Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2013 Apr;51(4):1269–1271. doi: 10.1128/JCM.03062-12

Rapid and Simultaneous Detection of Genes Encoding Klebsiella pneumoniae Carbapenemase (blaKPC) and New Delhi Metallo-β-Lactamase (blaNDM) in Gram-Negative Bacilli

Scott A Cunningham a, Tabassum Noorie b, Daniele Meunier b, Neil Woodford b, Robin Patel a,c,
PMCID: PMC3666784  PMID: 23345290

Abstract

We present a duplex, real-time PCR assay for detection of Klebsiella pneumoniae carbapenemase (blaKPC) and New Delhi metallo-β-lactamase (blaNDM) genes. Accuracy was assessed with 158 Gram-negative bacillary isolates, including 134 carbapenemase producers. The assay had 100% sensitivity and specificity compared with reference methods and a turnaround time of 90 min.

TEXT

Acquired carbapenem nonsusceptibility associated with carbapenemase production in Gram-negative bacilli is increasing, compromising treatment and raising concerns about nosocomial transmission (1, 2). Several genes encode carbapenemases, including serine carbapenemases blaKPC and blaOXA-48 and metallo-β-lactamases blaIMP, blaVIM, and blaNDM (3). In the United States, Klebsiella pneumoniae carbapenemase (KPC) is most common, followed by New Delhi metallo-β-lactamase (NDM). Plasmids carrying these genes have a range of host organisms and are spread efficiently (4, 5).

Carbapenemase detection using the modified Hodge test is neither sensitive nor specific and is subjective and requires follow-up molecular methods to characterize the underlying mechanism in positive isolates (612). Molecular methods can detect and characterize carbapenemases, including KPC- and NDM-mediated resistance (9). Confirmation of the PCR product by sequencing or target-specific probes in real-time assays has been described (1321), as have microarray and loop-mediated isothermal amplification (LAMP) detection (2225).

Here we describe a LightCycler (Roche Molecular Diagnostics, Indianapolis, IN) duplex real-time PCR assay employing fluorescence resonance energy transfer (FRET) hybridization probe-based detection of blaKPC and blaNDM which, when coupled with simple pre-PCR colony lysis, yields a “colony-to-result” time of 90 min, faster than any previously described assay. We validated our assay using a large number of carbapenemase-producing isolates, including Enterobacteriaceae and non-Enterobacteriaceae.

(This work was presented in part at the joint 48th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy [ICAAC]-46th Annual Meeting of the Infectious Diseases Society of America [IDSA], Washington, DC, 2008.)

Primers targeting blaKPC (GenBank accession no. AF297554.1) and blaNDM (GenBank accession no. FN396876.1) with exact sequence matches to all known genotypes of KPC (1 to 14) and NDM (1 to 7) were designed using LightCycler probe design software, version 2.0 (Roche Applied Science, Indianapolis, IN) (primers and probes are shown in Table 1). K. pneumoniae BAA-1705 (ATCC, Manassas, VA), containing blaKPC, and K. pneumoniae NCTC 13443 (Health Protection Agency [HPA], London, United Kingdom), containing blaNDM-1, were used as controls.

Table 1.

Primers and probes used in this studya

Primer or probe Sequence
Primer
    KPC160F 5′ ATTGGCTAAAGGGAAACACGACC 3′
    KPC160R 5′ GTAGACGGCCAACACAAT 3′
    NDM1F 5′ ATTAGCCGCTGCATTGAT 3′
    NDM1R 5′ GGCATGTCGAGATAGGAAGT 3′
Probe
    KPC160fl 5′ GAACCGCGGAGTGTATGGCACGG FITC 3′
    KPC160iLC610 5′ AAATGACTATGCCGTCGTCTGGCCCACT Red610 3′
    NDMfl 5′ CAACGGTTTGGCGATCTGGT FITC 3′
    NDMiLC670 5′ Red670 TCCGCCAGCTCGCACCG TPO4 3′
a

blaKPC and blaNDM-1 10× primer-probe set (number 1716; TIB MolBiol, Adelphia, NJ).

