directly, or stimulated with anti-CD74 (C-16, Santa Cruz Biotechnology) or isotype control Ab (Santa Cruz biotechnology) for 5h. HGF intracellular staining was performed using the Cell Fixation/Permeabilization Kit for Intracellular Cytokine Analysis according to the manufacturer’s instructions (BD Cytofix/Cytoperm™ Kit BD Bioscience).The cells were pre-stained with anti-CD45R/B220 and anti-IgD (both from eBioscience). Then, the permeabilized cells were stained with goat-anti mouse HGF (R&D system) followed by donkey anti-goat (Jackson Immuno-Research Laboratories, West Grove, PA).

Preparation of cell extracts

Stimulated cells were lysed in buffer containing: 25 mM Tris, pH 7.4; 2 mM Vanadate; 75 mM β glycophosphate, pH 7.2; 2 mM EDTA; 2 mM EGTA; 10 mM NaPPi; and 0.5% NP-40 in the presence of the following protease inhibitors: 10 μg/ml Leupeptin, 10 μg/ml aprotinin, 10 μg/ml pepstatin, 10 μg/ml chymostatin (Roche), 1mM PMSF (Sigma), and 20 mM N-ethyl-melamide (Sigma).

Immunoprecipitation and western blot

Protein-G Sepharose beads (Pharmacia) were conjugated to c-Met mAb (B-2, SC-8057 Santa Cruz Biotechnology), CD44 (BD Biosciences) or Tyr(P) (Santa Cruz) mAb for 2 hours at 4°C, followed by three washes in PBS. Beads were added to the cell lysates and c-Met, CD44 or Tyr(P) proteins were immunoprecipitated overnight. The protein G bound material was washed three times with PBS containing 0.1% SDS and 0.5% NP40. Immunoprecipitates were separated by 10% (w/v) SDS-PAGE. The protein bands were transferred onto a nitrocellulose membrane and probed with anti-CD74 (INI), anti-c-Met (AF527,R&D system) and anti-Syk (LR; Santa Cruz Biotechnology) respectively, followed by horseradish peroxidase-conjugated anti rabbit IgG or anti goat IgG (Jackson ImmunoResearch Laboratories).

Blocking peptide

Protein-G Sepharose beads (Pharmacia) were incubated in the presence of c-Met mAb (B-2, SC-8057 Santa Cruz Biotechnology) and the c-Met blocking peptide (B-2, SC-8057 P Santa Cruz Biotechnology) which recognizes the c-Met cytoplasmic domain of murine origin. Immunoprecipitation and western blotting were then performed, as described above.

Western Blot Analysis

To detect changes in protein phosphorylation, lysates or immunoprecipitates were separated by 12% (w/v) SDS-PAGE. The proteins were transferred onto a nitrocellulose membrane and probed with anti-Bcl2 (C-2; Santa Cruz Biotechnology) or anti-c-Met (AF527,R&D system) followed by horseradish peroxidase conjugated anti-mouse or anti-goat (Jackson ImmunoResearch Laboratories), respectively. The membranes then were stripped and reprobed with anti-tubulin antibody (Sigma) followed by peroxidase-conjugated anti-mouse (Jackson ImmunoResearch Laboratories).

HGF Injections

C57BL/6 mice were intraperitoneally injected daily with 4 μg of HGF or PBS for 2 days. Spleens were collected and splenocytes were analyzed for their B cell populations and survival.

Injections with c-Met inhibitor

C57BL/6 mice were intraperitoneally injected daily with 0.15 mg of the c-Met blocker, PHA-665752 (a kind gift from Pfizer), or DMSO twice a day for 5 days. Spleens were collected, and splenocytes were analyzed for their B cell populations and survival.

PI staining

Spleens were collected from HGF or PBS injected mice as described. Purified splenic B cells were cultured in 6-well plates at 1×107 cells/well in RPMI medium supplemented with 1% FCS, 2 mM glutamate, 100 U/ml penicillin, 100 μg/ml streptomycin, with or without HGF (10ng/ml) for 18 hours. Cells were collected by centrifugation, washed and fixed in 70% cold ethanol and incubated in the presence of RNAse (25μg/ml). Propodium Iodide (PI; 25μg/ml) (Sigma) was added for 20 min at room temp. PI staining was analyzed by FACS. Doublet-discrimination settings were used to eliminate cell clusters from consideration.

Cell death detection

Magic Red Apoptosis Detection Kit

Cells were incubated with Magic Red (Immunochemistry Technology) according to the manufacturer’s instructions, at 37 °C for 1 h. Then, Magic Red staining was quantitated by FACS analysis.

FLICA Apoptosis Detection Kit

Cells were incubated with FLICA (Immunochemistry Technology) according to the manufacturer’s instructions at 37 °C for 1 h. Cells were then washed three times with FLICA washing buffer. FLICA staining was measured by FACS analysis. The positive population was identified by comparison of the staining to that of the negative stained population.

Annexin-PI staining

Spleens were collected from HGF or PBS injected mice. Cells were washed and stained with Annexin (BD Biosciences) and PI (Bender Medsystems) for 15 min at room temperature. Annexin and PI staining were analyzed by FACS. The positive population was identified by comparison of the staining to that of the negative stained population.

Immunofluorescence and flow cytometry

c-Met cell surface expression was analyzed using directly conjugated anti mouse c-Met (HGFR eBioclone 7 from eBioscience) (40, 41), or goat anti-mouse HGFR (AF527, R&D systems) followed by horseradish peroxidase conjugated anti-goat (Jackson ImmunoResearch Laboratories).

CD74 cell surface staining was analyzed using goat anti mouse CD74 (C-16, Santa Cruz biotechnology) followed by horseradish peroxidase conjugated anti-goat (Jackson ImmunoResearch Laboratories).

Characterization of B cells

Purified B cells from control and CD74−/− mice that were incubated for 18h in the presence or absence of HGF (10 ng/ml) and freshly isolated splenocytes, were stained for RA3-6B2 anti-CD45R/B220, anti- IgM, anti-IgD, anti- AA4, anti-CD21 (CR2/CR), anti-CD24 (HSA) and anti-CD23 (all from eBioscience) and analyzed by FACS.

Statistical Analysis

Comparisons between groups were evaluated by the Student’s t -test. Data are expressed as mean±SD, and were considered statistically significant if p values were 0.05 or less.

Results

CD74/CD44 forms a cell surface complex with c-Met in B cells

We first wished to determine whether CD74/CD44 might form a cell surface complex with c-Met in B cells; to this end, we analyzed c-Met expression in B cells. T1, T2, MZ and mature B cell populations were sorted using cell-surface markers specific for each population (35), and then c-Met message was followed by RT-PCR. As seen in Fig. 1A, all splenic B cell populations transcribed c-Met. To confirm that B cells express c-Met protein as well as mRNA, c-Met cell surface expression levels were analyzed in control and naïve mature B cell populations, identified using various maturation markers. B cells, including the mature B population, expressed c-Met on their cell surface (Fig 1 B-D; supplementary data Fig 1 A-B). c-Met protein expression was also detected by western blot analysis in the mature (B220+IgD+) population (Fig. 1E).

Figure 1. CD74/CD44 forms a cell surface complex with c-Met in B cells.

Figure 1

Open in a new tab

(A) T1, T2, MZ and mature B cells were purified as described in Materials and Methods. Total RNA was isolated, and reverse transcription using primers for c-Met, and HPRT was performed as described in Methods, and fold activation was calculated. The intensity of the c-Met band for each population was normalized by dividing the measured intensity of the HPRT band from the same cell population. The activation fold ratio in the mature population was normalized to 1 and the ratio for the other populations was calculated as the intensity of the each sample relative to 1. (B-D) Splenocytes from C57BL/6 mice were stained with (B) anti-B220 and anti-c-Met (eBioscience) or isotype control antibodies; (C) anti–B220, anti-IgD and anti-c-Met (eBioscience) antibodies; or (D) anti-B220, anti-CD21, anti-CD24 and anti-c-Met (eBioscience) antibodies. Histograms present cell surface expression of c-Met on B220 positive cells (B), IgD and B220 positive cells (C), and CD21low, CD24low B220 positive cells (D). (E) IgD+B220+ B cells or B220+ B cells were purified as described in Materials and Methods. Cells were lysed and the level of c-Met was analyzed by western blot analysis. (F-H) Immunoprecipitations: Control (F); CD44−/− (G); or CD74−/− (H) B220+ B cells were lysed. After anti-c-Met immunoprecipitation, proteins were separated on SDS-PAGE and transferred onto nitrocellulose. CD74 was detected by western blot analysis. The results presented are representative of at least three different experiments. (I) Control B220+ B cells were lysed. After anti-CD44 or isotype antibody immunoprecipitation, proteins were separated on SDS-PAGE and transferred onto nitrocellulose. c-Met was detected by western blot analysis.

To identify complex formation between c-Met and CD74/CD44, control B cells were lysed and c-Met was immunoprecipitated. Immunoprecipitates were separated on SDS-PAGE and probed with anti-CD74 antibody. Immunoprecipitation of c-Met (Supplementary data, Fig 1C) specifically co-precipitated CD74, mainly the p31 isoform, showing that CD74 forms a complex with c-Met in B cells (Fig 1F). This interaction was not observed in CD44 or CD74-deficient B cells (Fig. 1 G-H), suggesting that CD44 is essential for the formation of the CD44/CD74/c-Met complex. To further confirm that c-Met forms a cell surface complex with CD44, CD44 was immunoprecipitated, and the co-immunoprecipitation of c-Met was confirmed by western blot analysis. As shown in Fig. 1I, c-Met was specifically pulled-down by anti-CD44 antibody, further indicating that c-Met engages with CD44 in B cells.

c-Met and HGF are MIF/CD74 target genes

To determine whether the survival cascade induced by CD74 is c-Met dependent, we first investigated whether c-Met expression is modulated by CD74. B cells were stimulated with MIF for 8h, and c-Met gene expression was analyzed by RT-PCR. As shown in Fig. 2 A-B, c-Met mRNA levels were elevated following CD74 activation. This elevation in c-Met mRNA levels was specific to MIF stimulation and did not occur in CD74 or CD44 deficient B cells (Fig. 2C). To follow c-Met protein levels in CD74 stimulated cells, c-Met protein and cell surface expression were analyzed following MIF stimulation. c-Met protein levels were upregulated following MIF stimulation, as detected by western blot analysis (Fig. 2D). Similarly, a specific elevation in c-Met cell surface expression following MIF stimulation was observed in control B cells, while there was no change in its levels in CD74-deficient B cells (Fig 2E).

Figure 2. c-Met is a MIF/CD74 target gene.

Figure 2

Open in a new tab

(A-C) B220+ B cells derived from control (A,B), or from CD74−/− or CD44−/− (C) mice were incubated in the presence or absence of MIF (100 ng/ml) for 10 h. (A,C) RT-PCR, using primers for c-Met or HPRT, was performed as described in Materials and Methods, and fold activation was calculated. The intensity of the c-Met band following each treatment was normalized by dividing the measured intensity of the HPRT band from the same treatment. The activation fold ratio in the absence of any treatment was normalized to 1 and the ratio for each treatment was calculated as the intensity of the treatment sample relative to 1. The results presented are representative of at least three different experiments. (B) Quantitative real time PCR was performed using primers for c-Met and β-actin as described in Methods. β-actin levels were used to normalize samples for calculation of the relative expression levels of c-Met. Results are expressed as a fold change in c-Met expression in stimulated cells compared to non-stimulated cells, which was defined as 1. Results shown are averages of three separate experiments. (D) B220+ B cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml) for 18h. Cells were lysed, and levels of c-Met and tubulin were analyzed by western blot analysis. The results presented are representative of at least three separate experiments. (E) B220+ cells derived from control or CD74−/− mice were incubated in the presence or absence of MIF (100 ng/ml) for 18h. Cell surface expression of c-Met was analyzed by FACS. The cells were double stained with anti-B220 and anti-c-Met (eBioscience). The histograms present cell surface expression of c-Met on B220 positive cells. The results presented are representative of at least three different experiments.

We next investigated whether HGF expression is modulated by CD74; to this end, we first measured HGF mRNA expression in control B cells. The T1 and mature B cell populations were sorted as described in Materials and Methods, and HGF mRNA was followed by RT-PCR. As shown in Fig. 3A, HGF expression was detected in both T1 and mature subpopulations. HGF expression in total B cells (B220+) and mature cells (B220+IgD+) was also confirmed by intracellular staining (Fig. 3B). We next examined whether HGF mRNA expression is modulated by MIF stimulation. As shown in Fig. 3C, a specific increase in HGF mRNA levels was detected in control B cells following CD74 stimulation, while no change was detected in CD74 deficient B cells. Moreover, CD74 stimulation elevated HGF intracellular expression (Fig. 3D) and secretion into the conditioned medium, as analyzed by ELISA assay (Fig. 3E-F). Together, these results demonstrate that stimulation of the CD74/CD44 complex expressed on B cells augments both c-Met cell surface expression and HGF secretion.

Figure 3. HGF is a MIF/CD74 target gene.

Figure 3

Open in a new tab

(A) T1 and mature B cells were purified. Total RNA was isolated, reverse transcription using primers for HGF and HPRT was performed as described in Methods, and fold activation was calculated. (B) Splenocytes derived from control mice were stained for B220 and IgD and HGF intracellular protein levels were analyzed by intracellular staining as described in Methods. (C) B220+ B cells derived from control or CD74−/− mice were incubated in the presence or absence of MIF (100 ng/ml) for 5h. RT-PCR, using primers for HGF or HPRT, was performed as described in Methods, and fold activation was calculated. The results presented are representative of at least three different experiments. (D) B220+ cells from control mice were stimulated with anti-CD74 or and isotype control antibodies for 4 hours. Intracellular HGF protein levels were analyzed by intracellular staining as described in Methods. The results presented are representative of at least three separate experiments. (E-F) B220+ cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml) for 8 h. Conditioned medium was collected, and analyzed by ELISA to determine HGF levels (E). (F) HGF levels in unstimulated cells were normalized to 1, and the relative ratio for each treatment was calculated. The results presented are an average of three independent experiments.

HGF induces survival and proliferation cascades in B cells resulting in regulation of the peripheral B cell subsets

Activation of the HGF/c-Met signaling pathway leads to cellular responses including cell survival (22, 24, 27, 42, 43)].

To reveal whether HGF induces a survival cascade in B cells, we first followed the HGF-induced signaling cascade. After HGF stimulation, cells were lysed, and phosphorylated proteins were analyzed by western blot analysis.

The BCR transduces antigen binding into alterations in the activity of intracellular signaling pathways through its ability to recruit and activate the cytoplasmic protein-tyrosine kinase, Syk. The recruitment of Syk to the receptor, its activation, and its subsequent interactions with downstream effectors regulate B cell survival (44). In addition, we have recently shown that MIF induces Syk phosphorylation, also resulting in B cell survival (15, 16). Therefore, Syk phosphorylation following HGF stimulation was analyzed. B cells derived from control mice were incubated in the presence or absence of HGF for 0–5 min. The cells were then lysed and Syk phosphorylation was analyzed. As can be seen in Fig. 4A, HGF stimulation augmented Syk phosphorylation.

Figure 4. In-vitro treatment with HGF induces survival and proliferation cascades in B cells.

Figure 4

Open in a new tab

(A) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for various time periods. Immediately after stimulation, cell pellets were washed and fast frozen in liquid N2. The cells then were lysed, and an aliquot reserved for total Syk analysis. Phosphorylated proteins from the remaining lysate were immunoprecipitated (IP) with an anti-Tyr(P) antibody. Immunoprecipitates and total lysate proteins were separated on 10% (w/v) SDS-PAGE and blotted with an anti-Syk antibody. The results presented are representative of at least three different experiments. (B-C) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10ng/ml) for 8h. Total RNA was isolated. (B) RNA was reverse transcribed using primers for Bcl-2 or HPRT. The results presented are representative of at least five different experiments. (C) Quantitative real time PCR was performed using primers for Bcl-2 and β-actin as described in Methods. β-actin levels were used to normalize samples for calculation of the relative expression levels of Bcl-2. Results are expressed as a fold of change in Bcl-2 expression at stimulated cells compared to non-stimulated cells, which was defined as 1. Results shown are average of three separate experiments. (D) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10ng/ml) or MIF (100ng/ml) for 8h. Total RNA was isolated. Quantitative Real time PCR was performed using primers for Bcl-2 and β-actin as described in Methods. β-actin levels were used to normalize samples for calculation of the relative expression levels of Bcl-2. Results are expressed as fold change in Bcl-2 expression in stimulated cells compared to the level non-stimulated cells, which was defined as 1. (E) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 18h. Cells were lysed, and levels of Bcl-2 and tubulin were analyzed by western blot analysis. The results presented are representative of at least three different experiments. (F) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) or MIF (100 ng/ml) for 16h. Cell survival was then analyzed by Annexin V and PI staining of intact cells. (G) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 18 h. Cell death was measured by Magic Red apoptosis detection kit. The graph shows the average of four independent experiments. (H) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 8h. Total RNA was isolated and reverse transcribed using primers for Cyclin E or HPRT. (I) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 18h, and subjected to PI staining. The first gate includes cells in the GO/G1 phase, and the second one, cells in the S/G2/M phases. The graph shows an average of four independent experiments.

Next, the role of HGF in B cell survival was examined. B cells were incubated in the presence or absence of HGF, and the expression of the anti-apoptotic protein, Bcl-2, was analyzed. As shown in Fig. 4 B-E, HGF stimulation up-regulated Bcl-2 mRNA (Fig. 4 B-D) and protein (Fig. 4E) levels. To further determine whether HGF regulates B cell survival, the B cell apoptotic populations following HGF stimulation were analyzed by Annexin/PI staining. As shown in Fig. 4F, HGF reduced B cell apoptosis resulting in an elevation of the live population. Since B cells survive poorly in vitro, and following 24 h incubation a large proportion of the cells are already dead, we followed cell survival over a shorter time period. Therefore, cells were incubated in the presence or absence of HGF for 8 h, and their caspase 3 and 7 activity was analyzed as a marker of apoptosis. As shown in Fig. 4G, a significant reduction in the apoptotic population was detected in control B cells stimulated with HGF.

The possible regulation of B-cell proliferation by HGF in vitro was studied by analyzing cell entry into the S-phase. Cell-cycle progression is regulated by cyclin-dependent kinases (Cdks). We previously showed that CD74 activation induces expression of cyclin E (15, 16), which regulates cell entry into the S phase. To determine whether HGF also regulates cell entry to the S phase, cyclin E mRNA levels were followed. As demonstrated in Fig. 4H, HGF elevated the intracellular level of cyclin E mRNA. To further evaluate cell-cycle entry and DNA synthesis following HGF stimulation, PI staining was performed. As shown in Fig. 4I, HGF stimulation induced the entry of B cells into the S phase. The HGF-induced survival pathway may control peripheral B cell subsets; B cells from control mice were therefore incubated with or without HGF for 18h. Then, the different B cell populations were analyzed for the expression of various maturation markers. As shown in Fig. 5A-B, accumulation of the mature B cell subpopulation (IgDhigh AA4−) was observed following HGF stimulation, which resulted from elevated survival of p>the mature (AA4−, Figs. 5C2 and 5D2; and CD21low,CD24low, Fig. 5D1) population, while there was no change in the cell death of the immature (AA4+, Figs. 5C3 and 5D3) population. Thus, HGF preferentially promotes the viability of mature B cells. Next, to investigate whether HGF controls differentiation of the transitional B cell populations, purified transitional (T1, derived from a 1 week old mouse, Fig. 5E1; and AA4+, Fig. 5E2) B cells were incubated with or without HGF for 18h, and were analyzed for the expression of maturation markers. No change in the transitional and mature B populations was observed in HGF-stimulated cells. These results suggest that HGF regulates mature B cell survival, and is not involved in differentiation of transitional B cells into mature cells.

Figure 5. The HGF survival pathway induced in vitro regulates peripheral B cell subsets.

Figure 5

Open in a new tab

(A, B) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 18h. The B cell sub-populations then were analyzed by FACS. Dot plots show IgD and AA4 expression on B220 positive cells (A). Graph showing an average of four independent experiments (B). (C) B220+ B cells derived from control mice were incubated in the presence or absence of HGF (10 ng/ml) for 18h. (1) Histograms show AA4 expression on B220 positive cells. (2,3) Cell survival of AA4 negative (2), or positive (3) populations was analyzed by Annexin V staining. (D) Mature (sorted CD21low,CD24low(1), or AA4−(2)) and transitional (AA4+ (3)) B cells, were incubated in the presence or absence of HGF (10ng/ml) for 6h. Cell death was measured by Magic Red apoptosis detection kit. (E) T1 B cells derived from 1 week old control mice (1), and transitional (AA4+) B cells (2), were incubated in the presence or absence of HGF (10ng/ml) for 18h. Histograms show AA4 expression (1) and IgD expression(2) in B220 positive cells.

To follow the in vivo effect of HGF on B cells, we injected HGF (4 mg) into mice for 2 days and analyzed the apoptotic populations by Annexin/PI staining of B cells recovered from the spleens. As demonstrated in Fig. 6A, a high proportion of live B splenocytes was detected in both PBS or HGF injected mice. However, HGF significantly reduced the apoptosis of mature B cells. To further evaluate cell division, cell cycle entry and DNA synthesis following HGF injection, PI staining was performed. As shown in Fig. 6B, the proportion of cells that entered the S and M phases was elevated in HGF treated mice. These results show that HGF induces survival and proliferation cascades in vivo.

Figure 6. The HGF induced survival pathway regulates peripheral B cell subsets in-vivo.

Figure 6

Open in a new tab

Control mice were injected with HGF (4 μg) or PBS for 2 days. (A) Cell survival was analyzed by Annexin V and PI staining of intact cells. (B) Cell cycle entry was analyzed by PI staining following cell fixation. The first gate includes cells in the GO/G1 phase and the second one, cells in the S/G2/M phases. The results presented are representative of at least three separate experiments. (C-E) Control mice were injected with HGF (4 μg) or PBS for 2 days, and the B cell sub-populations then were analyzed for IgD and IgM (C); AA4 (D); and CD21, CD24 and CD23 (E) expression on B220 positive cells. The graph shows an average of four independent experiments. (F-G) Control mice were injected with the c-Met inhibitor, PHA-665752 (0.15 mg) twice a day for 5 days. (F) B cell survival was analyzed by Annexin V and PI staining of intact cells. (G) B cell sub-populations were analyzed for IgD and AA4 expression on B220 positive cells. The results presented are representative of four separate experiments.

To directly follow the in vivo role of HGF in B cell survival, the splenic B cell populations were analyzed in mice treated with HGF or with c-Met inhibitor. C57BL/6 mice were injected with HGF (4 mg) for 2 days and the B cells obtained from the HGF treated and non-treated mice were analyzed using maturation markers for the peripheral differentiation of B cells. As shown in Fig. 6 C-E, HGF treatment resulted in a reduction of the transitional 1 (IgMhigh IgDlow, AA4+, CD21low CD24high) and transitional 2 (CD21high CD24highCD23high) populations and an elevation in the proportion of the B mature cells (IgMlow IgDhigh, AA4−, CD21low CD24low). To directly show that c-Met is involved in the survival of peripheral mature B cells, C57BL/6 mice were injected with PHA-665752, a specific c-Met inhibitor. PHA-665752 is a selective small molecule, active-site inhibitor of the catalytic activity of c-Met kinase (Ki 4 nM) that competes with its ATP binding (45). As shown in Fig. 6 F-G, blocking c-Met in vivo induced apoptosis of mature B cells (Fig. 6F), resulting in the reduction of the mature population in the spleen (Fig. 6G). Together, these results show that activation of c-Met induces cell division and suppression of apoptosis, which enlarge the mature B cell compartment, while its blockade results in mature B cell death.

CD74 induces B cell survival in a c-Met/HGF dependent manner

In order to determine whether the c-Met induced survival cascade is a CD74 downstream event, we first tested whether exogenous HGF could bypass the reduced survival in CD74 deficient cells. CD74−/− B cells were treated in the presence or absence of HGF, and Bcl-2 mRNA and protein levels were evaluated. As shown in Fig. 7, HGF stimulation up-regulated Bcl-2 mRNA (Fig. 7A) and protein (Fig. 7B) levels in cells lacking CD74. Next, CD74−/− B cells were incubated in the presence or absence of HGF for 18h, and cell death was analyzed. As shown in Fig. 7C, a reduced apoptotic population was observed in HGF stimulated cells. To directly determine whether HGF can shape B peripheral cell subsets by regulating the survival of the mature population, CD74−/− B cells were incubated in the presence or absence of HGF, and the various B cell populations were analyzed 18h later by FACS. A specific elevation in the mature population and reduction in the transitional B cell population was observed in the HGF stimulated cells (Fig. 7D). Together, these results show that HGF induces a survival cascade in CD74 deficient cells, and stimulation with exogenous HGF restores the mature population missing in cells lacking CD74.

Figure 7. HGF transmits a survival signal in CD74 deficient cells, and stimulation with exogenous HGF restores the mature population missing in cells lacking CD74.

Figure 7

Open in a new tab

(A) B220+ B cells derived from CD74−/− mice were incubated in the presence or absence of HGF (10 ng/ml) for 8 h. Total RNA was isolated and reverse transcription using primers for Bcl-2 or HPRT was carried out. The results presented are representative of at least five different experiments. (B) B220+ B cells derived from CD74−/− mice were incubated in the presence or absence of HGF (10ng/ml) for 18 h. Cells were lysed, and levels of Bcl-2 and tubulin were analyzed by western blot analysis. The results presented are representative of at least three separate experiments. (C) B220+ B cells derived from CD74−/− mice were incubated in the presence or absence of HGF (10 ng/ml) for 18 h. Cell death was measured by Magic Red apoptosis detection kit. The graph shows an average of the results obtained from four independent experiments. (D) B220+ B cells derived from CD74−/− mice were incubated in the presence or absence of HGF (10 ng/ml) for 18h. Next, B cell sub-populations were analyzed by FACS. The graph shows an average of results obtained from four independent experiments.

Finally, we tested whether the formation of the CD74/CD44/c-Met cell surface complex is MIF-dependent. As shown in Fig. 8A, stimulation of B cells with MIF induced the co-precipitation of CD74 with c-Met, showing that MIF regulates the formation of CD74/CD44/c-Met cell surface complex. Next, B cells were incubated in the presence or absence of the c-Met inhibitor, PHA-665752 (0.3 ng/ml), for 3h. Following incubation with PHA-665752, the cells were stimulated with MIF for 0-5 min. Then, the cells were lysed, and Syk phosphorylation was analyzed. As shown in Fig. 8B, the c-Met inhibitor abolished the MIF-induced Syk phosphorylation. Thus, c-Met activation is required for the MIF/CD74 signaling cascade.

Figure 8. c-Met regulates the CD74 induced survival cascade.

Figure 8

Open in a new tab

(A) B220+ B cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml) for various periods. Immediately after stimulation, cells were washed and fast frozen in liquid N2. Next, the cells were lysed; proteins were immunoprecipitated with anti-c-Met, separated on SDS-PAGE and transferred to nitrocellulose. CD74 was detected by western blot analysis. (B) B220+ B cells derived from control mice were incubated in the presence or absence of the c-Met inhibitor, PHA-665752 (0.3 ng/ml) for 3 h, and were then stimulated with MIF (100 ng/ml) for various periods. Immediately after stimulation, cells were washed and fast frozen in liquid N2. The cells then were lysed and an aliquot reserved for total Syk analysis. Phosphorylated proteins from the remaining lysate were immunoprecipitated (IP) with an anti-Tyr(P) antibody. Immunoprecipitates and total lysate proteins were separated on 10% (w/v) SDS-PAGE and blotted with an anti-Syk antibody. (C) B220+ B cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml) or the c-Met inhibitor, PHA-665752 (0.3 ng/ml) for 8 h. Total RNA was isolated and reverse transcription using primers for Bcl-2 or HPRT was carried out. The results presented are representative of at least three different experiments. (D) Quantitative real time PCR was performed using primers for Bcl-2 and β-actin as described in Methods. β-actin levels were used to normalize samples for calculation of the relative expression levels of c-Met. Results are expressed as fold change in Bcl-2 expression in stimulated cells compared to non-stimulated cells, which was defined as 1. Results shown are a summary of three separate experiments. (E) B220+ B cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml) or the c-Met inhibitor, PHA-665752 (0.3 ng/ml) for 5 h. Cell death was analyzed by Magic Red and FLICA apoptosis detection kits. Graphs summarize results of three different experiments. (F-H) B220+ B cells derived from control mice were incubated in the presence or absence of MIF (100 ng/ml), anti-HGF (3 μg) or an isotype control antibody. (F) After 8h, total RNA was isolated and reverse transcribed using primers for Bcl-2 or HPRT. The results presented are representative of at least three different experiments. (G) After 12h, cells were lysed, and levels of Bcl-2 and tubulin (loading control) were analyzed by western blot analysis. The results presented are representative of at least three different experiments. (H) After 12h, cell death was analyzed by Magic Red apoptosis detection kits. The graph summarizes results of three different experiments.

We then analyzed the CD74 induced survival cascade in the presence of MIF and of the c-Met inhibitor, PHA-665752, as above. Bcl-2 transcription levels were analyzed by means of RT-PCR. As shown in Fig. 8 C-D, addition of the c-Met inhibitor significantly down-regulated the MIF-induced Bcl-2 mRNA levels. In addition, as shown in Fig. 8E, the MIF-induced support of cell survival was abolished in PHA665752 treated cells. Finally, cells were stimulated with MIF in the presence or absence of an anti-HGF blocking antibody or an isotype control antibody, and Bcl-2 mRNA and protein levels were analyzed. As shown in Fig. 8F-G, while stimulation with MIF augmented Bcl-2 mRNA and protein levels, blocking of HGF significantly reduced this elevation. Down regulation of Bcl-2 transcription and expression was specific and did not occur in the cells incubated in the presence of an isotype control antibody. In addition, blocking of the secreted HGF by the anti-HGF blocking antibody abolished the MIF-induced elevation of survival. Thus, the MIF-dependent survival of mature cells is regulated by the secreted HGF in an autocrine manner.

Together, these results show that blocking the HGF/c-Met pathway results in induction of cell death and inhibition of the MIF/CD74-induced survival cascade. Thus, HGF/c-Met axis functions as a CD74 downstream pathway, regulating B cell survival in an autocrine manner.

Discussion

In B cells, as in every other tissue, the balance between cell survival and apoptosis is essential for homoeostasis. Adaptive immunity depends on the production and maintenance of a pool of mature peripheral lymphocytes throughout life. Most of these cells circulate in the periphery in a quiescent state, without actively contributing to a given acute immune response. This vast number of resting cells must be maintained to preserve a diverse B cell repertoire. Long-term B cell persistence in the periphery is dependent on survival signals that are transduced by cell surface receptors. Conversely, resistance to apoptosis, leading to enhanced survival, is associated with initiation and progression of B cell malignancies.

It was previously shown that the regulation of B cell homeostasis depends on tonic and induced BCR signaling, and on receptors sensitive to trophic factors, such as B cell-activating factor receptor (BAFF-R or BR3), during development and maintenance (1, 3, 4). Our previous studies demonstrated that survival of mature B cells is controlled by MIF.

MIF is a ubiquitous protein that has a broad tissue distribution and is found in virtually all cells (46); thus, it undergoes tonic production in the spleen, as well. Engagement of the CD74/CD44 complex by MIF triggers the anti-apoptotic Syk-PI3K/Akt signaling pathway, and thus promotes B cell survival (15, 16, 47). Here, we identified two novel components of the CD74/CD44 B cell survival complex, the c-Met receptor and its ligand, HGF. The c-Met tyrosine kinase receptor and its cognate ligand, HGF, are known to efficiently induce the survival of many cell types subjected to various apoptotic inducers (48). HGF is a paracrine factor that is produced by stromal and mesenchymal cells (21, 49). We found that HGF can be produced by B cells, indicating a possible autocrine mechanism of c-Met activation. Although paracrine HGF appears to be sufficient for survival of CD74−/− B cells, we believe that since in CD74−/− mice, B cell survival is nevertheless impaired, the autocrine pathway induced by MIF/CD74 plays an essential role in upregulating HGF secretion inducing optimal B cell survival.

Our results show that HGF does not affect differentiation of transitional cells in the spleen, but rather, induces a signaling cascade involving Syk, leading to B cell entry into the S phase and to cell survival of mature B cells. In addition, our studies show that the c-Met/HGF induced survival cascade is regulated by the CD74/CD44 cell surface complex, since exogenous HGF can bypass the absent survival signal and rescue the mature population missing in cells lacking CD74. Moreover, blocking HGF or c-Met activity abolishes the MIF-induced Syk phosphorylation and Bcl-2 elevation, thereby inhibiting cell survival.

The precise mechanism by which MIF activates c-Met is still unclear. It is possible that MIF binding to CD74/CD44 complex can induce c-Met activation in an HGF-independent manner, as was shown in tumor cells (50, 51), or following cellular adherence (52). However, since HGF was shown in our studies to be sufficient to support survival of mature B cells and its blocking inhibits the MIF-induced survival pathway, we believe that HGF is involved in the MIF-induced survival cascade. We suggest that MIF activation induces transient CD74/CD44/c-Met complex formation. This can lead to induction of a signaling cascade leading to Syk phosphorylation and augmented transcription of genes, including the survival genes, and c-Met and HGF. Subsequently, c-Met cell surface expression becomes elevated together with the augmented levels of HGF.

There is limited information regarding the expression and function of c-Met and HGF in naïve mature B cells. Previous studies showed that human tonsillar and human peripheral B cells do not express c-Met (53-55) and HGF (55), while germinal center activated cells and plasma cells exhibit c-Met expression. These results suggest that B cell activation significantly elevates c-Met expression, while its expression in resting mouse and human splenic B cells might be lower. Our study shows that naïve murine splenic B cells express c-Met and its ligand, HGF. Thus, upon activation, it is likely that c-Met expression is significantly upregulated. Further studies will be required to compare c-Met expression in activated B cells versus that in naïve murine or human cells.

One of the signaling proteins that plays a crucial role in B cell development is the Syk protein-tyrosine kinase. Syk belongs to the Syk/ZAP-70 family of protein-tyrosine kinases and participates in B-cell fate decisions and antigen processing. Recent findings indicate that expression of Syk in non-hematopoietic cells is involved in a wide variety of cellular functions and in the pathogenesis of malignant tumors. Syk was previously shown to be required for the activation of Akt in a phosphatidylinositol 3-kinase-dependent manner. Syk is a critical component of this signaling machinery. Studies in knockout mice and cell lines indicate that Syk is essential for most of the biochemical responses to BCR engagement, including regulation of cell survival (44). Previously, we showed that MIF initiates a signaling cascade in mature B cells that involves Syk and Akt phosphorylation, and is dependent on PI3K (16). Here, we demonstrate that in B cells, HGF stimulation leads to Syk phosphorylation. Blocking c-Met activity abolishes MIF-induced Syk phosphorylation. Therefore, c-Met appears to be necessary for the signaling mechanism induced by MIF in a Syk-dependent manner.

Our model suggests that c-Met and HGF are both CD74/CD44 target genes. Following MIF stimulation, c-Met engages with CD74 and CD44 on the cell membrane and, together with HGF, triggers an additional signaling pathway, which is necessary to initiate the MIF-induced survival signaling cascade. It is interesting to note that both the MIF/CD74 and HGF/c-Met pathways have been implicated in tumor progression. It has been reported that MIF is overexpressed in solid tumors (56, 57), and that its expression is associated with the growth of malignant cells (58). In addition, anti-MIF Ig therapy has been shown to suppress tumor growth (59). Many studies have demonstrated the overexpression of CD74 in various cancers (60-65) and CD74 has been suggested to serve as a prognostic factor in several tumor types, with higher relative expression of CD74 behaving as a marker of tumor progression (66). Moreover, a humanized anti-CD74 monoclonal antibody (hLL1) was shown to have therapeutic activity in multiple myeloma, perhaps due to the high level of expression of CD74 in this plasma cell malignancy (67). Finally, we recently showed that activation of cell surface CD74, expressed at high levels from an early stage of B-chronic lymphocytic leukemia (B-CLL), by MIF initiates a signaling cascade that contributes to tumor progression (68). Uncontrolled activation of c-Met is oncogenic and has been implicated in the growth, invasion and metastasis of a variety of tumors in both mice and humans (69). It has been shown that receptor over-expression is by far the most frequent alteration of c-Met in human tumors (70). c-Met over expression has been described in a variety of human cancers, including B-cell malignancies such as multiple myeloma (MM) (42, 71). Furthermore, in MM, Hodgkin lymphoma (HL), and diffuse large B-cell lymphoma (DLBCL), elevated serum HGF levels correlate with unfavorable prognosis (72, 73). Moreover, it was shown that HGF induces a potent proliferative and anti-apoptotic response in MM cell lines and primary MMs (42, 43). Thus, CD74 and c-Met might operate together in supporting tumor cell survival.

These studies establish the function of the c-Met/CD44/CD74 complex in delivering signals important for B cell survival, and may provide a basis for therapy of B cell malignancies with enhanced specificity.

Supplementary Material

supplemental figures

Acknowledgments

The authors gratefully acknowledge Pfizer Inc. for accepting our proposal for this study and for providing the PHA-665752 (c-met inhibitor) reagent. The authors wish to thank Prof. Tsvee Lapidot and members of the Shachar laboratory team, for helpful discussions and review of this manuscript.

Footnotes

Author contribution M.G.- designed the experiments, performed experiments, analyzed results, wrote the paper.

M.T.- designed the experiments, performed experiments, analyzed results.

S.C.- designed the experiments, performed experiments, analyzed results.

Y.G.- designed the experiments, performed experiments, analyzed results.

F.L.- performed experiments, analyzed results.

L.L.- contributed reagents.

R.B.- contributed reagents and wrote the paper.

I.S.- designed the experiments, analyzed results, wrote the paper.

1

This research was supported by The Israel Science Foundation (Morasha), The Israel Science Foundation, The Israel Cancer Association, and The Minerva Foundation. I.S. is the incumbent of the Dr. Morton and Ann Kleiman Professorial Chair. R Bucala and L Leng are supported by NIH AR049610, AR050498, AI042310, and the Alliance for Lupus Research.

References

  • 1.Lam KP, Kuhn R, Rajewsky K. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell. 1997;90:1073–1083. doi: 10.1016/s0092-8674(00)80373-6. [DOI] [PubMed] [Google Scholar]
  • 2.Kraus M, Alimzhanov MB, Rajewsky N, Rajewsky K. Survival of resting mature B lymphocytes depends on BCR signaling via the Ig alpha/beta heterodimer. Cell. 2004;117:787–800. doi: 10.1016/j.cell.2004.05.014. [DOI] [PubMed] [Google Scholar]
  • 3.Crowley JE, Treml LS, Stadanlick JE, Carpenter E, Cancro MP. Homeostatic niche specification among naive and activated B cells: A growing role for the BLyS family of receptors and ligands. Seminars in Immunology. 2005;17:193–199. doi: 10.1016/j.smim.2005.02.001. [DOI] [PubMed] [Google Scholar]
  • 4.Woodland RT, Schmidt MR, Thompson CB. BLyS and B cell homeostasis. Seminars in Immunology. 2006;18:318–326. doi: 10.1016/j.smim.2006.06.001. [DOI] [PubMed] [Google Scholar]
  • 5.Schiemann B, Gommerman JL, Vora K, Cachero TG, Shulga-Morskaya S, Dobles M, Frew E, Scott ML. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science. 2001;293:2111–2114. doi: 10.1126/science.1061964. [DOI] [PubMed] [Google Scholar]
  • 6.Schneider P, Takatsuka H, Wilson A, Mackay F, Tardivel A, Lens S, Cachero TG, Finke D, Beermann F, Tschopp J. Maturation of marginal zone and follicular B cells requires B cell activating factor of the tumor necrosis factor family and is independent of B cell maturation antigen. Journal of Experimental Medicine. 2001;194:1691–1697. doi: 10.1084/jem.194.11.1691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Thompson JS, Schneider P, Kalled SL, Wang L, Lefevre EA, Cachero TG, MacKay F, Bixler SA, Zafari M, Liu ZY, Woodcock SA, Qian F, Batten M, Madry C, Richard Y, Benjamin CD, Browning JL, Tsapis A, Tschopp J, Ambrose C. BAFF binds to the tumor necrosis factor receptor-like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population. Journal of Experimental Medicine. 2000;192:129–135. doi: 10.1084/jem.192.1.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Stumptner-Cuvelette P, Benaroch P. Multiple roles of the invariant chain in MHC class II function. Biochim Biophys Acta. 2002;1542:1–13. doi: 10.1016/s0167-4889(01)00166-5. [DOI] [PubMed] [Google Scholar]
  • 9.Naujokas MF, Morin M, Anderson MS, Peterson M, Miller J. The chondroitin sulfate form of invariant chain can enhance stimulation of T cell responses through interaction with CD44. Cell. 1993;74:257–268. doi: 10.1016/0092-8674(93)90417-o. [DOI] [PubMed] [Google Scholar]
  • 10.Shi X, Leng L, Wang T, Wang W, Du X, Li J, McDonald C, Chen Z, Murphy JW, Lolis E, Noble P, Knudson W, Bucala R. CD44 Is the Signaling Component of the Macrophage Migration Inhibitory Factor-CD74 Receptor Complex. Immunity. 2006;25:595–606. doi: 10.1016/j.immuni.2006.08.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Leng L, Metz CN, Fang Y, Xu J, Donnelly S, Baugh J, Delohery T, Chen Y, Mitchell RA, Bucala R. MIF Signal Transduction Initiated by Binding to CD74. J. Exp. Med. 2003;197:1467–1476. doi: 10.1084/jem.20030286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Matza D, Kerem A, Shachar I. Invariant chain, a chain of command. Trends Immunol. 2003;24:246–248. doi: 10.1016/s1471-4906(03)00073-5. [DOI] [PubMed] [Google Scholar]
  • 13.Matza D, Wolstein O, Dikstein R, Shachar I. Invariant Chain Induces B Cell Maturation by Activating TAFII105-NF-kB Dependent Transcription Program. J. Biol. Chem. 2001;276:27203–27206. doi: 10.1074/jbc.M104684200. [DOI] [PubMed] [Google Scholar]
  • 14.Matza D, Kerem A, Lantner F, Shachar I. Invariant chain induced B cell differentiation requires intramembrane - proteolytic release of the cytosolic domain. Immunity. 2002;17:549–560. doi: 10.1016/s1074-7613(02)00455-7. [DOI] [PubMed] [Google Scholar]
  • 15.Starlets D, Gore Y, Binsky I, Haran M, Harpaz N, Shvidel L, Becker-Herman S, Berrebi A, Shachar I. Cell Surface CD74 initiates a signaling cascade leading to cell proliferation and survival. Blood. 2006;107:4807–4816. doi: 10.1182/blood-2005-11-4334. [DOI] [PubMed] [Google Scholar]
  • 16.Gore Y, Starlets D, Maharshak N, Becker-Herman S, Kaneyuki U, Leng L, Bucala R, Shachar I. Macrophage migration inhibitory factor (MIF) induces B cell survival by activation of a CD74/CD44 receptor complex. J Biol Chem. 2008;283:2784–2792. doi: 10.1074/jbc.M703265200. [DOI] [PubMed] [Google Scholar]
  • 17.Sapoznikov A, Pewzner-Jung Y, Kalchenko V, Krauthgamer R, Shachar I, Jung S. Perivascular clusters of dendritic cells provide critical survival signals to B cells in bone marrow niches. Nat Immunol. 2008;9:388–395. doi: 10.1038/ni1571. [DOI] [PubMed] [Google Scholar]
  • 18.van der Voort R, Taher TE, Wielenga VJ, Spaargaren M, Prevo R, Smit L, David G, Hartmann G, Gherardi E, Pals ST. Heparan sulfate-modified CD44 promotes hepatocyte growth factor/scatter factor-induced signal transduction through the receptor tyrosine kinase c-Met. J Biol Chem. 1999;274:6499–6506. doi: 10.1074/jbc.274.10.6499. [DOI] [PubMed] [Google Scholar]
  • 19.Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is required for two consecutive steps in HGF/c-Met signaling. Genes Dev. 2002;16:3074–3086. doi: 10.1101/gad.242602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Orian-Rousseau V, Morrison H, Matzke A, Kastilan T, Pace G, Herrlich P, Ponta H. Hepatocyte growth factor-induced Ras activation requires ERM proteins linked to both CD44v6 and F-actin. Mol Biol Cell. 2007;18:76–83. doi: 10.1091/mbc.E06-08-0674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. Met, metastasis, motility and more. Nat Rev Mol Cell Biol. 2003;4:915–925. doi: 10.1038/nrm1261. [DOI] [PubMed] [Google Scholar]
  • 22.Bertotti A, Comoglio PM. Tyrosine kinase signal specificity: lessons from the HGF receptor. Trends Biochem Sci. 2003;28:527–533. doi: 10.1016/j.tibs.2003.09.001. [DOI] [PubMed] [Google Scholar]
  • 23.Zhang YW, Vande Woude GF. HGF/SF-met signaling in the control of branching morphogenesis and invasion. J Cell Biochem. 2003;88:408–417. doi: 10.1002/jcb.10358. [DOI] [PubMed] [Google Scholar]
  • 24.Corso S, Comoglio PM, Giordano S. Cancer therapy: can the challenge be MET? Trends Mol Med. 2005;11:284–292. doi: 10.1016/j.molmed.2005.04.005. [DOI] [PubMed] [Google Scholar]
  • 25.Bladt F, Riethmacher D, Isenmann S, Aguzzi a., Birchmeier C. Essential Role for the C-Met Receptor in the Migration of Myogenic Precursor Cells into the Limb Bud. Nature. 1995;376:768–771. doi: 10.1038/376768a0. [DOI] [PubMed] [Google Scholar]
  • 26.Schmidt C, Bladt F, Goedecke S, Brinkmann V, Zschiesche W, Sharpe M, Gherardi E, Birchmeier C. Scatter Factor/Hepatocyte Growth-Factor Is Essential for Liver Development. Nature. 1995;373:699–702. doi: 10.1038/373699a0. [DOI] [PubMed] [Google Scholar]
  • 27.Uehara Y, Minowa O, Mori C, Shiota K, Kuno J, Noda T, Kitamura N. Placental Defect and Embryonic Lethality in Mice Lacking Hepatocyte Growth Factor/Scatter Factor. Nature. 1995;373:702–705. doi: 10.1038/373702a0. [DOI] [PubMed] [Google Scholar]
  • 28.Nishino T, Hisha H, Nishino N, Adachi M, Ikehara S. Hepatocyte Growth-Factor as a Hematopoietic Regulator. Blood. 1995;85:3093–3100. [PubMed] [Google Scholar]
  • 29.Yu CZ, Hisha H, Li YG, Lian ZX, Nishino T, Toki J, Adachi Y, Inaba M, Fan TX, Jin TN, Iguchi T, Sogo S, Hosaka N, Song TH, Xing JL, Ikehara S. Stimulatory effects of hepatocyte growth factor on hemopoiesis of SCF/c-kit system-deficient mice. Stem Cells. 1998;16:66–77. doi: 10.1002/stem.160066. [DOI] [PubMed] [Google Scholar]
  • 30.Delaney B, Koh WS, Yang KH, Strom SC, Kaminski NE. Hepatocyte Growth-Factor Enhances B-Cell Activity. Life Sciences. 1993;53:PL89–PL93. doi: 10.1016/0024-3205(93)90654-l. [DOI] [PubMed] [Google Scholar]
  • 31.Teder P, Vandivier RW, Jiang D, Liang J, Cohn L, Pure E, Henson PM, Noble PW. Resolution of lung inflammation by CD44. Science. 2002;296:155–158. doi: 10.1126/science.1069659. [DOI] [PubMed] [Google Scholar]
  • 32.Elliott EA, Drake JR, Amigorena S, Elsemore J, Webster P, Mellman I, Flavell RA. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J. Exp. Med. 1994;179:681–694. doi: 10.1084/jem.179.2.681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Shachar I, Flavell RA. Requirement for invariant chain in B cell maturation and function. Science. 1996;274:106–108. doi: 10.1126/science.274.5284.106. [DOI] [PubMed] [Google Scholar]
  • 34.Becker-Herman S, Lantner F, Shachar I. Id2 negatively regulates B cell differentiation in the spleen. J. Immunol. 2002;168:5507–5513. doi: 10.4049/jimmunol.168.11.5507. [DOI] [PubMed] [Google Scholar]
  • 35.Su TT, Rawlings DJ. Transitional B lymphocyte subsets operate as distinct checkpoints in murine splenic B cell development. J. Immunol. 2002;168:2101–2110. doi: 10.4049/jimmunol.168.5.2101. [DOI] [PubMed] [Google Scholar]
  • 36.Loder F, Mutschler B, Ray RJ, Paige CJ, Sideras P, Torres, Lamers MC, Carsetti R. B Cell Development in the Spleen Takes Place in Discrete Steps and Is Determined by the Quality of B Cell Receptor–derived Signals. J. Exp. Med. 1999;190:75–90. doi: 10.1084/jem.190.1.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bernhagen J, Mitchell RA, Calandra T, Voelter W, Cerami A, Bucala R. Purification, bioactivity, and secondary structure analysis of mouse and human macrophage migration inhibitory factor (MIF) Biochemistry. 1994;33:14144–14155. doi: 10.1021/bi00251a025. [DOI] [PubMed] [Google Scholar]
  • 38.Luger D, Dayan M, Zinger H, Liu JP, Mozes E. A peptide based on the complementarity determining region 1 of a human monoclonal autoantibody ameliorates spontaneous and induced lupus manifestations in correlation with cytokine immunomodulation. J Clin Immunol. 2004;24:579–590. doi: 10.1007/s10875-004-6245-2. [DOI] [PubMed] [Google Scholar]
  • 39.Parameswaran R, Ben David H, Sharabi A, Zinger H, Mozes E. B-cell activating factor (BAFF) plays a role in the mechanism of action of a tolerogenic peptide that ameliorates lupus. Clinical Immunology. 2009;131:223–232. doi: 10.1016/j.clim.2008.12.009. [DOI] [PubMed] [Google Scholar]
  • 40.Iyer a., Kmiecik TE, Park M, Daar I, Blair D, Dunn KJ, Sutrave P, Ihle JN, Bodescot M, Vandewoude GF. Structure, Tissue-Specific Expression, and Transforming Activity of the Mouse Met Protooncogene. Cell Growth & Differentiation. 1990;1:87–95. [PubMed] [Google Scholar]
  • 41.Suzuki a., Zheng YW, Kaneko S, Onodera M, Fukao K, Nakauchi H, Taniguchi H. Clonal identification and characterization of self-renewing pluripotent stem cells in the developing liver. Journal of Cell Biology. 2002;156:173–184. doi: 10.1083/jcb.200108066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Derksen PWB, de Gorter DJJ, Meijer HP, Bende RJ, van Dijk M, Lokhorst HM, Bloem AC, Spaargaren M, Pals ST. The hepatocyte growth factor/Met pathway controls proliferation and apoptosis in multiple myeloma. Leukemia. 2003;17:764–774. doi: 10.1038/sj.leu.2402875. [DOI] [PubMed] [Google Scholar]
  • 43.Derksen PWB, Keehnen RMJ, Evers LM, van Oers MHJ, Spaargaren M, Pals ST. Cell surface proteoglycan syndecan-1 mediates hepatocyte growth factor binding and promotes Met signaling in multiple myeloma. Blood. 2002;99:1405–1410. doi: 10.1182/blood.v99.4.1405. [DOI] [PubMed] [Google Scholar]
  • 44.Geahlen RL. Syk and pTyr’d: Signaling through the B cell antigen receptor. Biochim. Biophys. Acta. 2009 doi: 10.1016/j.bbamcr.2009.03.004. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ma PC, Jagadeeswaran R, Jagadeesh S, Tretiakova MS, Nallasura V, Fox EA, Hansen M, Schaefer E, Naoki K, Lader A, Richards W, Sugarbaker D, Husain AN, Christensen JG, Salgia R. Functional expression and mutations of c-met and its therapeutic inhibition with SU11274 and small interfering RNA in non-small cell lung cancer. Cancer Research. 2005;65:1479–1488. doi: 10.1158/0008-5472.CAN-04-2650. [DOI] [PubMed] [Google Scholar]
  • 46.Calandra T, Froidevaux W, Martin C, Roger T. Macrophage migration inhibitory factor and host innate immune defenses against bacterial sepsis. Journal of Infectious Diseases. 2003;187:S385–S390. doi: 10.1086/374752. [DOI] [PubMed] [Google Scholar]
  • 47.Lantner F, Starlets D, Gore Y, Flaishon L, Yamit-Hezi A, Dikstein R, Leng L, Bucala R, Machluf Y, Oren M, Shachar I. CD74 induces TAp63 expression leading to B cell survival. Blood. 2007;110:4303–4311. doi: 10.1182/blood-2007-04-087486. [DOI] [PubMed] [Google Scholar]
  • 48.Tulasne D, Foveau B. The shadow of death on the MET tyrosine kinase receptor. Cell Death and Differentiation. 2008;15:427–434. doi: 10.1038/sj.cdd.4402229. [DOI] [PubMed] [Google Scholar]
  • 49.Birchmeier C, Gherardi E. Developmental roles of HGF/SF and its receptor, the c-Met tyrosine kinase. Trends in Cell Biology. 1998;8:404–410. doi: 10.1016/s0962-8924(98)01359-2. [DOI] [PubMed] [Google Scholar]
  • 50.Giordano S, Ponzetto C, Direnzo MF, Cooper CS, Comoglio PM. Tyrosine Kinase Receptor Indistinguishable from the C-Met Protein. Nature. 1989;339:155–156. doi: 10.1038/339155a0. [DOI] [PubMed] [Google Scholar]
  • 51.Rusciano D, Lorenzoni P, Burger MM. Expression of Constitutively Activated Hepatocyte Growth-Factor Scatter Factor-Receptor (C-Met) in B16 Melanoma-Cells Selected for Enhanced Liver Colonization. Oncogene. 1995;11:1979–1987. [PubMed] [Google Scholar]
  • 52.Wang R, Kobayashi R, Bishop JM. Cellular adherence elicits ligand-independent activation of the Met cell-surface receptor. Proceedings of the National Academy of Sciences of the United States of America. 1996;93:8425–8430. doi: 10.1073/pnas.93.16.8425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.van der Voort ER, van Dijken H, Kuipers B, van der Biezen J, van der Ley P, Meylis J, Claassen I, Poolman J. Human B- and T-cell responses after immunization with a hexavalent PorA meningococcal outer membrane vesicle vaccine. Infect Immun. 1997;65:5184–5190. doi: 10.1128/iai.65.12.5184-5190.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Weimar IS, deJong D, Muller EJ, Nakamura T, vanGorp JMHH, deGast GC, Gerritsen WR. Hepatocyte growth factor scatter factor promotes adhesion of lymphoma cells to extracellular matrix molecules via alpha(4)beta(1) and alpha(5)beta(1) integrins. Blood. 1997;89:990–1000. [PubMed] [Google Scholar]
  • 55.Tjin EPM, Bende RJ, Derksen PWB, van Huijstee AP, Kataoka H, Spaargaren M, Pals ST. Follicular dendritic cells catalyze hepatocyte growth factor (HGF) activation in the germinal center microenvironment by secreting the serine protease HGF activator. Journal of Immunology. 2005;175:2807–2813. doi: 10.4049/jimmunol.175.5.2807. [DOI] [PubMed] [Google Scholar]
  • 56.Meyer-Siegler K, Hudson PB. Enhanced expression of macrophage migration inhibitory factor in prostatic adenocarcinoma metastases. Urology. 1996;48:448–452. doi: 10.1016/S0090-4295(96)00207-5. [DOI] [PubMed] [Google Scholar]
  • 57.Bando H, Matsumoto G, Bando M, Muta M, Ogawa T, Funata N, Nishihira J, Koike M, Toi M. Expression of macrophage migration inhibitory factor in human breast cancer: association with nodal spread. Jpn. J. Cancer Res. 2002;93:389–396. doi: 10.1111/j.1349-7006.2002.tb01269.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Nishihira J, Ishibashi T, Fukushima T, Sun B, Sato Y, Todo S. Macrophage migration inhibitory factor (MIF): Its potential role in tumor growth and tumor-associated angiogenesis. Ann. N Y. Acad. Sci. 2003;995:171–182. doi: 10.1111/j.1749-6632.2003.tb03220.x. [DOI] [PubMed] [Google Scholar]
  • 59.Chesney J, Metz C, Bacher M, Peng T, Meinhardt A, Bucala R. An essential role for macrophage migration inhibitory factor (MIF) in angiogenesis and the growth of a murine lymphoma. Mol. Med. 1999;5:181–191. [PMC free article] [PubMed] [Google Scholar]
  • 60.Meyer-Siegler KL, Leifheit EC, Vera PL. Inhibition of macrophage migration inhibitory factor decreases proliferation and cytokine expression in bladder cancer cells. BMC Cancer. 2004;4:34–45. doi: 10.1186/1471-2407-4-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Ishigami S, Natsugoe S, Tokuda K, Nakajo A, Iwashige H, Aridome K, Hokita S, Aikou T. Invariant chain expression in gastric cancer. Cancer Lett. 2001;168:87–91. doi: 10.1016/s0304-3835(01)00503-1. [DOI] [PubMed] [Google Scholar]
  • 62.Young AN, Amin MB, Moreno CS, Lim SD, Cohen C, Petros JA, Marshal FF, Neish AS. Expression profiling of renal epithelial neoplasms: a method for tumor classification and discovery of diagnostic molecular markers. Am. J. Pathol. 2001;158:1639–1651. doi: 10.1016/S0002-9440(10)64120-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Ioachim HL, Pambuccian SE, Hekimgil M, Giancotti FR, Dorsett BH. Lymphoid monoclonal antibodies reactive with lung tumors. Diagnostic applications. Am. J. Surg. Pathol. 1996;20:64–71. doi: 10.1097/00000478-199601000-00007. [DOI] [PubMed] [Google Scholar]
  • 64.Datta MW, Shahsafaei A, Nadler LM, Freeman GJ, Dorfman DM. Expression of MHC class II-associated invariant chain (Ii;CD74) in thymic epithelial neoplasms. Appl. Immunohistochem. Mol. Morphol. 2000;8:210–215. doi: 10.1097/00129039-200009000-00007. [DOI] [PubMed] [Google Scholar]
  • 65.Lazova R, Moynes R, May D, Scott G. LN-2 (CD74). A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 1997;79:2115–2124. doi: 10.1002/(sici)1097-0142(19970601)79:11<2115::aid-cncr8>3.0.co;2-n. [DOI] [PubMed] [Google Scholar]
  • 66.Mizue Y, Nishihira J, Miyazaki T, Fujiwara S, Chida M, Nakamura K, Kikuchi K, Mukai M. Quantitation of macrophage migration inhibitory factor (MIF) using the one-step sandwich enzyme immunosorbent assay: elevated serum MIF concentrations in patients with autoimmune diseases and identification of MIF in erythrocytes. Int. J. Mol. Med. 2000;5:397–403. doi: 10.3892/ijmm.5.4.397. [DOI] [PubMed] [Google Scholar]
  • 67.Stein R, Qu Z, Cardillo TM, Chen S, Rosario A, Horak ID, Hansen HJ, Goldenberg DM. Antiproliferative activity of a humanized anti-CD74 monoclonal antibody, hLL1, on B-cell malignancies. Blood. 2004;104:3705–3711. doi: 10.1182/blood-2004-03-0890. [DOI] [PubMed] [Google Scholar]
  • 68.Binsky I, Haran M, Starlets D, Gore Y, Lantner F, Harpaz N, Leng L, Goldenberg DM, Shvidel L, Berrebi A, Bucala R, Shachar I. IL-8 secreted in a macrophage migration-inhibitory factor- and CD74-dependent manner regulates B cell chronic lymphocytic leukemia survival. Proc Natl Acad Sci U S A. 2007;104:13408–13413. doi: 10.1073/pnas.0701553104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Gentile a., Trusolino L, Comoglio PM. The Met tyrosine kinase receptor in development and cancer. Cancer and Metastasis Reviews. 2008;27:85–94. doi: 10.1007/s10555-007-9107-6. [DOI] [PubMed] [Google Scholar]
  • 70.Migliore C, Giordano S. Molecular cancer therapy: Can our expectation be MET? European Journal of Cancer. 2008;44:641–651. doi: 10.1016/j.ejca.2008.01.022. [DOI] [PubMed] [Google Scholar]
  • 71.Borset M, HjorthHansen H, Seidel C, Sundan A, Waage A. Hepatocyte growth factor and its receptor c-met in multiple myeloma. Blood. 1996;88:3998–4004. [PubMed] [Google Scholar]
  • 72.Teofili L, Di Febo AL, Pierconti F, Maggiano N, Bendandi M, Rutella S, Cingolani A, Di Renzo N, Musto P, Pileri S, Leone G, Larocca LM. Expression of the c-met proto-oncogene and its ligand, hepatocyte growth factor, in Hodgkin disease. Blood. 2001;97:1063–1069. doi: 10.1182/blood.v97.4.1063. [DOI] [PubMed] [Google Scholar]
  • 73.Hsiao LT, Lin JT, Yu IT, Chiou TJ, Liu JH, Yen CC, Wang WS, Chen PM. High serum hepatocyte growth factor level in patients with non-Hodgkin’s lymphoma. European Journal of Haematology. 2003;70:282–289. doi: 10.1034/j.1600-0609.2003.00059.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplemental figures
NIHMS451962-supplement-supplemental_figures.pdf (49.2KB, pdf)

RESOURCES