Skip to main content
Neurology logoLink to Neurology
. 2013 Apr 23;80(17):1606–1610. doi: 10.1212/WNL.0b013e31828f180e

The p.L302P mutation in the lysosomal enzyme gene SMPD1 is a risk factor for Parkinson disease

Ziv Gan-Or 1, Laurie J Ozelius 1, Anat Bar-Shira 1, Rachel Saunders-Pullman 1, Anat Mirelman 1, Ruth Kornreich 1, Mali Gana-Weisz 1, Deborah Raymond 1, Liron Rozenkrantz 1, Andres Deik 1, Tanya Gurevich 1, Susan J Gross 1, Nicole Schreiber-Agus 1, Nir Giladi 1, Susan B Bressman 1, Avi Orr-Urtreger 1,✉
PMCID: PMC3662322  PMID: 23535491

Abstract

Objective:

To study the possible association of founder mutations in the lysosomal storage disorder genes HEXA, SMPD1, and MCOLN1 (causing Tay-Sachs, Niemann-Pick A, and mucolipidosis type IV diseases, respectively) with Parkinson disease (PD).

Methods:

Two PD patient cohorts of Ashkenazi Jewish (AJ) ancestry, that included a total of 938 patients, were studied: a cohort of 654 patients from Tel Aviv, and a replication cohort of 284 patients from New York. Eight AJ founder mutations in the HEXA, SMPD1, and MCOLN1 genes were analyzed. The frequencies of these mutations were compared to AJ control groups that included large published groups undergoing prenatal screening and 282 individuals matched for age and sex.

Results:

Mutation frequencies were similar in the 2 groups of patients with PD. The SMPD1 p.L302P was strongly associated with a highly increased risk for PD (odds ratio 9.4, 95% confidence interval 3.9–22.8, p < 0.0001), as 9/938 patients with PD were carriers of this mutation compared to only 11/10,709 controls.

Conclusions:

The SMPD1 p.L302P mutation is a novel risk factor for PD. Although it is rare on a population level, the identification of this mutation as a strong risk factor for PD may further elucidate PD pathogenesis and the role of lysosomal pathways in disease development.


Gaucher disease is the most common lysosomal storage disease in the Ashkenazi Jewish (AJ) population.1 It is an autosomal recessive disorder caused by mutations in the GBA gene that encodes the lysosomal enzyme glucocerebrosidase (GCase). Founder mutations in GBA can be detected in 1 out of 16 Ashkenazi Jews, and were shown to be important risk factors for Parkinson disease (PD) in this population2,3 and in many other populations worldwide.4–18

Three other lysosomal storage diseases that are caused by founder mutations can be found in the AJ population: Tay-Sachs disease19 (carrier frequency of 1:2720), Niemann-Pick disease type A21 (1:11520), and mucolipidosis type IV22 (1:8920). These 3 autosomal recessive diseases are caused by mutations in genes encoding lysosomal enzymes,23 and their deficiency results in cellular accumulation of the enzymes' substrates.

In recent years, studies not related to GBA suggest that lysosomal dysfunction is an important mechanism involved in PD pathogenesis.24 Genetic causes of PD including α-synuclein, LRRK2, Parkin, PINK1, DJ1, and ATP13A2 encode proteins that reside in the lysosome or function in lysosomal-related pathways, such as autophagy and mitophagy.25–32

We hypothesized that carriers of lysosomal storage diseases causing mutations may be at higher risk for PD. Eight founder mutations in the HEXA, SMPD1, and MCOLN1 genes are common in Ashkenazi Jews, making this an ideal population for testing this hypothesis. Herein, we report for the first time on the association of these mutations in a cohort of 938 AJ patients with PD and in thousands of AJ controls from both Israel and the United States.

METHODS

Population.

The patient population included 654 consecutively recruited patients with PD (2005–2009) from Tel Aviv Sourasky Medical Center in Israel and 284 patients (1999–2010) from Beth Israel Medical Center in New York, New York, which served as a replication set (table e-1 on the Neurology® Web site at www.neurology.org). Patients with PD from Tel Aviv and New York were diagnosed by a movement disorders specialist according to UK Parkinson's Disease Society Brain Bank criteria,33 and underwent a detailed interview to ascertain ancestry, family history of PD and other movement disorders, presenting symptoms, and age at onset of motor symptoms. AJ ancestry was determined by self-report, and only patients reporting 2 AJ parents were included in Tel Aviv, while in New York all but 3 patients had 2 AJ parents. Familial PD was defined as having at least one first- or second-degree relative with a diagnosis of PD.

Two groups of controls were analyzed: 1) a group of 282 AJ elderly individuals matched by age and sex to the group of patients with PD from Tel Aviv (age 67.7 ± 10.2, 64.9% men); and 2) large groups of young AJ individuals who underwent routine genetic screening tests for the mutations analyzed here, which were previously published,20 and detailed in table 1.

Table 1.

Frequency of 8 founder Ashkenazi mutations in the HEXA, SMPD1, and MCOLN1 genes among patients with PD and controlsa

graphic file with name WNL204954T1.jpg

Standard protocol approvals, registrations, and patient consents.

All patients and controls signed an informed consent before entering the study. The institutional review board (Tel Aviv, New York) and Helsinki Committee (Tel Aviv) approved the study protocols and the informed consents.

Mutation detection.

Eight mutations in 3 genes, HEXA (c.1274_1277dupTATC, c.1421+1 G>C, and p.G269S), SMPD1 (p.L302P, p.R496L, and c.996delC), and MCOLN1 (c.406-2A>G and g.511_6943del), were analyzed. In Tel Aviv, 6 mutations were genotyped using Taqman assay in StepOnePlus RT-PCR system (Applied Biosystems, Foster City, CA; table e-2). The SMPD1 c.996delC mutation was genotyped using the forward primer 5′–ACACCTGTCAATAGCTTCCCTGGCCC and the reverse primer 5′–TTCGGCAGGCAGCCAGGGCTC, followed by NlaIV restriction enzyme analysis. The MCOLN1 g.511_6943del mutation was identified by using a 3-primer reaction. The forward primer 5′ CTGATATAAATGGCAGGCAGCTTTC was designed to target the point of deletion. The second forward primer was 5′ TGGTCAATGTCACCATCCAC, and the reverse primer was 5′ CTCACCGTGCTGGAAGACAC. All detected mutation carriers were genotyped again to validate the presence of a mutation, using a second method. The primers and methods used are detailed in table e-3. Mutation detection in the AJ patients with PD from New York, the confirmation cohort, was done using Tag-It Mutation Detection Kits (Luminex Corporation, Austin, TX) as previously described.20

Statistical analysis.

Data are presented in the text as mean (± SD) for continuous variables. Clinical and demographic categorical variables are presented in percentages whereas allele frequency is presented as a range of 0–1. Any differences among groups in continuous variables were tested using analysis of variance (ANOVA), and χ2 or Fisher exact test was used for comparison of categorical variables. When comparing groups with small numbers of individuals, the nonparametric Kruskal-Wallis ANOVA was used. Goodness-of-fit test with 1 degree of freedom was applied to look for any deviation from the Hardy-Weinberg equilibrium among the young controls and among patients with PD who were screened for HEXA, SMPD1, and MCOLN1 mutations. When comparing to the groups of young controls, an online calculator was used to determine the odds ratio (OR) and confidence interval (CI) (DJR Hutchon Calculator). SPSS software v. 17 (SPSS Inc., Chicago, IL) was used for all other data analysis.

RESULTS

The SMPD1 p.L302P mutation is strongly associated with PD.

Table 1 details the frequencies of the 8 Ashkenazi founder mutations in the HEXA, SMPD1, and MCOLN1 genes in patients with PD and controls. Bonferroni correction for multiple comparisons set the cutoff p value to 0.0063. The frequencies of all 8 mutations were similar in both PD patient populations from Tel Aviv and New York. There were no statistically significant differences in mutation frequencies between the elderly and young control groups, allowing us to compare the PD patient population to the young control groups, which represent an average-risk population. This approach was previously applied for the analysis of GBA mutations.3 The combined analysis demonstrated that the frequency of the 3 SMPD1 mutations that cause Niemann-Pick type A was significantly higher in patients with PD compared to young controls (1.9% vs 0.9%, p = 0.002, Fisher test). However, the analysis of each mutation separately demonstrated that only the SMPD1 p.L302P mutation was significantly more frequent in patients with PD (1.1% vs 0.1%, p < 0.0001 in Tel Aviv, 0.7% vs 0.1%, p = 0.04 in the replication analysis, and 1.0% vs 0.1%, p < 0.0001 in the combined analysis, Fisher or χ2 with Yates correction test). The OR to develop PD among carriers of this mutation was 9.4 (95% CI 3.9–22.8). The frequencies of the other mutations did not differ significantly between patients with PD and controls.

The effect of harboring one of the founder mutations in the HEXA, SMPD1, and MCOLN1 genes on age at motor symptoms onset (AAO) was examined among patients with PD from Tel Aviv Sourasky Medical Center. The AAO was calculated for each gene and for each mutation and was compared to noncarriers of the same mutation using the Kruskal-Wallis nonparametric ANOVA, since the number of mutation carriers was too small to assume normal distribution of AAO. In addition, since carriers of the LRRK2 p.G2019S mutation and carriers of Ashkenazi founder GBA mutations have an earlier AAO of PD,34 and their inclusion in this analysis may bias the results, the comparison was done twice, before and after excluding these carriers from the analysis. No statistically significant differences were found. Table e-4 details the AAO of different mutation carriers after the exclusion of carriers of LRRK2 and GBA mutations (data including these patients are not shown). Carriers of the SMPD1 p.L302P mutation (n = 7) had an average AAO of 56.4 ± 16.2, more than 4 years younger than noncarriers, but due to the small number of patients with this mutation this difference was not statistically significant.

DISCUSSION

The results presented here suggest that carrying the SMPD1 p.L302P founder mutation is associated with PD in the AJ population, increasing the risk for developing PD by about ninefold. By studying this genetically homogeneous population, we demonstrated that statistically significant results could be obtained even for a rare mutation such as the SMPD1 p.L302P, with a carrier frequency of about 1:1,000. Our results further illustrated the importance of the AJ population for genetic studies of PD and other diseases. Since the carrier frequency of SMPD1 p.L302P is probably similar or lower in other populations,20 it is currently not possible to estimate the role of SMPD1 mutations in PD pathogenesis worldwide. Nevertheless, this specific finding is of importance for further understanding the mechanisms underlying PD pathogenesis.

SMPD1 encodes sphingomyelin phosphodiesterase 1 (acid-sphingomyelinase, SMase), a lysosomal enzyme that cleaves the phosphocholine head group of sphingomyelin to generate ceramide. The p.L302P amino acid change is a severe mutation that, when inherited from both parents, causes a fatal infantile type A Niemann-Pick disease. The residual activity of p.L302P mutated SMase is dramatically reduced,35 resulting in substrate accumulation and loss of cellular function in the CNS and other organs.36 Our results therefore strengthen accumulating data that emphasize the potential role of the lysosome in PD pathogenesis and the involvement of key PD-causing genes in lysosomal pathways. The lysosome is the main cellular organelle responsible for the degradation of α-synuclein,26 the major protein aggregate in Lewy bodies, which is the pathologic hallmark of PD.24

Is it possible that both GBA- and SMPD1-encoded lysosomal enzymes, GCase and SMase, are involved in PD pathogenesis in a similar manner? Interestingly, both share a common feature: the end product of their enzymatic cleavage is ceramide. It was previously hypothesized37 that a defect in the ceramide metabolism pathway may be involved in PD pathogenesis, perhaps by altering the properties and function of the lysosome, which may result in α-synuclein accumulation and Lewy body formation. This hypothesis was supported by the fact that the PANK2 and PLA2G6 genes that are involved in ceramide metabolism cause neurodegenerative diseases (neurodegeneration with brain iron accumulation type 1 and 2, respectively), in which Lewy bodies also accumulate.37

One question that arises from our study originated from the isolated association of SMPD1 p.L302P mutation, while the 2 other SMPD1 mutations were not associated with PD. These findings raise the possibility that the p.L302P mutation might be in linkage disequilibrium with another alteration that increases the risk for PD. It is therefore important to note that in the original description of the p.L302P founder mutation in AJ patients, sequencing of the entire SMPD1 cDNA was performed, and did not identify any additional mutations in this gene.35 These data rule out the possibility of linkage disequilibrium between p.L302P and other pathogenic SMPD1 coding mutations, but cannot exclude the possibility of a noncoding mutation in this gene or a distant mutation in another gene. However, none of the genes that reside in the 3 Mb region around this mutation is known to be associated with PD. Furthermore, the replication of p.L302P association with PD in 2 independent cohorts in our study demonstrates the importance of this mutation either as causative or as a marker for increased PD risk. Another explanation to consider is the possibility that the p.L302P mutation results in a toxic gain-of-function effect, as suggested for some of the GBA mutations associated with PD.38 Of interest, although not statistically significant, the c.996delC mutation was also more frequent in patients with PD as compared to young controls (1.96-fold, 5/938 vs 29/10,709), suggesting that studies of SMPD1 mutations in other populations are warranted to further determine the role of this gene in PD.

Supplementary Material

Data Supplement
Accompanying Editorial

ACKNOWLEDGMENT

The authors thank the study subjects for their participation; Yaritza Rodriguez, Mount Sinai School of Medicine, for technical assistance; and Vicki Shanker, Mark Groves, Christina Palmese, Naomi Lubarr, Jeannie Soto-Valencia, Akhila Iyer, Jose Cabassa, and Ann Hunt for recruiting and evaluating Beth Israel Medical Center subjects.

GLOSSARY

AJ

Ashkenazi Jewish

ANOVA

analysis of variance

CI

confidence interval

GCase

glucocerebrosidase

OR

odds ratio

PD

Parkinson disease

SMase

sphingomyelin phosphodiesterase

Footnotes

Editorial, page 1544

Supplemental data at www.neurology.org

AUTHOR CONTRIBUTIONS

Dr. Gan-Or: design and conceptualization of the study, study coordination, acquisition of data, analysis and interpretation of the data, statistical analysis, drafting the manuscript, and revising the manuscript for intellectual content. Dr. Ozelius: design and conceptualization of the study, study coordination, acquisition of data, analysis and interpretation of the data, statistical analysis, supervision of the study, obtaining funding. and revising the manuscript for intellectual content. Dr. Bar-Shira: study coordination, acquisition of the data, analysis and interpretation of the data, and revising the manuscript for intellectual content. Dr. Saunders-Pullman: study coordination, acquisition of data, obtaining funding, and revising the manuscript for intellectual content. Dr. Mirelman: acquisition of data and revising the manuscript for intellectual content. Dr. Kornreich: acquisition of data, obtaining funding, and revising the manuscript for intellectual content. Dr. Gana-Weisz: acquisition of data and revising the manuscript for intellectual content. Ms. Raymond: acquisition of data and revising the manuscript for intellectual content. Ms. Rozenkrantz: acquisition of data and revising the manuscript for intellectual content. Dr. Deik: acquisition of data and revising the manuscript for intellectual content. Dr. Gurevich: acquisition of data and revising the manuscript for intellectual content. Dr. Gross: acquisition of data and revising the manuscript for intellectual content. Dr. Schreiber-Agus: acquisition of data and revising the manuscript for intellectual content. Dr. Giladi: design and conceptualization of the study, study coordination, acquisition of data, obtaining funding, and revising the manuscript for intellectual content. Dr. Bressman: study coordination, acquisition of data, supervision of the study, obtaining funding, and revising the manuscript for intellectual content. Dr. Orr-Urtreger: design and conceptualization of the study, study coordination, acquisition of data, analysis and interpretation of the data, drafting the manuscript, supervision of the study, obtaining funding, and revising the manuscript for intellectual content.

STUDY FUNDING

Supported by the Tel Aviv Sourasky Medical Center Grant of Excellence, Kahn Foundation, Chief Scientist Israel Ministry of Health (grant no. 3-4893), Legacy Heritage Biomedical Science Partnership Program of the Israel Science Foundation (grant no.1922/08), Empire State Clinical Research Training Program, Marcled Foundation, Edwin and Caroline Levy, Joseph and Carol Reich, and NIH-NINDS NS073836. Luminex Corporation, Austin, TX, donated the kits to perform the studies at MSSM.

DISCLOSURE

Z. Gan-Or reports no disclosures. L. Ozelius serves on scientific advisory boards for the Benign Essential Blepharospasm Research Foundation, the National Spasmodic Dysphonia Association, and the Tourette Syndrome Association Inc.; is listed as an author on patents re: Torsin, Torsin genes and methods of use, and Nucleic acids, methods and kits for the diagnosis of DYT6 primary torsion dystonia; receives research support from the NIH and the Bachmann Strauss Dystonia & Parkinson Foundation; and receives royalties from Athena Diagnostics, Inc. for a patent re: Torsin, Torsin genes and methods of use. A. Bar-Shira reports no disclosures. R. Saunders-Pullman serves on the Scientific Advisory Board of the Dystonia Medical Research Foundation; has received research support from NIH/NINDS (K23NS047256 and K02NS073836), the Michael J. Fox Foundation for Parkinson's Research, the Thomas Hartman Foundation for Parkinson's Research, the Bachmann-Strauss Dystonia & Parkinson Foundation, and the Marcled Foundation. A. Mirelman, R. Kornreich, and M. Gana-Weisz report no disclosures. D. Raymond receives research support from the Michael J. Fox Foundation for Parkinson's Research, the Thomas Hartman Foundation for Parkinson's Research, Inc., and the Marcled Foundation. L. Rozenkrantz and A. Deik report no disclosures. T. Gurevich receives research support from the Michael J. Fox Foundation for Parkinson's Research and from National Parkinson Foundation. S. Gross receives research grant support from PerkinElmer Inc. and the NIH and is listed as an inventor on a patent for a potential marker for fetal aneuploidy for which she has received no royalties. N. Schreiber-Agus reports no disclosures. N. Giladi provided consultancy to Teva-Lundbeck, IntecPharma, Neuroderm, and UCB, and receives research support from Michael J. Fox Foundation, National Parkinson Foundation, Israel Science Foundation, and FP7 European Commission. S. Bressman serves on scientific advisory boards for the Bachmann Strauss Dystonia & Parkinson Foundation, the Michael J. Fox Foundation for Parkinson's Research, and the Dystonia Medical Research Foundation; is listed as an author on a patent re: Methods and kits for the diagnosis of DYT6 primary torsion dystonia; and receives research support from the NIH and Michael J. Fox Foundation for Parkinson's Research. A. Orr-Urtreger receives research support from Tel Aviv Sourasky Medical Center, Kahn Foundation, Chief Scientist Israel Ministry of Health, Legacy Heritage Biomedical Science Partnership Program of the Israel Science Foundation, and Michael J. Fox Foundation for Parkinson's Research. Go to Neurology.org for full disclosures.

REFERENCES

  • 1.Rosner G, Rosner S, Orr-Urtreger A. Genetic testing in Israel: an overview. Annu Rev Genomics Hum Genet 2009;10:175–192 [DOI] [PubMed] [Google Scholar]
  • 2.Aharon-Peretz J, Rosenbaum H, Gershoni-Baruch R. Mutations in the glucocerebrosidase gene and Parkinson's disease in Ashkenazi Jews. N Engl J Med 2004;351:1972–1977 [DOI] [PubMed] [Google Scholar]
  • 3.Gan-Or Z, Giladi N, Rozovski U, et al. Genotype-phenotype correlations between GBA mutations and Parkinson disease risk and onset. Neurology 2008;70:2277–2283 [DOI] [PubMed] [Google Scholar]
  • 4.Emelyanov A, Boukina T, Yakimovskii A, et al. Glucocerebrosidase gene mutations are associated with Parkinson's disease in Russia. Mov Disord 2012;27:158–159 [DOI] [PubMed] [Google Scholar]
  • 5.Hu FY, Xi J, Guo J, et al. Association of the glucocerebrosidase N370S allele with Parkinson's disease in two separate Chinese Han populations of mainland China. Eur J Neurol 2010;17:1476–1478 [DOI] [PubMed] [Google Scholar]
  • 6.Kalinderi K, Bostantjopoulou S, Paisan-Ruiz C, Katsarou Z, Hardy J, Fidani L. Complete screening for glucocerebrosidase mutations in Parkinson disease patients from Greece. Neurosci Lett 2009;452:87–89 [DOI] [PubMed] [Google Scholar]
  • 7.Lesage S, Condroyer C, Hecham N, et al. Mutations in the glucocerebrosidase gene confer a risk for Parkinson disease in North Africa. Neurology 2011;76:301–303 [DOI] [PubMed] [Google Scholar]
  • 8.Mao XY, Burgunder JM, Zhang ZJ, et al. Association between GBA L444P mutation and sporadic Parkinson's disease from Mainland China. Neurosci Lett 2010;469:256–259 [DOI] [PubMed] [Google Scholar]
  • 9.Moraitou M, Hadjigeorgiou G, Monopolis I, et al. beta-Glucocerebrosidase gene mutations in two cohorts of Greek patients with sporadic Parkinson's disease. Mol Genet Metab 2011;104:149–152 [DOI] [PubMed] [Google Scholar]
  • 10.Neumann J, Bras J, Deas E, et al. Glucocerebrosidase mutations in clinical and pathologically proven Parkinson's disease. Brain 2009;132:1783–1794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nichols WC, Pankratz N, Marek DK, et al. Mutations in GBA are associated with familial Parkinson disease susceptibility and age at onset. Neurology 2009;72:310–316 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sidransky E, Nalls MA, Aasly JO, et al. Multicenter analysis of glucocerebrosidase mutations in Parkinson's disease. N Engl J Med 2009;361:1651–1661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Socal MP, Bock H, Michelin-Tirelli K, et al. Parkinson's disease and the heterozygous state for glucocerebrosidase mutations among Brazilians. Parkinsonism Relat Disord 2009;15:76–78 [DOI] [PubMed] [Google Scholar]
  • 14.Spitz M, Rozenberg R, Pereira Lda V, Reis Barbosa E. Association between Parkinson's disease and glucocerebrosidase mutations in Brazil. Parkinsonism Relat Disord 2008;14:58–62 [DOI] [PubMed] [Google Scholar]
  • 15.Sun QY, Guo JF, Wang L, et al. Glucocerebrosidase gene L444P mutation is a risk factor for Parkinson's disease in Chinese population. Mov Disord 2010;25:1005–1011 [DOI] [PubMed] [Google Scholar]
  • 16.Tan EK, Tong J, Fook-Chong S, et al. Glucocerebrosidase mutations and risk of Parkinson disease in Chinese patients. Arch Neurol 2007;64:1056–1058 [DOI] [PubMed] [Google Scholar]
  • 17.Wu YR, Chen CM, Chao CY, et al. Glucocerebrosidase gene mutation is a risk factor for early onset of Parkinson disease among Taiwanese. J Neurol Neurosurg Psychiatry 2007;78:977–979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ziegler SG, Eblan MJ, Gutti U, et al. Glucocerebrosidase mutations in Chinese subjects from Taiwan with sporadic Parkinson disease. Mol Genet Metab 2007;91:195–200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Myerowitz R. Tay-Sachs disease-causing mutations and neutral polymorphisms in the Hex A gene. Hum Mutat 1997;9:195–208 [DOI] [PubMed] [Google Scholar]
  • 20.Scott SA, Edelmann L, Liu L, Luo M, Desnick RJ, Kornreich R. Experience with carrier screening and prenatal diagnosis for 16 Ashkenazi Jewish genetic diseases. Hum Mutat 2010;31:1240–1250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Schuchman EH. The pathogenesis and treatment of acid sphingomyelinase-deficient Niemann-Pick disease. J Inherit Metab Dis 2007;30:654–663 [DOI] [PubMed] [Google Scholar]
  • 22.Bach G. Mucolipidosis type IV. Mol Genet Metab 2001;73:197–203 [DOI] [PubMed] [Google Scholar]
  • 23.Charrow J. Ashkenazi Jewish genetic disorders. Fam Cancer 2004;3:201–206 [DOI] [PubMed] [Google Scholar]
  • 24.Corti O, Lesage S, Brice A. What genetics tells us about the causes and mechanisms of Parkinson's disease. Physiol Rev 2011;91:1161–1218 [DOI] [PubMed] [Google Scholar]
  • 25.Lees AJ, Hardy J, Revesz T. Parkinson's disease. Lancet 2009;373:2055–2066 [DOI] [PubMed] [Google Scholar]
  • 26.Xilouri M, Vogiatzi T, Vekrellis K, Stefanis L. alpha-synuclein degradation by autophagic pathways: a potential key to Parkinson's disease pathogenesis. Autophagy 2008;4:917–919 [DOI] [PubMed] [Google Scholar]
  • 27.Schneider L, Zhang J. Lysosomal function in macromolecular homeostasis and bioenergetics in Parkinson's disease. Mol Neurodegener 2010;5:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Geisler S, Holmstrom KM, Treis A, et al. The PINK1/Parkin-mediated mitophagy is compromised by PD-associated mutations. Autophagy 2010;6:871–878 [DOI] [PubMed] [Google Scholar]
  • 29.Thomas KJ, McCoy MK, Blackinton J, et al. DJ-1 acts in parallel to the PINK1/parkin pathway to control mitochondrial function and autophagy. Hum Mol Genet 2011;20:40–50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ferree A, Guillily M, Li H, et al. Regulation of physiologic actions of LRRK2: focus on autophagy. Neurodegener Dis 2012;10:238–241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gomez-Suaga P, Luzon-Toro B, Churamani D, et al. Leucine-rich repeat kinase 2 regulates autophagy through a calcium-dependent pathway involving NAADP. Hum Mol Genet 2012;21:511–525 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ramirez A, Heimbach A, Grundemann J, et al. Hereditary parkinsonism with dementia is caused by mutations in ATP13A2, encoding a lysosomal type 5 P-type ATPase. Nat Genet 2006;38:1184–1191 [DOI] [PubMed] [Google Scholar]
  • 33.Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico-pathological study of 100 cases. J Neurol Neurosurg Psychiatry 1992;55:181–184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gan-Or Z, Bar-Shira A, Mirelman A, et al. LRRK2 and GBA mutations differentially affect the initial presentation of Parkinson disease. Neurogenetics 2010;11:121–125 [DOI] [PubMed] [Google Scholar]
  • 35.Levran O, Desnick RJ, Schuchman EH. Identification and expression of a common missense mutation (L302P) in the acid sphingomyelinase gene of Ashkenazi Jewish type A Niemann-Pick disease patients. Blood 1992;80:2081–2087 [PubMed] [Google Scholar]
  • 36.Dodge JC, Clarke J, Song A, et al. Gene transfer of human acid sphingomyelinase corrects neuropathology and motor deficits in a mouse model of Niemann-Pick type A disease. Proc Natl Acad Sci USA 2005;102:17822–17827 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bras J, Singleton A, Cookson MR, Hardy J. Emerging pathways in genetic Parkinson's disease: potential role of ceramide metabolism in Lewy body disease. Febs J 2008;275:5767–5773 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sardi SP, Clarke J, Kinnecom C, et al. CNS expression of glucocerebrosidase corrects alpha-synuclein pathology and memory in a mouse model of Gaucher-related synucleinopathy. Proc Natl Acad Sci USA 2011;108:12101–12106 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Supplement
Accompanying Editorial

Articles from Neurology are provided here courtesy of American Academy of Neurology

RESOURCES