Skip to main content
Cell Proliferation logoLink to Cell Proliferation
. 2012 Jun 13;45(4):335–344. doi: 10.1111/j.1365-2184.2012.00828.x

BIX‐01294 treatment blocks cell proliferation, migration and contractility in ovine foetal pulmonary arterial smooth muscle cells

Q Yang 1,✉, Z Lu 1, D Singh 1, J U Raj 1,2
PMCID: PMC3649875  NIHMSID: NIHMS463258  PMID: 22691107

Abstract

Objective

Recent studies have indicated a role of epigenetic phenomena in pathogenesis of pulmonary hypertension, but in foetal pulmonary artery smooth muscle cell (PASMC) proliferation this is still largely unknown. G9a is a key enzyme for histone H3 dimethylation at position lysine‐9. In this study, we have investigated the function of G9a in ovine foetal PASMC proliferation, migration and contractility.

Material and methods

Cell proliferation was measured by cell counting and BrdU incorporation assay and cell cycle analysis was performed by flow cytometry. Expression of cell cycle‐related genes was determined by real‐time PCR and the wound‐healing scratch assay was used to measure cell migration. A gel contraction assay was used to determine contractility of foetal PASMCs. Global DNA methylation was measured by liquid chromatography‐mass spectroscopy.

Results

Inhibition of G9a by its inhibitor BIX‐01294 reduced proliferation of foetal PASMCs and induced cell cycle arrest in G1 phase. This was accompanied by increased p21 expression, but not p53 and other cell cycle‐related genes. Treatment of foetal PASMCs with BIX‐01294 inhibited platelet‐derived growth factor‐induced cell proliferation and migration. Contractility of foetal PASMCs was also markedly inhibited by BIX‐01294. Expression of calponin and ROCK‐II proteins was reduced by BIX‐01294 in a dose‐dependent manner and BIX‐01294 significantly increased global methylation level in the foetal PASMCs.

Conclusion

Our results demonstrate for the first time that histone lysine methylation is involved in cell proliferation, migration, contractility and global DNA methylation in foetal PASMCs. Further understanding of this mechanism may provide insight into proliferative vascular disease in the lungs.

Introduction

Pulmonary arterial hypertension is characterized by vascular remodelling associated with proliferative changes in the arterial wall. Recent studies indicate that epigenetic events may be implicated in pulmonary vascular remodelling 1, however, little is known regarding effects of these events on cell proliferation and migration of foetal pulmonary artery smooth muscle cells (PASMCs).

Histone lysine methyltransferase G9a is a key enzyme for histone H3 dimethylation at lysine‐9 (H3K9me2), and is an epigenetic mark of gene suppression 2. G9a is highly expressed in human cancer cells and plays a key role in promoting malignant cell invasion and metastasis. RNAi‐mediated knockdown of G9a in highly invasive lung cancer cells has been reported to inhibit cell migration and invasion in vitro, and metastasis in vivo 3. p21 is a potent cyclin‐dependent kinase (CDK) inhibitor that plays a critical role in regulation of cell proliferation 4, 5. Promoter regions of p21 have been reported to be bound to G9a, DNA methyltransferase1 and histone deacetylase1, suggesting that G9a and other chromatin modification enzymes may play an important part in regulating p21 expression, leading to inherent changes in cell proliferation 6.

In this study, we have investigated effects of inhibition of G9a, using its specific inhibitor BIX‐01294, on ovine foetal PASMC proliferation and migration and expression of cell cycle‐related genes such as p21 and p53. We have also determined the effects of inhibition of G9a on foetal PASMC contractility and on global DNA methylation.

Materials and methods

Reagents

Histone lysine methyltransferase inhibitor (BIX‐01294) and PDGF‐BB were purchased from Millipore, Bedford, MA, USA, and propidium iodide and the protease inhibitor cocktail were purchased from Sigma, St. Louis, MO, USA.

Preparation of foetal PASMCs

Intrapulmonary arteries, 2nd to 4th generation, from term ovine foetal lungs were dissected free of parenchyma and retained in ice‐cold modified Krebs‐Ringer bicarbonate buffer (composition in mm: 118.3 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, 25.0 NaHCO3, and 11.1 glucose). Primary foetal PASMCs were isolated from the pulmonary arteries 7, and cells were maintained in DMEM containing 10% heat‐inactivated FBS, 400 ng/ml amphotericin B and 160 U/ml penicillin and streptomycin (Invitrogen, Carlsbad, CA, USA). The cells were confirmed as being smooth muscle by their typical ‘hill and valley’ morphology and by α‐smooth muscle actin immunofluorescentce staining. Contamination with endothelial cells was ruled out by negative immunofluorescence staining with an anti‐von Willebrand factor VIII antibody. All experiments were performed with cells at passages 4–8.

Cell number, viability and BrdU incorporation

Cell number was determined by counting, using a haemocytometer and trypan blue staining was performed to differentiate between living and dead cells. Cell proliferation was measured by BrdU incorporation using a proliferation assay kit (Calbiochem, Merk, Darmstadt, Germany), according to the manufacturer's instructions. Briefly, foetal PASMCs were plated in 96‐well plates and starved for 24 h in 0.1% serum‐containing medium. PDGF‐BB (Millipore) was added for 24 h at concentrations indicated, in presence or absence of BIX‐01294. BrdU labelled solution (Calbiochem) was added to each well 18 h prior to analysis. Denaturing solution then was added to each well for 30 min at room temperature after removing fluid contents of wells. Then, anti‐BrdU antibody was added to each well and incubated for 1 h with peroxidase goat anti‐mouse IgG HRP conjugate added for 30 min at room temperature. Absorbance was read at 450–540 nm on a Glomax Multiple Detection System (Promega, Madison, WI, USA).

Cell cycle analysis

Cell cycle distribution was determined by flow cytometric analysis as previously described 8. Briefly, foetal PASMCs were cultured in serum‐free DMEM medium for 24 h. After starvation, medium containing 10% serum was replaced and BIX‐01294 was added at final concentration of 1 μg/ml. Cells were treated for 24 h, then washed in PBS, fixed in 70% ethanol and hypotonically lysed in 500 μl of DNA staining solution [0.05 mg/ml PI (Sigma), 0.1 mg/ml RNase A, and 0.05% Triton X‐100]. Cells were incubated (protected from light), at 37 °C for 40 min. Stained preparations were washed in PBS, and suspended in 300 μl of PBS before analysis. Cell cycle data were analysed using an Epics XL‐MCL flow cytometer (Beckman Coulter, Miami, FL, USA), with System II (version 3.0) software (Beckman Coulter). Additional analysis of cell cycle distribution was determined using Modfit LT (Verity Software House, Topsham, ME, USA).

cDNA synthesis and SYBR green real‐time PCR

Total RNA isolation and cDNA synthesis were performed as previously described 9. Briefly, RNA was isolated using Trizol reagent (Invitrogen). Reverse transcription was performed using Superscript III (Invitrogen) and 50 μm oligo(dT)20 at 50 °C for 50 min. SYBR green real‐time PCR reactions were set up containing 1X Power SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA), 250 nm forward and reverse primers in a 20 μl reaction. All assays were carried out in 96‐well format. Real‐time fluorescence detection of PCR products was performed using the StepOne Plus Real‐Time PCR System (Applied Biosystems) using the following thermocycling conditions: 1 cycle of 95 °C for 10 min; 40 cycles of 95 °C for 30 s, and 60 °C for 1 min; primer sequences are shown in Table 1. Sequences of primers for real‐time PCR were designed using Primer Express software (Applied Biosystems). β‐actin and RPL19 were used as endogenous controls for gene expression. For data analysis, the comparative method (∆∆Ct) was used to calculate relative quantities of any nucleic acid sequence.

Table 1.

Ovine primer sequences for PCR

Gene Assay Sense primer Antisense primer Accession no.
p21 Q‐PCR CCAGACCAGCATGACAGATTTC GCTTCCTCTTGGAGCAGATCAG EE754405.1
CDKN1B Q‐PCR ACACGCATTTGGTCGATCAG GGCAGGTCGCTTCCTTATCC EU126605
CDKN1C Q‐PCR TTATGCCAAAGGCACCTCACT TCCCCCAGAATACGCTACAAA FJ422556
CCND1 Q‐PCR TCGAGCACTTCCTCTCCAAAA GTTTGCGGATGATCTGCTTGT EU525165
CCND2 Q‐PCR GCTGGAGTGGGAGCTTGGT GACAGCTGCCAGGTTCCATT EE828214
CDK4 Q‐PCR GCTTGCCAGTGGAGACCATAAA ATGAAGGAAATCCAGGCCTCTT NM_001127269
PCNA Q‐PCR CCTAAGCCGGTTACACATTCCT GGCGGAGTCGCAATGACA GT644370
p53 Q‐PCR TCTGGGACTTAGTGCCTTTTATGG CAGTCAGAAACTGTCAAATCATCCA X81705
RPL19 Q‐PCR TTGACCGCCACATGTATCACA CCGCTTGTTTTTGAACACGTT AY158223
β‐actin Q‐PCR GCAGATGTGGATCAGCAAGCA AGCATTTGCGGTGGACGAT NM_001009784

siRNA transfection

All siRNA sequences were designed and purchased from Dharmacon (Lafayette, CO, USA). p21 SiRNA sequences are CAGACCAGCAUGACAGAUUUU (sense‐1), AAUCUGUCAUGCUGGUCUGUU (antisense‐1), GCUCCAAGAGGAAGCCCUAUU (sense‐2), UAGGGCUUCCUCUUGGAGCUU (antisense‐2) and D‐001 210‐03‐05 was used as non‐targeting control (nsRNA). Subconfluent foetal PASMCs were transfected with combination of SiRNA‐1 and SiRNA‐2 (50, 100 nm) using 1 μl of siRNA/2.5 μl of lipofectamine 2000 (Invitrogen), in DMEM containing 0.1% FBS, without antibiotics for 6 h. SiRNAs were first resuspended in Optimen® medium (Invitrogen) then mixed together for 20 min before transfection. After 6 h, the complete medium was added and incubated for a further period of 42 h.

Western blot analysis

Total protein from foetal PASMCs was extracted after lysing the cells in cell lysis buffer (RIPA buffer: 20 mm Tris–HCl, pH 7.5, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% IGEPAL, 2.5 mm sodium pyrophosphate, 1 mm β‐glycerophosphate) containing protease and phosphatase inhibitor cocktails (Sigma‐Aldrich, St. Louis, MO, USA), and protein concentration was determined using a Bradford protein assay kit (Bio‐Rad, Hercules, CA, USA). Equal amounts of total protein (10–25 μg) from cells were subjected to SDS–PAGE. Proteins were transferred to nitrocellulose membranes for 90 min at 100 V. Membranes were blocked for 1 h at room temperature in Tris‐buffered saline (TBS) containing 5% non‐fat powdered milk, and were probed with primary antibodies in TBS with 2.5% non‐fat powdered milk, at concentrations from 1:500 to 1:20 000 dilution and pre‐incubated overnight according to the manufacturer's instructions, for each antibody. In all cases, secondary antibody labelled with horseradish peroxidase (GE Life Sciences, Piscataway, NJ, USA) was used at concentrations from 1:2000 to 1:20 000 for 1 h at room temperature, and immunoreactive bands were detected by using SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA) and recorded on photosensitive film. Relative intensities of immunoreactive bands detected by Western blot analysis were quantified by densitometry using NIH Image J software (NIH), and normalized to density of tubulin (Sigma). Apparent molecular masses of bands were also compared. Primary antibodies used for this study included anti‐calponin (Sigma) and anti‐ROCK‐II (BD Transduction Laboratories, Lexington, KY, USA).

Gel contraction assay

Collagen contraction assay was performed as described previously 10. Briefly, collagen gels were prepared according to manufacturer's instructions, to final collagen concentration of 1.5 mg/ml (Becton Dickinson, Franklin Lanes, NJ, USA). Foetal PASMCs were seeded into gel mixtures at 2 × 105/ml, in the presence or absence of 5 μm BIX‐01294, and were allowed to polymerize for 20 min at 37 °C in 48‐well plates. Thereafter, gels were mechanically loosened from sides of wells. Three gels were analysed for each condition in each individual experiment.

Liquid chromatography‐mass spectroscopy

Total cytosine methylation was performed by liquid chromatography‐mass spectroscopy (LC/MS) as described previously 11. Briefly, DNA was hydrolysed to nucleosides by adding 5 U nuclease P1 (Sigma) at 37 °C for 2 h, 0.002 units of venom phosphodiesterase I (Sigma) at 37 °C for 2 h, 0.5 units of alkaline phosphatase at 37 °C for 1 h. Stock solutions of 2′‐deoxycytidine (Sigma) and 5‐methyl‐2′‐deoxycytidine (ChemGenes, Wilmington, MA, USA) were prepared in water. An eight‐point stock mixture of standard was carefully prepared to provide an exact known concentration ratio of 2′‐deoxycytidine and 5‐methyl‐2′‐deoxycytidine. Concentration of 2′‐deoxycytidine and 5‐methyl‐2′‐deoxycytidine in each sample was calculated from the standard curve. Each DNA sample was analysed in triplicate. 25 μl (80 ng) of sample was injected into the LC and was run through an Atlantis DC18 silica column (Waters Corporation, Milford, MA, USA). Identification of 2′‐deoxycytidine and 5‐methyl‐2′‐deoxycytidine was obtained from mass spectra of chromatographic peaks.

Statistical analysis

Statistical analysis of data was performed using a standard two‐sample Student's t‐test, assuming unequal variances of the two data sets. Statistical significance was determined using a two‐tailed distribution assumption and was set at 5% level (P < 0.05).

Results

Effect of G9a inhibition on cell proliferation, cell viability and cell cycle in foetal PASMCs

To test whether G9a regulates foetal PASMCs proliferation, cells were cultured for 24 h in medium containing BIX‐01294. BrdU incorporation assay was performed to detect proliferation of the cells. As shown in Fig. 1a, 1 μg/ml of BIX‐01294 caused ~80% reduction in BrdU incorporation (P < 0.01). Trypan blue staining (Fig. 1b) exhibited no significant difference in cell viability between control and 1 μg/ml BIX‐01294‐treated cells, indicating that BIX‐01294 had blocked cell proliferation.

Figure 1.

Figure 1

Effect of G9a inhibition on cell proliferation, cell viability and cell cycle arrest. (a) Foetal PASMCs were treated with 1 μg/ml of BIX‐01294 for 24 h. Proliferation was assessed by BrdU incorporation. (b) Cell viability was performed by trypan blue staining. (c) Cell cycle distribution was determined by flow cytometric analysis. *P < 0.05 compared with untreated group.

After 24 h serum starvation, foetal PASMCs were cultured for 24 h in 10% FBS with or without BIX‐01294. Cells were stained with propidium iodide to study the cell cycle progression. As shown in Fig. 1c, 63.81 ± 9.1% of foetal PASMCs in the control group were in G0/G1 phase, 26.8 ± 1.7% in S phase and 9.4 ± 7.4% in G2/M. On the other hand, 82.8 ± 5.2% of foetal PASMCs in BIX‐01294‐treated group were in G0/G1 phase, 10.2 ± 1.5% in S phase and 7.1 ± 3.7% in G2/M. This indicated that specific G9a inhibition arrested proliferation of PASMCs from these foetal lambs.

p21 was required for BIX‐01 294‐induced inhibitory effects on foetal PASMC proliferation

To determine whether expression of cell cycle‐related genes was altered after treatment with BIX‐01294, foetal PASMC were treated with BIX‐01294 for 24 h, and expression of genes coding p21, CDKN1B, CDKN1C, CCND1, CCND2, CDK4, p53 and PCNA was measured by quantitative RT‐PCR, with ovine sequence‐specific primers for these eight genes. Using cut‐off value of 2‐fold difference, p21 only was found to be altered by BIX‐01294 treatment (about 3.7‐fold difference), suggesting that inhibition of G9a induced p21 expression (Fig. 2a).

Figure 2.

Figure 2

Role of p21 in BIX ‐01294‐induced inhibition of foetal PASMC proliferation. (a) Foetal PASMCs were treated with BIX‐01294 at 1 μg/ml concentration for 24 h. Total RNA was isolated and real‐time PCR was performed to determine expression of cell cycle‐related genes. RPL19 was used as endogenous control. (b) 50 and 100 nm siRNA for p21 were transfected by lipofectimine 2000. After 6 h, complete medium was added and incubated for further 48 h. Cells were collected for RNA isolation and cDNA synthesis. p21 expression was examined by real‐time PCR. *P < 0.05 compared to nsRNA group. (c) BrdU incorporation was performed to determine the role of p21 siRNA in cell proliferation. nsRNA and p21 SiRNA transfection was performed in 96‐well plates. After 48 h of transfection, BrdU incorporation assay was performed. (d) The role of p21 in BIX‐01294‐induced inhibitory effect on foetal PASMC proliferation was also investigated by cell counting. Foetal PASMCs were grown in 12‐well dishes overnight. After 48 h of transfection with nsRNA and p21 SiRNA, PASMCs were treated with BIX‐01294 at 1 μg/ml concentration, for 1 day, and subjected to cell counting analysis. *P < 0.05 compared to nsRNA group without BIX‐01294 treatment. #P < 0.05 compared to nsRNA group without BIX‐01294 treatment. ##P < 0.05 compared to nsRNA group with BIX‐01294 treatment.

To determine whether p21 SiRNA was able to downregulate p21 expression, p21 SiRNA and nsRNA were transfected into foetal PASMCs. As shown in Fig. 2b, at concentration of 100 nm p21SiRNA, expression of p21 was reduced by 80% compared to nsRNA.

Next, we determined whether p21 was involved in BIX‐01294‐induced inhibitory effect on foetal PASMC proliferation. Foetal PASMCs were transfected with p21 SiRNA or nsRNA. After 48 h of transfection, the cells were treated with BIX‐01294 for 1 day. BrdU labelled solution (Millipore) was added to each well 16 h prior to analysis. As shown in Fig. 2c, BrdU incorporation assay revealed that p21 knockdown enhanced foetal PASMC proliferation (P < 0.05 compared to nsRNA group). Moreover, knockdown of p21 expression caused significant attenuation of BIX‐01294‐induced inhibitory effects on foetal PASMC proliferation, indicating that BIX‐01294 inhibited foetal FPASMC proliferation, at least in part, via p21. We confirmed this experiment by counting cell numbers. Foetal PASMCs were plated in 12‐well dishes. After 48h of transfection, the cells were treated with BIX‐01294 for 24 h, then were counted. As shown in Fig. 2d, p21 SiRNA significantly enhanced foetal PASMC proliferation compared to the nsRNA group. BIX‐01924 treatment resulted in marked reduction of cell numbers in nsRNA transfected cells compared to the nsRNA group without BIX‐01294 treatment. However, p21 SiRNA transfection attenuated BIX‐01294‐induced inhibitory effects on foetal PASMC proliferation compared to the nsRNA group with BIX‐01294 treatment.

Inhibition of G9a attenuated PDGF‐induced cell proliferation

As PDGF‐induced proliferation of vascular SMCs is a key event during pulmonary vascular remodelling, we examined effects of BIX‐01294 on PDGF‐induced cell proliferation. As shown in Fig 3a, PDGF promoted foetal PASMC proliferation in a dose‐dependent manner. At concentrations of 5, 10, 25 and 50 ng/ml of PDGF, BrdU incorporation was increased by ~20%, ~50%, ~120% and ~150% respectively. Next, we examined effects of BIX‐01294 on PDGF‐induced cell proliferation. As shown in Fig 3b, in the presence of BIX‐01294, BrdU incorporation was reduced in the region of 85% in foetal PASMCs treated with 25 or 50 ng/ml of PDGF (*P < 0.05 compared to PDGF treatment alone).

Figure 3.

Figure 3

Effect of G9a inhibition on PDGF ‐induced cell proliferation. (a) Foetal PASMCs were plated in 96‐well plates. They were then starved for 24 h in 0.1% serum‐containing medium. PDGF‐BB was added for 24 h at concentrations of 5, 10, 25, 50 ng/ml PDGF. BrdU labelled solution was added to each well, 18 h prior to analysis. *P < 0.05 compared to the untreated group. (b) Foetal PASMCs were plated in 96‐well plates and starved for 24 h in 0.1% serum‐containing medium. BIX‐01294 (1 μg/ml) was added 30 min prior to PDGF treatment and cells were grown for another 24 h. BrdU labelled solution was added to each well 18 h prior to analysis. *P < 0.05 compared to the PDGF group. (c) Expression of p21 was examined by Real‐time PCR. The foetal PASMCs were either treated or not treated with 1 μg/ml of BIX‐01294. After 30 minutes, PDGF, final concentration of 25 ng/ml, was added to the medium for 24 h. Real‐time PCR was performed to determine expression of p21 with or without BIX‐01294, in the presence of 25 ng/ml PDGF. *P < 0.05 compared to PDGF group. (d) The foetal PASMCs were seeded on 6‐well plates and cultured for 24 h. They were then starved for 24 h in 0.1% serum‐containing medium. BIX‐01294 was added 30 min prior to adding PDGF. Both morphological appearance and confluence were observed by microscope.

To address mechanisms underlying BIX‐01294‐induced inhibitory effect on proliferation, real‐time PCR analysis was performed to examine levels of p21, a potent CDK inhibitor. As shown in Fig. 3c, p21 expression was significantly increased in foetal PASMCs treated with combination of PDGF and BIX‐01294 compared to cells treated with PDGF (25 ng/ml) alone. Appearance and confluence of the foetal PASMCs after treatment with PDGF alone or in combination with BIX‐01294 are shown in Fig. 3d. Number of foetal PASMCs increased with 25 and 50 ng/ml of PDGF, however, confluence of foetal PASMCs was markedly reduced in the presence of BIX‐01294.

Inhibition of G9a attenuated PDGF‐induced cell migration

In addition to abundant cell proliferation, SMC migration is indicated in vascular remodelling. To determine whether BIX‐01294 exhibited inhibitory effects on PDGF‐induced foetal PASMC migration, the wound‐healing scratch assay was performed. As shown in Fig. 4a, there was slight migration of the foetal PASMCs in medium containing 0.1% serum at day 1, compared to day 0 time point. Increased migration of the cells treated with BIX‐01294 was not observed compared to the 0.1% serum group. PDGF at 25 ng/ml concentration caused marked increase in cell migration compared to those in 0.1% serum. However, BIX‐01294 treatment reduced cell migration induced by PDGF. Quantitative analysis indicated that PDGF at 25 ng/ml concentration increased foetal PASMC migration 2.3‐fold compared to that of 0.1% serum. BIX‐01294 treatment resulted in ∼70% reduction in cell migration stimulated by PDGF, as shown in Fig 4b (P < 0.05).

Figure 4.

Figure 4

Effect of G9a inhibition on PDGF ‐induced cell migration. Cell migration into ‘wound’ areas were examined by microscopy (a). Photomicrographs were taken at 0 and 1 day, and cell migration distance was determined by subtracting values obtained at 0 day from those obtained at 1 day. Migration distances were expressed as percentages over control values. BIX‐01294 was added to media 1 h prior to treatment of PASMCs with PDGF. Quantitative analysis of migration was performed (b). *P < 0.05 compared to 0.1% serum group; #P < 0.05 compared with PDGF group.

Effect of G9a inhibition on foetal PASMC‐mediated collagen gel contraction

The effect of BIX‐01294 on contractility of foetal FPASMCs was evaluated using a collagen gel contraction assay. Surface area of 48‐well dishes was defined as 100%. In the presence of 10% FBS, untreated foetal PASMCs had significant collagen gel contractility after 24 h in culture (Fig. 5a,b; *P < 0.01 compared with to cell free group). Contractility of foetal PASMCs was significantly attenuated by BIX‐01294 treatment (#P < 0.05 compared to untreated group).

Figure 5.

Figure 5

Effect of G9a inhibition on contractility of foetal PASMC s, as assessed by collagen gel contraction assay. Foetal FPASMCs were cultured in 3‐D collagen gels for 24 h in the presence of BIX‐01294 (5 μm). FPASMCs‐mediated collagen gel contraction was assessed by measuring the gel surface area using Image J software and (a) collagen gels were photographed. (b) contractility of collagen gel without foetal PASMCs was defined as 1. Relative contractility of BIX‐01294‐treated and untreated foetal PASMCs was calculated. *P < 0.05 compared to cell free sample; #P < 0.05 compared to untreated cells group. (c) Effect of G9a inhibition on expression of ROCK‐II proteins in foetal PASMCs was determined by Western blot analysis using antibody against ROCK‐II. (d) The effect of G9a inhibition on expression of calponin proteins was also examined by Western blot analysis, using antibody against calponin.

Effect of G9a inhibition on contraction‐related proteins in foetal PASMCs

To determine underlying mechanisms of action of BIX‐01294 on contractility of foetal PASMCs, expression of calponin and Rock‐II in foetal PASMCs was measured by Western blot analysis. As shown in Fig. 5c and d, levels of ROCKII and calponin proteins in BIX‐01294‐treated foetal PASMCs were markedly reduced in a dose‐dependent manner, compared to control groups.

Effect of G9a inhibition on global DNA methylation

To determine whether BIX‐01294 altered levels of global DNA methylation, LC/MS analysis was performed to determine percentage of cytosine methylation in vehicle‐treated and BIX‐01294‐treated foetal PASMCs. Using a standard curve average of 5‐methylcytosine (Fig. 6a), level of 5‐methylcytosine was found to increased significantly (P < 0.01), 1.7‐fold in BIX‐01294‐treated foetal PASMCs compared to controls (Fig. 6b), suggesting that G9a affected the pattern of DNA methylation in the cells.

Figure 6.

Figure 6

Effect of G9a inhibition on global DNA methylation level. (a) Stock solutions of 2′‐deoxycytidine (Sigma) and 5‐methyl‐2′‐deoxycytidine were prepared in water. An eight‐point stock mixture of a standard was carefully prepared to provide an exact known concentration ratio of 2′‐deoxycytidine and 5‐methyl‐2′‐deoxycytidine. (b) DNA methylation was determined by LC/MS. Genomic DNA was isolated from control and BIX‐01294‐treated foetal PASMCs. DNA was then subjected to digestion with nuclease P1, venom phosphodiesterase I and alkaline phosphatase respectively. Concentration of 2′‐deoxycytidine and 5‐methyl‐2′‐deoxycytidine in each sample was calculated from the standard curve. Each DNA sample was analysed in triplicate. *P < 0.05 compared with control group.

Discussion

Histone lysine methylation enzymes (HMTases) play an important role in organization of chromatin domains and regulation of gene expression 12, 13, 14. G9a is one HMTase that methylates lysine 9 (Lys 9) of histone H3. Methylation of histone 3, mediated by G9a, occurs at the ε amino group of lysine residues, a hallmark of silent chromatin, and is globally distributed throughout heterochromatic regions 15. BIX‐01294 has previously been identified as a small‐molecule inhibitor that is specific to euromatic G9a HMTase 16, 17. BIX‐01294 has been reported to be biologically active in reducing H3K9 me2 levels at several G9a target genes, therefore allowing transient reversal of this repressive marker in vivo. The repressive state of H3K9 with two methyl group modification has been detected at promoter regions of aberrantly silenced tumour suppressor genes in cancer, indicating a role for G9a in cancer cell proliferation and tumour progression. In this study, we have used BIX‐01294 as a specific G9a inhibitor to treat foetal PASMCs. This resulted in significant reduction in cell proliferation and migration, associated with increased expression of p21 (a potent CDK inhibitor), without significant change in other cell cycle‐related genes. Knockdown expression of p21 further suggested that BIX‐01294 inhibited foetal PASMC proliferation in part via p21.

BIX‐01294 also markedly reduced PDGF‐stimulated cell proliferation. The PDGF signalling pathway has been implicated in a broad range of diseases, such as vascular diseases, pulmonary hypertension, fibrosis and cancer 18, 19. Hypoxia enhances PDGF signalling in pulmonary vascular SMC by downregulation of protein tyrosine phosphatases 20. Thus, treatment with PDGF receptor antagonists offers the prospect of ‘reversal of remodeling’ 21. The molecular mechanisms underlying inhibition of PDGF‐induced cell proliferation by BIX‐01294 in this study remain largely unknown, but it is possible that the inhibitory effect was exerted either by changing the balance of CDK‐cyclins and CDK inhibitors, such as induction of p21, or deactivation of the PDGF‐induced signalling pathway. In this study, we compared p21 levels between PDGF‐treated and PDGF+ BIX‐01294‐treated foetal PASMCs; levels of p21 were much higher in PDGF+ BIX‐01294‐treated foetal PASMCs compared to PDGF treated alone (Fig. 3b). As p21 is a potent CDK inhibitor and here showed a functional role in BIX‐01294‐induced cell proliferation, it showed that BIX‐01294 attenuated PDGF‐induced cell proliferation, at least partially through the p21 pathway. Interestingly, hypoxic stress has been reported to induce levels of H3K9Me2 as well as G9a protein and enzyme activity 22. Kim et al. have reported that a ubiquitin‐like protein, containing PHD and RING finger domain1 (a multi‐domain protein associated with cell proliferation), is recruited and co‐operates with G9a to inhibit p21 promoter activity 6. It is possible that inhibition of G9a by BIX‐01294 reduced H3K9M2 levels, leading to recruitment of transcriptional factors or co‐activators to activate p21 promoter activity.

To address the mechanism of BIX‐01294 attenuating foetal PASMCs‐mediated gel contraction, we measured expression levels of calponin and ROCK‐II, which are known to regulate SMC contraction. We found that expression of calponin and ROCK‐II was downregulated, suggesting that BIX‐01294 attenuated foetal PASMCs gel contraction by inhibiting calponin and ROCK‐II expression; however, further in vivo studies are warranted to better understand the importance of this histone modifier in foetal PASMC proliferation.

Described here is the first demonstration of the relationship between inhibition of cell proliferation induced by BIX‐01294 and increase in global DNA methylation in foetal PASMCs. The association of global DNA methylation with cell proliferation has been previously reported in some types of cancers. During development of neoplasms, the degree of hypomethylation of genomic DNA increases as lesions progress from perhaps benign proliferation of cells to invasive cancer 23, 24. Reduction in DNA methylation is mainly due to hypomethylation of repetitive DNA sequences and demethylation of some coding regions and introns 25. Thus, the epigenetic modifier of histone lysine methyltransferase offers the prospect of ‘reverse chromatin remodeling’ and redistributes the methylation pattern in such a way as demethylation of some promoter regions, and increasing methylation in repetitive DNA sequences and other non‐coding regions. Our study demonstrates that an interplay between histone lysine modification and DNA methylation occurs in foetal PASMCs.

Taken together, our results demonstrate that G9a inhibitor, BIX‐01294, was capable of inhibiting foetal PASMC proliferation and migration, inducing cell cycle arrest in G1 phase. BIX‐01294 specifically upregulated p21 expression without marked induction of p53 and other cell cycle‐related genes. p21 protein was, at least in part, required for BIX‐01294‐induced inhibition of foetal PASMC proliferation. More importantly, BIX‐01294 strongly attenuated PDGF‐induced cell proliferation via increasing the level of p21 expression, attenuating PDGF‐induced cell migration and modulating levels of global DNA methylation. Epigenetic mechanisms of histone lysine methylation may have significant mechanistic and therapeutic implications in diseases such as pulmonary hypertension, and histone lysine methylation modifiers may be used as a new target for therapy of vascular disease.

Disclosures

No conflicts of interest, financial or otherwise, are declared by the author(s).

Acknowledgements

We gratefully acknowledge Dr. Lawrence Longo of Loma Linda University for providing ovine foetal lungs. We also thank Drs. Sekhar Reddy, Ramaswamy Ramchandran, Aarti Raghavan, Guofei Zhou, Tianji Chen, and Ms. Laura Bach, Qiyuan Zhou for helpful discussions and technical assistance. This study was supported in part by National Heart, Lung, and Blood Institute Grants HL‐059 435 and HL‐075 187 to J. U. Raj.

References

  • 1. Archer SL, Marsboom G, Kim GH, Zhang HJ, Toth PT, Svensson EC et al (2010) Epigenetic attenuation of mitochondrial superoxide dismutase 2 in pulmonary arterial hypertension: a basis for excessive cell proliferation and a new therapeutic target. Circulation 121, 2661–2671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Tachibana M, Sugimoto K, Nozaki M, Ueda J, Ohta T, Ohki M et al (2002) G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis. Genes Dev. 16, 1779–1791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Chen MW, Hua KT, Kao HJ, Chi CC, Wei LH, Johansson G et al (2010) H3K9 histone methyltransferase G9a promotes lung cancer invasion and metastasis by silencing the cell adhesion molecule Ep‐CAM. Cancer Res. 70, 7830–7840. [DOI] [PubMed] [Google Scholar]
  • 4. Waggoner SA, Johannes GJ, Liebhaber SA (2009) Depletion of the poly(C)‐binding proteins alphaCP1 and alphaCP2 from K562 cells leads to p53‐independent induction of cyclin‐dependent kinase inhibitor (CDKN1A) and G1 arrest. J. Biol. Chem. 284, 9039–9049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Lee EW, Lee MS, Camus S, Ghim J, Yang MR, Oh W et al (2009) Differential regulation of p53 and p21 by MKRN1 E3 ligase controls cell cycle arrest and apoptosis. EMBO J. 28, 2100–2113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kim JK, Esteve PO, Jacobsen SE, Pradhan S (2009) UHRF1 binds G9a and participates in p21 transcriptional regulation in mammalian cells. Nucleic Acids Res. 37, 493–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Golovina VA, Blaustein MP (2006) Preparation of primary cultured mesenteric artery smooth muscle cells for fluorescent imaging and physiological studies. Nat. Protoc. 1, 2681–2687. [DOI] [PubMed] [Google Scholar]
  • 8. Yang Q, Liu S, Tian Y, Salwen HR, Chlenski A, Weinstein J et al (2003) Methylation‐associated silencing of the thrombospondin‐1 gene in human neuroblastoma. Cancer Res. 63, 6299–6310. [PubMed] [Google Scholar]
  • 9. Yang Q, Tian Y, Ostler KR, Chlenski A, Guerrero LJ, Salwen HR et al (2010) Epigenetic alterations differ in phenotypically distinct human neuroblastoma cell lines. BMC Cancer 10, 286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Shentu TP, Titushkin I, Singh DK, Gooch KJ, Subbaiah PV, Cho M et al (2010) oxLDL‐induced decrease in lipid order of membrane domains is inversely correlated with endothelial stiffness and network formation. Am. J. Physiol. Cell Physiol. 299, C218–C229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Shah MY, Vasanthakumar A, Barnes NY, Figueroa ME, Kamp A, Hendrick C et al (2010) DNMT3B7, a truncated DNMT3B isoform expressed in human tumors, disrupts embryonic development and accelerates lymphomagenesis. Cancer Res. 70, 5840–5850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Albert M, Helin K (2010) Histone methyltransferases in cancer. Semin. Cell Dev. Biol. 21, 209–220. [DOI] [PubMed] [Google Scholar]
  • 13. Berger SL (2002) Histone modifications in transcriptional regulation. Curr. Opin. Genet. Dev. 12, 142–148. [DOI] [PubMed] [Google Scholar]
  • 14. Shi Y. (2007) Histone lysine demethylases: emerging roles in development, physiology and disease. Nat. Rev. Genet. 8, 829–833. [DOI] [PubMed] [Google Scholar]
  • 15. Shinkai Y, Tachibana M (2011) H3K9 methyltransferase G9a and the related molecule GLP. Genes Dev. 25, 781–788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kubicek S, O'Sullivan RJ, August EM, Hickey ER, Zhang Q, Teodoro ML et al (2007) Reversal of H3K9me2 by a small‐molecule inhibitor for the G9a histone methyltransferase. Mol. Cell 25, 473–481. [DOI] [PubMed] [Google Scholar]
  • 17. Shi Y, Do JT, Desponts C, Hahm HS, Scholer HR, Ding S (2008) A combined chemical and genetic approach for the generation of induced pluripotent stem cells. Cell Stem Cell 2, 525–528. [DOI] [PubMed] [Google Scholar]
  • 18. Andrae J, Gallini R, Betsholtz C (2008) Role of platelet‐derived growth factors in physiology and medicine. Genes Dev. 22, 1276–1312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Pietras K, Sjoblom T, Rubin K, Heldin CH, Ostman A (2003) PDGF receptors as cancer drug targets. Cancer Cell 3, 439–443. [DOI] [PubMed] [Google Scholar]
  • 20. ten Freyhaus H, Dagnell M, Leuchs M, Vantler M, Berghausen EM, Caglayan E et al (2011) Hypoxia enhances platelet‐derived growth factor signaling in the pulmonary vasculature by down‐regulation of protein tyrosine phosphatases. Am. J. Respir. Crit. Care Med. 183, 1092–1102. [DOI] [PubMed] [Google Scholar]
  • 21. Sakao S, Tatsumi K, Voelkel NF (2010) Reversible or irreversible remodeling in pulmonary arterial hypertension. Am. J. Respir. Cell Mol. Biol. 43, 629–634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chen H, Yan Y, Davidson TL, Shinkai Y, Costa M (2006) Hypoxic stress induces dimethylated histone H3 lysine 9 through histone methyltransferase G9a in mammalian cells. Cancer Res. 66, 9009–9016. [DOI] [PubMed] [Google Scholar]
  • 23. Frigola J, Sole X, Paz MF, Moreno V, Esteller M, Capella G et al (2005) Differential DNA hypermethylation and hypomethylation signatures in colorectal cancer. Hum. Mol. Genet. 14, 319–326. [DOI] [PubMed] [Google Scholar]
  • 24. Esteller M (2008) Epigenetics in cancer. N Engl. J. Med. 358, 1148–1159. [DOI] [PubMed] [Google Scholar]
  • 25. Reik W (2007) Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 447, 425–432. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES