Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2013 Apr;51(4):1247–1249. doi: 10.1128/JCM.03316-12

Rapid and Simultaneous Detection of blaKPC and blaNDM by Use of Multiplex Real-Time PCR

Michael Milillo 1, Yoon I Kwak 1, Erik Snesrud 1, Paige E Waterman 1, Emil Lesho 1, Patrick McGann 1,✉
PMCID: PMC3666810  PMID: 23325823

Abstract

The increasing incidence of carbapenem nonsusceptibility among clinically important species is of global concern. Identification of the molecular mechanisms underlying carbapenem nonsusceptibility is critical for epidemiological investigations. In this report, we describe a real-time PCR-based assay capable of simultaneously detecting blaKPC and blaNDM, two of the most important carbapenemases, directly from culture in less than 90 min. The assay was validated with blaKPC- and blaNDM-carrying clinical isolates and demonstrated 100% concordance with the Carba NP test.

TEXT

The potent antimicrobial activity of the carbapenems (ertapenem, doripenem, imipenem, and meropenem) is being increasingly compromised by the emergence and international dissemination of carbapenem-hydrolyzing β-lactamases (carbapenemases) (1–3). Culture-based methods, such as the modified Hodge test, combined with antibiotic susceptibilities remain the principal methods used to detect carbapenemase activity. These methods have limitations, including the inability to differentiate the molecular mechanism involved, extended turnaround times, and inconclusive results, particularly with nonmembers of the family Enterobacteriaceae, such as Acinetobacter baumannii and Pseudomonas aeruginosa (4–6). Molecular methods for the detection of carbapenemase genes provide several advantages over culture-based techniques, including high sensitivity and rapid turnaround time. Furthermore, they provide a critical resource for epidemiological investigations. Despite their advantages, the implementation of molecular methods has been slow, primarily because of concerns about allelic variation within target genes, primer cross-reactions, and high costs (7).

blaKPC and blaNDM have received global attention because of their widespread distribution (2, 8, 9), broad range of activity against β-lactams (3), and association with serious clinical infections (10, 11). As of this writing, the sequences of 13 blaKPC and 7 blaNDM alleles have been deposited at GenBank. However, unlike other important carbapenemase genes, such as blaVIM and blaIMP, allelic variation in blaKPC and blaNDM is very low.

The Multidrug-Resistant Organism Repository and Surveillance Network (MRSN) collects and characterizes multidrug-resistant organisms across the United States Military Health System to enhance infection prevention, inform empirical therapy, and influence policy (12). Over 20 military health care facilities worldwide, including those in war zones, submit an average of 300 clinical isolates monthly, comprising methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterococci, and multidrug-resistant, extremely drug resistant, and pan-drug-resistant Gram-negative bacteria. Thirty-five to 50 are submitted as carbapenem resistant, the majority of which are A. baumannii and P. aeruginosa. One hundred thirty-seven carbapenem-resistant members of the family Enterobacteriaceae have been submitted since 2010, with 97 displaying ertapenem resistance but imipenem/meropenem sensitivity phenotypes. All carbapenem-resistant isolates are tested for blaKPC, blaIMP, blaOXA-48, blaVIM, and blaNDM with separate, individual real-time PCR assays. In this report, we describe a novel triplex assay that simultaneously detects all variants of blaKPC and blaNDM.

Primers and probes (Table 1) for blaKPC and blaNDM were designed with Beacon Designer 7.0 (Premier Biosoft International) by using an alignment of all of the sequence variants available in GenBank. An internal control based on the 16S rRNA gene was designed by using an alignment of the 16S rRNA gene sequences from 45 members of the family Enterobacteriaceae (see Table S1 in the supplemental material), A. baumannii, A. nosocomialis, A. pitii, and P. aeruginosa. The 16S rRNA gene primer and probe amplified a product from every organism tested, including clinical isolates of A. baumannii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, and P. aeruginosa. Amplification was also achieved from 32 American Type Culture Collection strains (American Type Culture Collection, Manassas, VA) and 18 clinical isolates representing 50 different bacterial species (14) of the genera Achromobacter, Aeromonas, Alcaligenes, Burkholderia, Citrobacter, Hafnia, Kluyvera, Moraxella, Morganella, Proteus, Serratia, Salmonella, Shigella, and Stenotrophomonas (see Fig. S1 in the supplemental material). Primers and probes were validated and optimized individually and in a triplex reaction by using minimum information for the publication of quantitative real-time PCR experiments guidelines (13). The optimized triplex assay was tested against 26 blaKPC2 (E. coli n = 4, E. cloacae n = 2, K. pneumoniae n = 20), 1 blaKPC-3 (K. pneumoniae n = 1), and 3 blaNDM-1 (A. baumannii n = 1, A. schindleri n = 1, Providencia stuartii n = 1) clinical isolates cultured from urine (30%), respiratory (20%), wound (17%), blood (10%), sterile tissue (7%), sterile fluid (3.3%), and surveillance (groin, 10%; rectal, 3.3%) samples collected between 2010 and 2012 (see Table S2 in the supplemental material). All genes were previously detected by the uniplex assays and confirmed by sequencing.

Table 1.

Primers and probes used in this study

Namea Sequence (5′-3′)b Concn (nM)c Locationd Efficiency (%)e
16SMP-F AAGTCGGAATCGCTAGTAATCG 150 1335–1356
16SMP-R ATGGTGTGACGGGCGGT 150 1401–1417 102.1
16SMP-P 6FAM-TGTACAAGG-ZEN-CCCGGGAACGTATTCA-IABkFQ 100 1375–1399
KPCMP-F CTGTGCAGCTCATTCAAG 300 199–216
KPCMP-R CATGCCTGTTGTCAGATA 300 331–348 95.4
KPCMP-P HEX-TTCTTGCTG-ZEN-CCGCTGTGCTG-IABkFQ 250 221–240
NDMMP-F GCCCAATATTATGCACCC 250 562–582
NDMMP-R GTCGCCAGTTTCCATTTG 250 610–626 96.2
NDMMP-P TEX615-CGTTGGGATCGACGGCACC-BHQ2 200 585–603
a

KPC primers and probe target all 13 variants of blaKPC; NDM primers and probe target all 7 variants of blaNDM.

b

16SMP-Probe and KPCMP-Probe contain a double internal ZEN quencher. 6FAM, 6-carboxyfluorescein; BHQ2, black hole quencher 2; HEX, hexachlorofluorescein; IABkFQ, Iowa black fluorescence quencher; TEX615, Texas Red 615.

c

Optimal primer and probe concentrations in the triplex assay were determined by titration as described previously (13). For uniplex reactions, all primer and probe concentrations should be 250 and 200 nM, respectively.

d

Relative to the first base pair of the coding region of blaKPC-2 and blaNDM-1. The 16S rRNA location is approximate.

e

Efficiency was calculated from the triplex assay. The 16S rRNA primers and probe have an efficiency of >100%, as the positive control was a combination of DNA from K. pneumoniae ATCC 1705 (blaKPC-2) and A. baumannii NDM2 (blaNDM-2). All primers have an efficiency of ≥98% when used alone. The R2 values for all primers and probes were ≥98%.

Rapid DNA extraction (23-min protocol) was performed using Lyse-and-go (Thermo Scientific, Waltham, MA) as described previously (14). Real-time PCR was performed on a CFX96 cycler (Bio-Rad Laboratories, Hercules, CA) using iQ Multiplex Powermix (Bio-Rad) in 20-μl volumes. The cycling protocol was 95°C for 5 min and 40 cycles of 95°C for 10 s and 56°C for 40 s. Appropriate positive (K. pneumoniae ATCC 1705, blaKPC-2+; K. pneumoniae NCTC 13443, blaNDM-1+; A. baumannii NDM2, blaNDM-2+), negative (ATCC 1706), and no-template (water) controls were incorporated into every plate. In parallel, all isolates were tested for carbapenemase production by using the Carba NP test as described previously (15). The total time for the entire procedure was 88 min.

blaKPC- and blaNDM-carrying isolates were recovered from a variety of clinical sites (see Table S2 in the supplemental material). All isolates were classified as nonsusceptible to ertapenem (≥2 μg/ml) (16) (see Table S2). Two isolates, MRSN 10266 and MRSN 11906, were intermediately susceptible to imipenem (2 μg/ml) but nonsusceptible to meropenem (≥4 μg/ml). Conversely, MRSN 10189 was susceptible to meropenem (≤1 μg/ml) but nonsusceptible to imipenem (≥4 μg/ml). These data support previous studies that have shown various susceptibilities to carbapenems in producers of K. pneumoniae carbapenemase and New Delhi metallo-β-lactamase (17–19). In our surveillance network, nonsusceptibility to ertapenem in members of the family Enterobacteriaceae is used as the main criterion to select isolates for gene screening. However, this criterion is not suitable for P. aeruginosa and Acinetobacter species and in our experience has led to unnecessary screening of Enterobacteriaceae with altered outer membrane porins or AmpC enzyme producers (18, 20). By using the Carba NP test, the number of isolates selected for real-time PCR can be greatly reduced.

The triplex assay was capable of detecting <100 genome copies of blaKPC and blaNDM and amplified the expected product from all of our blaKPC- and blaNDM-carrying isolates. In contrast, only the 16S primer and probe amplified a product from 97 ertapenem-resistant but imipenem/meropenem-sensitive Enterobacteriaceae and 45 imipenem-resistant clinical isolates of A. baumannii and Pseudomonas aeruginosa that were previously determined to be blaKPC and blaNDM negative by uniplex real-time PCR. All blaKPC- and blaNDM-carrying members of the family Enterobacteriaceae in this study were positive for carbapenemase production by the Carba NP test (15). The test was unable to detect New Delhi metallo-β-lactamase 1 production in Acinetobacter species, most likely because of weak enzyme production by Acinetobacter species. In Acinetobacter, the blaNDM gene is disproportionally carried as a single copy on the chromosome, rather than on plasmids, as in many members of the family Enterobacteriaceae, where it may be present in higher copy numbers (21).

The triplex assay provides a rapid and accurate method for detecting blaKPC and blaNDM. The assay provides considerable advantages over methods that employ melting curve analysis and double-stranded DNA binding dyes (22), including the presence of an internal control to reduce false negatives, the ability to detect both blaKPC and blaNDM in the same target, and removal of the inherent variation in melting curves associated with allelic variation in target genes. After initial capital investments, the average cost per reaction is about $0.90. The MRSN now initially selects isolates for carbapenemase gene testing based on antibiotic susceptibilities, followed by the Carba NP test where appropriate, and finally real-time PCR.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We gratefully acknowledge the U.S. Army Medical Command and the Defense Medical Research and Development Program for providing major funding for this study. The reference strain, A. baumannii NDM2, was kindly provided by Patrice Nordmann.

This material has been reviewed by the Walter Reed Army Institute of Research. There is no objection to its presentation. The opinions or assertions contained herein are our private views and are not to be construed as official or reflecting the views of the Department of the Army or the Department of Defense.

Footnotes

Published ahead of print 16 January 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.03316-12.

REFERENCES

  • 1. Nordmann P, Naas T, Poirel L. 2011. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 17:1791–1798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Nordmann P, Poirel L, Walsh TR, Livermore DM. 2011. The emerging NDM carbapenemases. Trends Microbiol. 19:588–595 [DOI] [PubMed] [Google Scholar]
  • 3. Patel G, Bonomo RA. 2011. Status report on carbapenemases: challenges and prospects. Expert Rev. Anti Infect. Ther. 9:555–570 [DOI] [PubMed] [Google Scholar]
  • 4. Girlich D, Poirel L, Nordmann P. 2012. Value of the modified Hodge test for detection of emerging carbapenemases in Enterobacteriaceae. J. Clin. Microbiol. 50:477–479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Noyal MJ, Menezes GA, Harish BN, Sujatha S, Parija SC. 2009. Simple screening tests for detection of carbapenemases in clinical isolates of nonfermentative Gram-negative bacteria. Indian J. Med. Res. 129:707–712 [PubMed] [Google Scholar]
  • 6. Pasteran F, Veliz O, Rapoport M, Guerriero L, Corso A. 2011. Sensitive and specific modified Hodge test for KPC and metallo-beta-lactamase detection in Pseudomonas aeruginosa by use of a novel indicator strain, Klebsiella pneumoniae ATCC 700603. J. Clin. Microbiol. 49:4301–4303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Sibley CD, Peirano G, Church DL. 2012. Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology. Infect. Genet. Evol. 12:505–521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Nordmann P, Dortet L, Poirel L. 2012. Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol. Med. 18:263–272 [DOI] [PubMed] [Google Scholar]
  • 9. Walsh TR, Toleman MA. 2012. The emergence of pan-resistant Gram-negative pathogens merits a rapid global political response. J. Antimicrob. Chemother. 67:1–3 [DOI] [PubMed] [Google Scholar]
  • 10. Patel G, Huprikar S, Factor SH, Jenkins SG, Calfee DP. 2008. Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect. Control Hosp. Epidemiol. 29:1099–1106 [DOI] [PubMed] [Google Scholar]
  • 11. Schwaber MJ, Klarfeld-Lidji S, Navon-Venezia S, Schwartz D, Leavitt A, Carmeli Y. 2008. Predictors of carbapenem-resistant Klebsiella pneumoniae acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob. Agents Chemother. 52:1028–1033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Waterman P, Kwak Y, Clifford R, Julius M, Onmus-Leone F, Tsurgeon C, Riley M, Black C, McGann P, Lesho E. 2012. A multidrug-resistance surveillance network: 1 year on. Lancet Infect. Dis. 12:587–588 [DOI] [PubMed] [Google Scholar]
  • 13. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55:611–622 [DOI] [PubMed] [Google Scholar]
  • 14. Clifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, Kwak YI, Waterman PE, Lesho EP, Mc Gann P. 2012. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS One 7:e48558 doi:10.1371/journal.pone.0048558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Nordmann P, Poirel L, Dortet L. 2012. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 18:1503–1507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Clinical and Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing. M100–S22 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 17. Miriagou V, Cornaglia G, Edelstein M, Galani I, Giske CG, Gniadkowski M, Malamou-Lada E, Martinez-Martinez L, Navarro F, Nordmann P, Peixe L, Pournaras S, Rossolini GM, Tsakris A, Vatopoulos A, Canton R. 2010. Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin. Microbiol. Infect. 16:112–122 [DOI] [PubMed] [Google Scholar]
  • 18. Nordmann P, Cuzon G, Naas T. 2009. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis. 9:228–236 [DOI] [PubMed] [Google Scholar]
  • 19. Thomson KS. 2010. Extended-spectrum-beta-lactamase, AmpC, and carbapenemase issues. J. Clin. Microbiol. 48:1019–1025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Munier GK, Johnson CL, Snyder JW, Moland ES, Hanson ND, Thomson KS. 2010. Positive extended-spectrum-beta-lactamase (ESBL) screening results may be due to AmpC beta-lactamases more often than to ESBLs. J. Clin. Microbiol. 48:673–674 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bonnin RA, Naas T, Poirel L, Nordmann P. 2012. Phenotypic, biochemical, and molecular techniques for detection of metallo-beta-lactamase NDM in Acinetobacter baumannii. J. Clin. Microbiol. 50:1419–1421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S. 2012. Rapid detection of carbapenemase genes by multiplex real-time PCR. J. Antimicrob. Chemother. 67:906–909 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES