Abstract
We detected Toxoplasma gondii in 29.3% (95% confidence interval [CI], 25.5% to 33.1%) of 550 insectivorous bats collected in Myanmar. The genotyping of these positive samples revealed they were closely related to or belong to clonal type I, which is highly virulent in mice, showing that these bats are potential reservoirs for T. gondii transmission.
TEXT
Toxoplasma gondii is an important intracellular protozoan parasite that infects almost all warm-blooded animals, including humans. The infection can cause serious diseases in the developing fetus and immunocompromised individuals (1). The life cycle of T. gondii includes the felids as the definitive hosts and other animals and humans as the intermediate hosts (2). The infections are obtained by the ingestion of oocysts in the environment, by the consumption of tissue bradyzoites in infected intermediate hosts, or by congenital transmission (3).
Bats are important to public health because they may serve as natural reservoirs for many pathogens, such as rabies virus, Hantavirus, Marburg virus, and others, and have become important infection sources for a variety of etiologic agents (4). In addition to viruses, bacteria, fungi, and protozoa have been found in bats and can potentially be transmitted to humans (5–7). The ability of bats to fly and their social life contribute to the maintenance, evolution, and spread of pathogens (8).
Although bats represent approximately 20% of the known species of mammals, only two cases of toxoplasmosis have recently been described in captive bats in Australia (9), and several T. gondii strains have been isolated in Kazakhstan (10) and in Brazil (11, 12). The prevalence of T. gondii infection was reported to be 13.4% in British insectivorous bats (N. Dodd, J. Lord, D. Brooks, and G. Hide, presented at the XII International Congress of Parasitology, Melbourne, Australia, 2010). T. gondii has three main clonal lineages, designated types I, II, and III, based on multilocus restriction fragment length polymorphism (RFLP) analysis. Type I is highly virulent in mice, while type II and III strains are less virulent (13). The genetic characterization of T. gondii may vary in different animals or geographic regions. This study was conducted to determine the prevalence and genotypes of T. gondii in bats in Myanmar.
Bat collection and species.
The study was approved by the Ethics Committee of the Veterinary Institute, Academy of Military Medical Sciences. A total of 550 insectivorous bats were captured in caves and residential areas in Sedon and Wutao counties, southern Myanmar, close to Tengchong County, Yunnan Province, China, in 2008. These bats belonged to 6 species of 5 genera, including Miniopterus fuliginosus, Rhinolophus ferrumequinum, Myotis chinensis, Hipposideros fulvus, Hipposideros armiger, and Megaderma lyra. The dominant bat species was M. fuliginosus (64.2%), followed by R. ferrumequinum (29.5%), H. fulvus (2.0%), M. chinensi (1.8%), H. armiger (1.5%), and M. lyra (1.1%) (Table 1).
Table 1.
Prevalence of T. gondii in different bat species from Myanmar
| Bat species | No. (%) of bats examineda | No. of bats positive | Prevalence, % (95% CI)b |
|---|---|---|---|
| Miniopterus fuliginosus | 353 (64.2) | 137 | 38.8 (33.7–43.9) |
| Rhinolophus ferrumequinum | 162 (29.5) | 8 | 4.9 (1.6–8.3) |
| Myotis chinensis | 10 (1.8) | 9 | 90.0 (55.5–99.8) |
| Hipposideros fulvus | 11 (2.0) | 0 | 0 (0) |
| Hipposideros armiger | 8 (1.5) | 1 | 12.5 (0.3–52.7) |
| Megaderma lyra | 6 (1.1) | 6 | 100 (54.1–100) |
| Total | 550 | 161 | 29.3 (25.5–33.1) |
Percentage of the total bats collected.
A significant difference was found in prevalence of T. gondii in different bat species, which was analyzed by Fisher's exact test. The 95% confidence intervals (CI) are also indicated.
DNA extraction, nested PCR, and PCR-RELP.
The sampled bats were euthanized, organs (lung, heart, liver, spleen, stomach, gut, and kidney) from single bats were pooled, and genomic DNA was extracted using the TIANamp genomic DNA kit (Tiangen, Beijing, China). T. gondii infection in bats was tested by a nested PCR targeting the B1 gene as described elsewhere (14). Genotyping was conducted using 11 genetic markers for PCR-RFLP (i.e., SAG1, SAG2, alter.SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, and Apico), as previously described (13, 15). Genomic DNA of the T. gondii RH strain was used as a positive control, and molecular-grade water was used as a negative control, both of which were included in each PCR run. The primers used in this study are listed in Table 2.
Table 2.
Nested PCR primers used for nested PCR and nested PCR-RELP of T. gondii in bats
| Marker | Sequence (5′→3′)a |
|
|---|---|---|
| External primers | Internal primers | |
| B1 | F: GGAACTGCATCCGTTCATGAG | F: TGCATAGGTTGCAGTCACTG |
| R: TCTTTAAAGCGTTCGTGGTC | R: GGCGACCAATCTGCGAATACACC | |
| SAG1 | F: GTTCTAACCACGCACCCTGAG | F: CAATGTGCACCTGTAGGAAGC |
| R: AAGAGTGGGAGGCTCTGTGA | R: GTGGTTCTCCGTCGGTGTGAG | |
| 5′-SAG2 | F: TCTGTTCTCCGAAGTGACTCC | F: GAAATGTTTCAGGTTGCTGC |
| R: TCAAAGCGTGCATTATCGC | R: GCAAGAGCGAACTTGAACAC | |
| 3′-SAG2 | F: TCTGTTCTCCGAAGTGACTCC | F: ATTCTCATGCCTCCGCTTC |
| R: TCAAAGCGTGCATTATCGC | R: AACGTTTCACGAAGGCACAC | |
| alter.SAG2 | F: GGAACGCGAACAATGAGTTT | F: ACCCATCTGCGAAGAAAACG |
| R: GCACTGTTGTCCAGGGTTTT | R: ATTTCGACCAGCGGGAGCAC | |
| SAG3 | F: CAACTCTCACCATTCCACCC | F: TCTTGTCGGGTGTTCACTCA |
| R: GCGCGTTGTTAGACAAGACA | R: CACAAGGAGACCGAGAAGGA | |
| BTUB | F: TCCAAAATGAGAGAAATCGT | F: GAGGTCATCTCGGACGAACA |
| R: AAATTGAAATGACGGAAGAA | R: TTGTAGGAACACCCGGACGC | |
| GRA6 | F: ATTTGTGTTTCCGAGCAGGT | F: TTTCCGAGCAGGTGACCT |
| R: GCACCTTCGCTTGTGGTT | R: TCGCCGAAGAGTTGACATAG | |
| C22-8 | F: TGATGCATCCATGCGTTTAT | F: TCTCTCTACGTGGACGCC |
| R: CCTCCACTTCTTCGGTCTCA | R: AGGTGCTTGGATATTCGC | |
| C29-2 | F: ACCCACTGAGCGAAAAGAAA | F: AGTTCTGCAGAGTGTCGC |
| R: AGGGTCTCTTGCGCATACAT | R: TGTCTAGGAAAGAGGCGC | |
| L358 | F: TCTCTCGACTTCGCCTCTTC | F: AGGAGGCGTAGCGCAAGT |
| R: GCAATTTCCTCGAAGACAGG | R: CCCTCTGGCTGCAGTGCT | |
| PK1 | F: GAAAGCTGTCCACCCTGAAA | F: CGCAAAGGGAGACAATCAGT |
| R: AGAAAGCTCCGTGCAGTGAT | R: TCATCGCTGAATCTCATTGC | |
| Apico | F: TGGTTTTAACCCTAGATTGTGG | F: GCAAATTCTTGAATTCTCAGTT |
| R: AAACGGAATTAATGAGATTTGAA | R: GGGATTCGAACCCTTGATA | |
F, forward primer; R, reverse primer.
Prevalence of T. gondii infection in bats.
Of the 6 bat species tested, 5 were positive for T. gondii infection, and H. fulvus was negative (Table 1). Among 550 bats, 161 (29.3%; 95% confidence interval [CI], 25.5% to 33.1%) were infected. The infection rate was high in several bat species, e.g., 6 of 6 M. lyra bats (100%; 95% CI, 54.1% to 100%), and 9 of 10 M. chinensis bats (90%; 95% CI, 55.5% to 99.8%). Low prevalences of T. gondii infection were found in R. ferrumequinum (4.9%; 95% CI, 1.6% to 8.3%) and H. armiger (12.5%; 95% CI, 0.3% to 52.7%). Due to the limited numbers of samples from several bat species (M. chinensis, H. fulvus, H. armiger, and M. lyra) in this study, the prevalence of T. gondii infection in the bats should be investigated further.
Genotyping of T. gondii in bats.
From these 161 positive samples, only 19 (11.8%) were successfully genotyped at 9 or more genetic loci, most likely due to a low DNA concentration in these samples. The typing results are summarized in Table 3. Based on the data obtained in the present study, the majority (15/19 [78.9%]) of T. gondii strains from bats in Myanmar did not match the identified RFLP genotypes listed in ToxoDB (www.toxodb.org) and were thus atypical and mixed novel genotypes. However, the other three samples, including TgBatMm11 from M. fuliginosus and TgBatMm15 and TgBatMm19 from M. chinensis, matched the known ToxoDB genotype 10, in which TgBatMm11 was the clonal type I, but the other two were not confirmed type I because there were some missing markers. The sample TgBatMm18 from M. chinensis may belong to ToxoDB 10 or 27 at 10 loci, except for the c29-2 locus, for which no PCR product was found.
Table 3.
Multilocus genotyping of T. gondii isolates in bats from Myanmar by PCR-RFLP analysis
| Host and isolate ID | PCR-RFLP genotype by genetic markera |
ToxoDB genotyped | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SAG1 | 5′ + 3′ SAG2b | alter.SAG2 | SAG3 | BTUB | GRA6 | c22-8 | c29-2c | L358 | PK1 | Apico | ||
| Miniopterus fuliginosus | ||||||||||||
| TgBatMm1 | ND | II | I | I | ND | I | I | u-1 | II | I | I | Novel 1 |
| TgBatMm2 | ND | I | I | I | I | ND | I | u-1 | II | I | I | Novel 2 |
| TgBatMm3 | II/III | I | I | I | I | ND | ND | u-1 | ND | I | I | Novel 3 |
| TgBatMm4 | II/III | I | I | I | ND | I | I | u-1 | II | II | I | Novel 4 |
| TgBatMm5 | ND | I | I | I | I | I | I | u-1 | I+II | I | I | Novel 5 |
| TgBatMm6, -9 | I | I | I | I | I | I | I | u-1 | I | I | I | Novel 6 |
| TgBatMm7 | I | I | I | I | I | I | I | u-1 | ND | I | I | Novel 7 |
| TgBatMm8 | II/III | I | I | ND | I | I | I | u-1 | II | I | I | Novel 8 |
| TgBatMm10 | ND | I | I | I | I | III | I | I | u-1 | ND | I | Novel 9 |
| TgBatMm11 | I | I | I | I | I | I | I | I | I | I | I | 10 |
| TgBatMm12 | I | I | ND | I | I | III | I | I | II | ND | I | Novel 10 |
| Megaderma lyra | ||||||||||||
| TgBatMm13 | I | I | I | I | I | III | I | ND | I | I | I | Novel 11 |
| TgBatMm14 | I | I | I | I | I | I | I | u-1 | II | ND | I | Novel 12 |
| Myotis chinensis | ||||||||||||
| TgBatMm15 | I | I | I | I | I | I | I | I | ND | I | I | 10 (?) |
| TgBatMm16 | I | I | I | I | I | I | I | ND | II | I | I | Novel 13 |
| TgBatMm17 | I | I | I | I | I | III | I | I | II | I | ND | Novel 14 |
| TgBatMm18 | I | I | I | I | I | I | I | ND | I | I | I | 10, 27 (?) |
| TgBatMm19 | I | I | I | I | I | I | I | I | I | ND | ND | 10 (?) |
Genotypes of T. gondii were determined according to PCR-RFLP analysis of 12 genetic loci, each locus usually producing three different genotypes, which were grouped into types I, II, or III, based on the three clonal types of reference strains (ToxoDB 10, 1, and 2). ND, no amplification detected due to a low DNA concentration in the sample.
SAG2 marker based on the 5′ and 3′ ends of the gene sequence.
u-1 is the new allele different from the clonal type I, II, and III alleles.
A question mark indicates that the genotype of T. gondii in the sample may represent “others” that are not listed in ToxoDB due to some missing genetic markers.
Among the new genotypes, 2 (TgBatMm6 and-9) could be fully genotyped at all 11 loci, showing alleles of type I at 10 loci; 3 (TgBatMm7, -12, and -16) showed alleles of type I at 9 loci; 3 (TgBatMm5, -15, and -17) were classified into clonal type I at 8 loci; 4 (TgBatMm2, -8, -10, and -11) were grouped into clonal type I at 7 loci; and the other 3 (TgBatMm1, -3, and -4) showed alleles of type I at 6 loci (Table 3). These data demonstrated that the T. gondii strains in bats in Myanmar were closely related to the clonal type I lineage.
Public health significance of T. gondii in bats.
Few studies have been conducted on T. gondii infections in bats. The results of this study demonstrated that T. gondii infections are widely prevalent in insectivorous bats in Myanmar. T. gondii can cause infection by three transmission routes, including horizontal transmission and vertical or congenital transmission. T. gondii oocysts can be mechanically transmitted by certain types of insects to insectivorous bats (16, 17). Recent studies have shown that congenital transmission may play an important role in sustaining T. gondii infection in some species, including sheep and small mammals (18, 19). This transmission mode may be the main infection route in bat species, which needs further investigation. Differences in feeding habits among bat species could explain the different prevalences of T. gondii in bat species.
Previous studies have shown that bats can share the same genotypes of T. gondii found in domestic and wild animals (12). In the present study, T. gondii strains in bats in Myanmar were shown to be closely related to or to belong to clonal type I. As no previous data on the genotypes from different hosts in the studied region have been collected, the role of bats in the epidemiology of T. gondii infections in humans or domestic animals is unknown. However, the clonal type I lineage identified in bats has been found in animals and humans in North America, Europe, and Asia (20–22). In China, clonal type I has also been found, although it is not the predominant genotype (23). However, there is only one report on the T. gondii genotype in Yunnan Province, near the China-Myanmar border, with ToxoDB 19 found in pigs (24). Therefore, we cannot determine whether T. gondii in bats from Myanmar is transmitted to China by bats. The genetic diversity of T. gondii in Myanmar and along the China-Myanmar border should be further investigated to determine the public health significance of T. gondii in bats. To our knowledge, this study is the first report on molecular detection of T. gondii infection in bats in Asia.
ACKNOWLEDGMENTS
This work was supported by grants from NSFC-Yunnan Province Joint Fund (U1036601), the National Natural Science Foundation of China (31001057), the National Basic Research Program of China (973 Program) (2012CB722501), and the National Science & Technology Pillar Program during the Twelfth Five-Year Plan Period (2013BAD12B04).
Footnotes
Published ahead of print 29 March 2013
REFERENCES
- 1. Montoya JG, Liesenfeld O. 2004. Toxoplasmosis. Lancet 363: 1965– 1976 [DOI] [PubMed] [Google Scholar]
- 2. Dubey JP. 2009. History of the discovery of the life cycle of Toxoplasma gondii. Int. J. Parasitol. 39: 877– 882 [DOI] [PubMed] [Google Scholar]
- 3. Tenter AM, Heckeroth AR, Weiss LM. 2000. Toxoplasma gondii: from animals to humans. Int. J. Parasitol. 30: 1217– 1258 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Smith I, Wang LF. 2013. Bats and their virome: an important source of emerging viruses capable of infecting humans. Curr. Opin. Virol. 3: 84– 91 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Concannon R, Wynn-Owen K, Simpson VR, Birtles RJ. 2005. Molecular characterization of haemoparasites infecting bats (Microchiroptera) in Cornwall, UK. Parasitology 131: 489– 496 [DOI] [PubMed] [Google Scholar]
- 6. Gibson KE, Rikihisa Y, Zhang C, Martin C. 2005. Neorickettsia risticii is vertically transmitted in the trematode Acanthatrium oregonense and horizontally transmitted to bats. Environ. Microbiol. 7: 203– 212 [DOI] [PubMed] [Google Scholar]
- 7. Grisard EC, Sturm NR, Campbell DA. 2003. A new species of trypanosome, Trypanosoma desterrensis sp. n., isolated from South American bats. Parasitology 127: 265– 271 [DOI] [PubMed] [Google Scholar]
- 8. Hayman DT, Bowen RA, Cryan PM, McCracken GF, O'Shea TJ, Peel AJ, Gilbert A, Webb CT, Wood JL. 2013. Ecology of zoonotic infectious diseases in bats: current knowledge and future directions. Zoonoses Public Health 60: 2– 21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Sangster CR, Gordon AN, Hayes D. 2012. Systemic toxoplasmosis in captive flying-foxes. Aust. Vet. J. 90: 140– 142 [DOI] [PubMed] [Google Scholar]
- 10. Schmidt S, Galvao AB, Fernandes WJ, Oliveira RL. 1969. Do primeiro encontro do Toxoplasma gondii (Nicolle & Manceaux, 1909) em morcegos. Rev. Goiana. Med. 15: 149– 154 [Google Scholar]
- 11. Beyer TV, Shevkunova EA. 1986. A review of toxoplasmosis of animals in the U.S.S.R. Vet. Parasitol. 19: 225– 243 [DOI] [PubMed] [Google Scholar]
- 12. Cabral AD, Gama AR, Sodre MM, Savani ES, Galvao-Dias MA, Jordao LR, Maeda MM, Yai LE, Gennari SM, Pena HF. 2013. First isolation and genotyping of Toxoplasma gondii from bats (Mammalia: Chiroptera). Vet. Parasitol. 193: 100– 104 [DOI] [PubMed] [Google Scholar]
- 13. Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. 2010. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii. Parasitology 137: 1– 11 [DOI] [PubMed] [Google Scholar]
- 14. Jones CD, Okhravi N, Adamson P, Tasker S, Lightman S. 2000. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Invest. Ophthalmol. Vis. Sci. 41: 634– 644 [PubMed] [Google Scholar]
- 15. Su C, Zhang X, Dubey JP. 2006. Genotyping of Toxoplasma gondii by multilocus PCR-RFLP markers: a high resolution and simple method for identification of parasites. Int. J. Parasitol. 36: 841– 848 [DOI] [PubMed] [Google Scholar]
- 16. Graczyk TK, Knight R, Tamang L. 2005. Mechanical transmission of human protozoan parasites by insects. Clin. Microbiol. Rev. 18: 128– 132 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Jones JL, Dubey JP. 2010. Waterborne toxoplasmosis—recent developments. Exp. Parasitol. 124: 10– 25 [DOI] [PubMed] [Google Scholar]
- 18. Hide G, Morley EK, Hughes JM, Gerwash O, Elmahaishi MS, Elmahaishi KH, Thomasson D, Wright EA, Williams RH, Murphy RG, Smith JE. 2009. Evidence for high levels of vertical transmission in Toxoplasma gondii. Parasitology 136: 1877– 1885 [DOI] [PubMed] [Google Scholar]
- 19. Thomasson D, Wright EA, Hughes JM, Dodd NS, Cox AP, Boyce K, Gerwash O, Abushahma M, Lun ZR, Murphy RG, Rogan MT, Hide G. 2011. Prevalence and co-infection of Toxoplasma gondii and Neospora caninum in Apodemus sylvaticus in an area relatively free of cats. Parasitology 138: 1117– 1123 [DOI] [PubMed] [Google Scholar]
- 20. Khan A, Dubey JP, Su C, Ajioka JW, Rosenthal BM, Sibley LD. 2011. Genetic analyses of atypical Toxoplasma gondii strains reveal a fourth clonal lineage in North America. Int. J. Parasitol. 41: 645– 655 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Kim HY, Kim YA, Lee HS, Rhie HG, Cho SH, Yu JR, Lee SE. 2009. Genotype of Toxoplasma gondii from blood of stray cats in Gyeonggi-do, Korea. Korean J. Parasitol. 47: 413– 415 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Minot S, Melo MB, Li F, Lu D, Niedelman W, Levine SS, Saeij JP. 2012. Admixture and recombination among Toxoplasma gondii lineages explain global genome diversity. Proc. Natl. Acad. Sci. U. S. A. 109: 13458– 13463 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Zhou P, Zhang H, Lin RQ, Zhang DL, Song HQ, Su C, Zhu XQ. 2009. Genetic characterization of Toxoplasma gondii isolates from China. Parasitol. Int. 58: 193– 195 [DOI] [PubMed] [Google Scholar]
- 24. Zhou P, Sun XT, Yin CC, Yang JF, Yuan ZG, Yan HK, Zhu XQ, Zou FC. 2011. Genetic characterization of Toxoplasma gondii isolates from pigs in southwestern China. J. Parasitol. 97: 1193– 1195 [DOI] [PubMed] [Google Scholar]