Each 15-μl master mix aliquot contained the following components: 9 μl molecular-grade water, 1.6 μl 10× DNA Master HybProbe mix (containing Taq DNA polymerase, reaction buffer, deoxyribonucleoside triphosphates with deoxyuridine triphosphate [dUTP] substituted for deoxyribosylthymine triphosphate [dTTP], and 1 mM MgCl2) (Roche Applied Science), 2.4-μl volume of 25 μM MgCl2 (supplemental), and 2.0 μl 10× primer-probe set 1716 (TIB MolBiol, Adelphia, NJ). Five microliters of colony lysate was added to 20 μl LightCycler reaction cuvettes containing the master mix. Cycling conditions were as follows: 95°C for 10 min; 45 cycles of 10 s at 95°C, 15 s at 55°C, and 15 s at 72°C; melting curve analysis for 0 s at 95°C, 20 s at 59°C, 20 s at 40°C (ramp rate of 0.2°C/s), and 0 s at 85°C (ramp rate of 0.2°C/s and continuous acquisition); and cooling for 30 s at 40°C. Analytical sensitivity for both targets was 10 CFU/μl. There was no cross-reactivity against a panel of 12 organisms (see Table S1 in the supplemental material).

Fifty-seven Enterobacteriaceae or nonfermenting Gram-negative bacillus isolates (46 of which were ertapenem nonsusceptible) were studied at Mayo Clinic (see Table S2 in the supplemental material). Isolation plate primary inoculation areas were gently swept using an inoculation loop and transferred to methicillin-resistant Staphylococcus aureus (MRSA) lysis tubes (Roche Molecular Diagnostics). Suspensions were heated and physically disrupted on a Thermomixer R (Eppendorf AG, Germany) for 6 min at 1,400 rpm, followed by centrifugation at 20,800 × g for 2 min. Thirty isolates were positive for blaKPC, and three isolates were positive for blaNDM. Concordant results were obtained with the Centers for Disease Control and Prevention's duplex real-time PCR assay (26).

To enrich for NDM-positive isolates, 101 isolates of Enterobacteriaceae or nonfermenting Gram-negative bacilli, which had been shown previously to produce an NDM-type carbapenemase by metallo-β-lactamase gene PCR, were additionally studied at the HPA (see Table S2 in the supplemental material). Colonies from overnight culture were suspended in 100 μl water, heated for 5 min at 95°C, and centrifuged at 8,000 rpm for 5 min; supernatant was tested by PCR. All were positive for blaNDM (as expected) by the novel real-time PCR assay.

Recent publications have described molecular assays for carbapenemase genes. Spanu et al. evaluated 300 clinical isolates using the commercial NucliSENS EasyQ KPC (bioMérieux, Marcy l'Etoile, France) assay and found 100% sensitivity and specificity and an analytical sensitivity of 4 CFU/reaction (16). Manchanda et al. evaluated a laboratory-developed real-time PCR assay targeting blaNDM-1 by assaying 34 clinical isolates and compared results to a conventional PCR assay; concordant results and a sensitivity of 10 copies/reaction were reported (18). Diene et al. evaluated a collection of 44 clinical isolates using a real-time PCR assay targeting blaNDM-1; results were concordant with conventional PCR, although only a single blaNDM-1-positive isolate was studied (19). Ong et al. described a real-time PCR assay for blaNDM-1 using hydrolysis probes and assayed 47 isolates (12 of which were positive), reporting 100% sensitivity and specificity compared with conventional PCR and a limit of detection of 35 CFU/reaction (21). Qi et al. described a LAMP assay for detection of blaNDM-1 and tested it on 345 veterinary isolates also characterized by conventional PCR; their study included only a single blaNDM-1-positive isolate (22). Finally, Monteiro et al. evaluated a multiplex real-time PCR assay, which detected six resistance genes, including blaKPC and blaNDM-1, using high-resolution melting-curve analysis. Fifty-eight isolates, which had been previously characterized by PCR and sequencing, were evaluated with 100% concordance (20). A commercial assay, hyplex SuperBug ID (Amplex, BioSystems GMBH, Geiβen, Germany), which detects blaKPC and blaNDM-1 and other carbapenemase genes in 2.5 to 4 h, has been recently described (15). Although these assays performed equivalently to our assay, all except two used preparatory DNA extraction/purification and all had longer turnaround times than our 1.5-h estimate. The only reports that used a comparable lysis method either targeted only blaKPC (16) or did not use real-time detection (15). Additionally, none of the reports detail the specificity of assay design for detection of NDM genotypes other than NDM-1; based on in silico analysis, NDM-1 through -7 would be detected by our assay.

Two evaluations utilizing microarrays that target multiple resistance genes reported similar results compared with conventional and real-time PCR methods (23, 24, 27, 28). While more information can be gained from this approach, the turnaround time is long and the instrumentation and expertise required are beyond the scope of most clinical laboratories.

In summary, this is the first description of a FRET hybridization probe-based real-time PCR assay that targets blaKPC and blaNDM in a single assay. It is simple to perform, as evidenced by its implementation in our laboratories in the United States and the United Kingdom. Including the rapid preparatory lysis procedure, results are obtained within 90 min, and the assay performs as well as a reference assay for use in the public health arena. It offers rapid detection and differentiation of blaKPC and blaNDM in multidrug-resistant Gram-negative isolates, resistance mechanisms that are important causes of carbapenem resistance worldwide, and provides information for patient care and for limiting the spread of resistant bacteria.

Supplementary Material

Supplemental material

ACKNOWLEDGMENT

We thank the Minnesota Department of Health for providing two of the NDM-producing isolates studied.

Footnotes

Published ahead of print 23 January 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.03062-12.

REFERENCES

  • 1. Peirano G, Ahmed-Bently J, Woodford N, Pitout JD. 2011. New Delhi metallo-beta-lactamase from traveler returning to Canada. Emerg. Infect. Dis. 17:242–244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Paterson DL. 2006. Resistance in gram-negative bacteria: Enterobacteriaceae. Am. J. Infect. Control 34(Suppl 1):S20–S28 [DOI] [PubMed] [Google Scholar]
  • 3. Bush K, Fisher JF. 2011. Epidemiological expansion, structural studies, and clinical challenges of new beta-lactamases from gram-negative bacteria. Annu. Rev. Microbiol. 65:455–478 [DOI] [PubMed] [Google Scholar]
  • 4. Carattoli A. 2009. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother. 53:2227–2238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Potron A, Poirel L, Nordmann P. 2011. Plasmid-mediated transfer of the blaNDM-1 gene in Gram-negative rods. FEMS Microbiol. Lett. 324:111–116 [DOI] [PubMed] [Google Scholar]
  • 6. Clinical and Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing: twenty-second informational supplement. CLSI document M100–S222012. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 7. Anderson KF, Lonsway DR, Rasheed JK, Biddle J, Jensen B, McDougal LK, Carey RB, Thompson A, Stocker S, Limbago B, Patel JB. 2007. Evaluation of methods to identify the Klebsiella pneumoniae carbapenemase in Enterobacteriaceae. J. Clin. Microbiol. 45:2723–2725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Mochon AB, Garner OB, Hindler JA, Krogstad P, Ward KW, Lewinski MA, Rasheed JK, Anderson KF, Limbago BM, Humphries RM. 2011. New Delhi metallo-beta-lactamase (NDM-1)-producing Klebsiella pneumoniae: case report and laboratory detection strategies. J. Clin. Microbiol. 49:1667–1670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Nordmann P, Gniadkowski M, Giske CG, Poirel L, Woodford N, Miriagou V. 2012. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin. Microbiol. Infect. 18:432–438 [DOI] [PubMed] [Google Scholar]
  • 10. Arakawa Y, Shibata N, Shibayama K, Kurokawa H, Yagi T, Fujiwara H, Goto M. 2000. Convenient test for screening metallo-beta-lactamase-producing gram-negative bacteria by using thiol compounds. J. Clin. Microbiol. 38:40–43 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kim SY, Hong SG, Moland ES, Thompson KS. 2007. Convenient test using a combination of chelating agents for detection of metallo-beta-lactamases in the clinical laboratory. J. Clin. Microbiol. 45:2798–2801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Girlich D, Poirel L, Nordmann P. 2012. Value of the modified Hodge test for detection of emerging carbapenemases in Enterobacteriaceae. J. Clin. Microbiol. 50:477–479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kruttgen A, Razavi S, Imhol M, Ritter K. 2011. Real-time PCR assay and a synthetic positive control for the rapid and sensitive detection of the emerging resistance gene New Delhi Metallo-beta-lactamase-1 (blaNDM-1). Med. Microbiol. Immunol. 200:137–141 [DOI] [PubMed] [Google Scholar]
