Determination of Helicobacter pylori Virulence Genes in Gastric Biopsies by PCR

Abstract

Aim. The aim of this study was to identify the presence of H. pylori in biopsy specimens from symptomatic patients by PCR. In addition, the rate of cagA, vacA, iceA1, and iceA2 virulence genes was determined. Materials and Methods. One hundred antral gastric biopsy specimens were collected during endoscopy from patients suffering from gastroduodenal symptoms. The samples were collected by the gastroenterologists in their own clinics in Ramallah, Palestine. DNA was extracted from the biopsies and subsequently used for PCR identification of H. pylori and the virulence genes using specific primers. Results. The rate of positive H. pylori in the collected biopsies was 44%. The rates of the virulence genes in this sample: cagA, vacA, iceA1, and iceA2 were 65.9%, 40.9%, 63.6%, and 84.1%, respectively. Conclusion. The iceA2 gene was the most frequent in this study. Much research is necessary to determine the presence of an association of this gene with gastric pathology. Variation in the rates of the iceA gene in different countries is a strong indication of its geographical distribution. This study would provide important information regarding the prevalence of virulence genes (vacA, cagA, iceA1, and iceA2) in H. pylori strains in the sample tested in this country.

1. Introduction

Helicobacter pylori is a microaerophilic, spiral shaped Gram-negative bacterium that colonizes the human stomach. It has been linked to chronic active gastritis, peptic ulcers disease, gastric cancer, and mucosa-associated lymphoid tissue lymphoma [1, 2]. H. pylori has been classified as a definite class I carcinogen by the World Health Organization [3]. Although the prevalence of H. pylori infection may exceed 70% in some developing countries [4, 5], only a small percentage of the population develop severe disease. This can be attributed to the involvement of specific factors that contribute to the pathogenicity of this organism. The cytotoxin-associated gene (cagA), a marker for cag pathogenicity island, is associated with severe clinical diseases as seen in peptic ulcer disease and gastric adenocarcinoma [1]. The vacuolating cytotoxin (vacA) gene encodes for the vacuolating cytotoxin, the pore forming toxin which causes progressive vacuolation and injury to gastric epithelium [6, 7]. The induced by contact with epithelium (iceA) A gene has been considered as the marker for peptic ulcer disease.

The aims of this study were to identify H. pylori directly from biopsy specimen collected from symptomatic patients using primers to amplify the ureA and glmM (ureC) genes and to determine the rate of virulence genes, cagA, vacA, iceA1 and iceA2, in the biopsy samples by PCR.

2. Methods

2.1. Specimen Collection and Processing

Antral gastric biopsy specimens were collected during upper endoscopy from 100 patients suffering from gastroduodenal symptoms. Patient's consent to participate in this study was obtained prior to enrollment. The samples were collected by gastroenterologists between January and August 2012. DNA was extracted from the biopsies by the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions. Extracted DNA was used for subsequent PCR experiments.

2.2. Polymerase Chain Reaction

Amplification was conducted in a total volume of 25 μL. The reaction mixture contained 12.5 uL, 2X ready PCR mix (Thermo Scientific) and consisted of 1.25 U Taq-Pol, 75 mM Tris-HCL (pH 8.8), 1.5 mM MgCl₂, and 0.2 mM of each dNTP. The reaction mixture contained 12.5 uL master mix, 1.0 uM of each forward and reverse primers (Table 1), 1 ug DNA template, and 8.5 uL RNase free water to a total volume of 25 uL. The amplification was carried out in a C-1000 thermal cycler (Bio-Rad, USA) according to the following program: an initial denaturation step at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing, primer specific shown in Table 1 for 1 min, and a final extension step at 72°C for 5 min. Amplified PCR products were resolved by agarose gel electrophoresis (5 V/60 min) using 1,5% agarose in Tris Acetate-EDTA (TAE) buffer containing 0.5 ug/mL of ethidium bromide. Molecular size ladder of 100 bp (Fermentans, Germany) was used to determine the size of the bands. The gel was viewed and photographed on a Gel-Doc System (Bio-Rad, USA). The primers used for the amplifications were obtained from Invitrogen (Rhenium, Jerusalem), shown in Table 1.

Table 1.

Primers used for the amplification of H. pylori genes.

Primer	5′-3′ sequence	Product size (bp)	Annealing (°C)
CagA-F	AATACACCAACGCCTCCAAG	400	55
CagA-R	TTGTTGGCGCTTGCTCTC
VacA-3.AS	GCCGATATGCAAATGAGCCGC	678	66
VacA-1.SE	CAATCGTGTGGGTTCTGGAGC
IceA1-F	CGTTGGGTAAGCGTTACAGAATTT	558	56
IceA1-R	TCATTGTATATCCTATCATTACAAG
IceA2-F	GTTGTCGTTGTTTTAATGAA	120	50
IceA2-R	GTCTTAAACCCCACGATTAAA
HPU1	GCCAATGGTAAATTAGTT	411	45
HPU2	CTCCTTAATTGTTTTTAC
GlmM-F	AAGCTTTTAGGGGTGTTAGGGGTTT	294	55
GlmM-R	AAGCTTACTTTCTAACACTAACGC

3. Results

Antral biopsies were collected from 100 patients. Molecular identification of H. pylori was performed on all biopsies by PCR using primers (HPU1, HPU2) to amplify a 411 bp product for the ureA gene and primers (GlmM-F, GlmM-R) to amplify a 294 bp product for the glmM (ureC) gene (Table 2). The rate of positive H. pylori in the biopsies tested was 44% (44/100). The rate of virulence genes cagA, vacA, iceA1, and iceA2 in the positive biopsies for H. pylori is summarized in Table 2.

Table 2.

Genes used in the PCR identification of H. pylori and virulence genes determination.

	Genes
	cagA	vacA	iceA1	iceA2	ureA	gl mM  (ureC)
Positive	29 (65.9%)	19 (43.2%)	28 (63.6%)	37 (84.1%)	41 (93.2%)	43 (98%)
Negative	15 (34.1%)	25 (56.8%)	16 (36.4%)	7 (15.9%)	3 (6.8%)	1 (2%)
Total	44 (100%)	44 (100%)	44 (100%)	44 (100%)	44 (100%)	44 (100%)

4. Discussion

The glmM gene is highly conserved and has been used to identify H. pylori in gastric biopsies. Although it has been reported that the sensitivity and specificity of ureA is more than 90% [8], the glmM gene has better sensitivity than the ureA gene [9]. One of the advantages of using the glmM gene to identify H. pylori directly in gastric biopsies is its high degree of sensitivity and specificity, since it has a detection rate of 10 to 100 H. pylori cells which is better than histopathology [10]. Our findings revealed a rate of positive H. pylori in the tested biopsies of 44% based on direct molecular detection by PCR using the ureA and the glmM genes. To improve DNA extraction from the biopsies and to eliminate PCR inhibitors, a special extraction kit from Qiagen was used [11].

The induced by contact with epithelium (iceA) gene has two allelic forms, iceA1 and iceA2. The iceA1 gene is expressed by H. pylori upon contact with the gastric epithelial cells [12]. Although iceA gene has not been associated with gastric cancer, there is an unresolved controversy for the role of this gene in gastric pathology. Reports have associated the iceA1 allele in peptic ulcer [12, 13] while others did not find any role for this allele in gastroduodenal disease [13]. The iceA2 allele has been inversely associated with peptic ulcer [14].

There are significant variations reported regarding the prevalence of if iceA1 and iceA2 alleles. The iceA1 has been reported to be the prevalent allele in some studies [12] while iceA2 the prevalent allele in others [15].

The iceA2 gene was the most frequent in this study (84.4%). A Brazilian study reported a rate of 90.1% for the iceA2 allele [16]. Contrary to that, a Mexican study reported a rate of 9% for the iceA2 allele, while 72% carried both genes iceA1 and iceA2 [17]. In East Asia, the iceA1 genotype has been reported to be the predominant (76%) while in Portugal and Colombia icaA2 is predominant [18]. The rate of the iceA1 gene in this study was 62.2% and 53.3% of the samples carried both genes iceA1 and iceA2. This variation in rates for the iceA gene in different countries is a strong indication of its geographical distribution.

The cagA results in our study of 65.9% are similar to those obtained in Tunisia of 61.6% [19]. They are higher than those obtained in Pakistan (56%), but lower than rates reported in Iran (76%), Iraq (71%) [19], India, and Bangladesh of 70% [20]. The cagA positive strains in the Mexican study was 86% [17]. In Japan, the rate of cagA is very high (90%) [19], which is correlated with the commonly encountered gastric cancer in that country.

The cagA and the vacA genes are major virulence factors in H. pylori responsible for the gastric pathology. The polymorphic nature of the vacA gene, due to allelic variations in the signal and middle regions of the gene, has not been addressed in this study. The rate of the vacA gene in the sample tested was 40.9%. vacA negative H. pylori has been detected in biopsy specimens in Sweden [21]. Our findings revealed the presence of 7 combinations of genotypes based on the cag/vac genes as shown in Table 2. In one biopsy specimen, cagA negative/vacA negative genotype was encountered. Although the other virulence genes were tested (iceA1 and iceA2), the identity of this isolate as H. pylori was confirmed by repeating the amplification with ureA primers.

In conclusion, this study would provide important information regarding the rate of virulence factors in this country. Determination of virulence genes may provide information regarding the risk of clinical outcomes in symptomatic patients.