  • 14. Richter SN, Frasson I, Biasolo MA, Bartolini A, Cavallaro A, Palu G. 2012. Ultrarapid detection of blaKPC1/2–12 from perirectal and nasal swabs by use of real-time PCR. J. Clin. Microbiol. 50:1718–1720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Kaase M, Szabados F, Wassill L, Gatermann SG. 2012. Detection of carbapenemases in enterobacteriaceae by a commercial multiplex PCR. J. Clin. Microbiol. 50:3115–3118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Spanu T, Fiori B, D'Inzeo T, Canu G, Campoli S, Giani T, Palucci I, Tumbarello M, Sanguinetti M, Rossolini GM. 2012. Evaluation of the new NucliSENS EasyQ KPC test for rapid detection of Klebsiella pneumoniae carbapenemase genes (blaKPC). J. Clin. Microbiol. 50:2783–2785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Naas T, Ergani A, Carrer A, Nordmann P. 2011. Real-time PCR for detection of NDM-1 carbapenemase genes from spiked stool samples. Antimicrob. Agents Chemother. 55:4038–4043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Manchanda V, Rai S, Gupta S, Rautela RS, Chopra R, Rawat DS, Verma N, Singh NP, Kaur IR, Bhalla P. 2011. Development of TaqMan real-time polymerase chain reaction for the detection of the newly emerging form of carbapenem resistance gene in clinical isolates of Escherichia coli, Klebsiella pneumoniae, and Acinetobacter baumannii. Indian J. Med. Microbiol. 29:249–253 [DOI] [PubMed] [Google Scholar]
  • 19. Diene SM, Bruder N, Raoult D, Rolain JM. 2011. Real-time PCR assay allows detection of the New Delhi metallo-beta-lactamase (NDM-1)-encoding gene in France. Int. J. Antimicrob. Agents 37:544–546 [DOI] [PubMed] [Google Scholar]
  • 20. Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S. 2012. Rapid detection of carbapenemase genes by multiplex real-time PCR. J. Antimicrob. Chemother. 67:906–909 [DOI] [PubMed] [Google Scholar]
  • 21. Ong DC, Koh TH, Syahidah N, Krishnan P, Tan TY. 2011. Rapid detection of the blaNDM-1 gene by real-time PCR. J. Antimicrob. Chemother. 66:1647–1649 [DOI] [PubMed] [Google Scholar]
  • 22. Qi J, Du Y, Zhu X, Bai H, Luo Y, Liu Y. 2012. A loop-mediated isothermal amplification method for rapid detection of NDM-1 gene. Microb. Drug Resist. 18:359–363 [DOI] [PubMed] [Google Scholar]
  • 23. Naas T, Cuzon G, Bogaerts P, Glupczynski Y, Nordmann P. 2011. Evaluation of a DNA microarray (Check-MDR CT102) for rapid detection of TEM, SHV, and CTX-M extended-spectrum beta-lactamases and of KPC, OXA-48, VIM, IMP, and NDM-1 carbapenemases. J. Clin. Microbiol. 49:1608–1613 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Cuzon G, Naas T, Bogaerts P, Glupczynski Y, Nordmann P. 2012. Evaluation of a DNA microarray for the rapid detection of extended-spectrum beta-lactamases (TEM, SHV and CTX-M), plasmid-mediated cephalosporinases (CMY-2-like, DHA, FOX, ACC-1, ACT/MIR and CMY-1-like/MOX) and carbapenemases (KPC, OXA-48, VIM, IMP and NDM). J. Antimicrob. Chemother. 67:1865–1869 [DOI] [PubMed] [Google Scholar]
  • 25. Fishbain JT, Sinyavskiy O, Riederer K, Hujer AM, Bonomo RA. 2012. Detection of extended-spectrum beta-lactamase and Klebsiella pneumoniae carbapenemase genes directly from blood cultures by use of a nucleic acid microarray. J. Clin. Microbiol. 50:2901–2904 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Centers for Disease Control and Prevention 2011. Multiplex real-time PCR detection of Klebsiella pneumoniae carbapenemase (KPC) and New Delhi metallo-B-lactamase (NDM-1) genes. Centers for Disease Control and Prevention, Atlanta, GA: http://www.cdc.gov/HAI/settings/lab/kpc-ndm1-lab-protocol.html [Google Scholar]
  • 27. Woodford N, Warner M, Pike R, Zhang J. 2011. Evaluation of a commercial microarray to detect carbapenemase-producing Enterobacteriaceae. J. Antimicrob. Chemother. 66:2887–2888 [DOI] [PubMed] [Google Scholar]
  • 28. Stuart JC, Voets G, Scharringa J, Fluit AC, Leverstein-Van Hall MA. 2012. Detection of carbapenemase-producing Enterobacteriaceae with a commercial DNA microarray. J. Med. Microbiol. 61:809–812 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES