Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 May 30.
Published in final edited form as: Endocr Relat Cancer. 2012 May 24;19(3):435–446. doi: 10.1530/ERC-11-0306

Thyroid specific ablation of the Carney Complex gene, PRKAR1A, results in hyperthyroidism and follicular thyroid cancer

Daphne R Pringle 1, Zhirong Yin 1,*, Audrey A Lee 1, Parmeet K Manchanda 1, Lianbo Yu 2, Alfred F Parlow 3, David Jarjoura 2, Krista M D La Perle 4, Lawrence S Kirschner 1,5
PMCID: PMC3667702  NIHMSID: NIHMS468411  PMID: 22514108

Abstract

Thyroid cancer is the most common endocrine malignancy in the population, and the incidence of this cancer is increasing at a rapid rate. Although genetic analysis of papillary thyroid cancer (PTC) has identified mutations in a large percentage of patients, the genetic basis of follicular thyroid cancer (FTC) is less certain. Thyroid cancer, including both PTC and FTC has been observed in patients with the inherited tumor predisposition Carney Complex (CNC), caused by mutations in PRKAR1A. In order to investigate the role of loss of PRKAR1A in thyroid cancer, we generated a tissue-specific knockout of Prkar1a in the thyroid. We report that the resulting mice are hyperthyroid and developed follicular thyroid neoplasms by one year of age, including FTC in over 40% of animals. These thyroid tumors showed a signature of pathway activation different from that observed in other models of thyroid cancer. In vitro cultures of the tumor cells indicated that Prkar1a-null thyrocytes exhibited growth factor independence and suggested possible new therapeutic targets. Overall, this work represents the first report of a genetic mutation known to cause human follicular thyroid cancer that exhibits a similar phenotype when modeled in the mouse. In addition to adding to our knowledge of the mechanisms of human follicular thyroid tumorigenesis, this model is highly reproducible and may provide a viable mechanism for the further clinical development of therapies aimed at follicular thyroid cancer.

Keywords: PKA, PRKAR1A, thyroid hormone signaling, follicular thyroid cancer

INTRODUCTION

Epithelial thyroid cancer (i.e., non-medullary thyroid cancer) is the most common endocrine malignancy in the general population and rates of thyroid cancer continue to rise in the United States beyond what has been predicted from improved case ascertainment (Aschebrook-Kilfoy et al., 2010). Well-differentiated non-medullary thyroid cancer is divided into papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) based on histological criteria. Although PTC is the more common subtype, patients with FTC have a poorer prognosis owing to the tendency of this tumor to behave more aggressively, including local and vascular invasion and distant metastases (Besic et al., 1999).

Although there is a wealth of information regarding the molecular basis of PTC (reviewed in (Nikiforov, 2011)), less is known about the genetics of FTC. Analysis of sporadic tumors has identified mutations in RAS in a small subset of tumors, whereas other investigators have demonstrated activating fusions between the PAX8 and PPARG transcription factors (Lacroix et al., 2005; Niepomniszcze et al., 2006). Since PAX8 is required for thyroid development, it has been hypothesized that the PPARG-PAX8 fusion protein causes cancer by activating aberrant gene transcription.

Analysis of genetic syndromes that include FTC is another potential source for the identification of the molecular mechanisms contributing to carcinogenesis. FTC is associated with two tumor predisposition syndromes, Carney Complex (CNC) and Cowden Syndrome (CS). CNC (OMIM #160980) is characterized by spotty skin pigmentation, myxomas, endocrine tumors and schwannomas (Stratakis et al., 2001). In a recent large series, benign thyroid adenomas were observed in 25% of cases, and thyroid cancer, either PTC or FTC or both, was found in 2.5% of patients, including being the cause of death in 1 patient (Bertherat et al., 2009). CNC is caused by inactivating mutations in PRKAR1A (Kirschner et al., 2000), which encodes the type 1a regulatory subunit of the cAMP dependent protein kinase (Protein Kinase A, PKA), and mutations of this gene have been observed in sporadic cases of thyroid cancer (Sandrini et al., 2002). CS (OMIM #158350) is characterized as a multiple hamartoma syndrome, and includes brain and breast cancer, in addition to FTC. This syndrome is caused by inactivating mutations in PTEN, a dual-specificity phosphatase which negatively regulates the PI3 Kinase/AKT pathway. Mutations in this gene have been detected in a variety of advanced sporadic cancers (reviewed in (Hollander et al., 2011)) and approximately 5% of FTCs (Nagy et al., 2011).

Our laboratory has been interested in studying the mechanism of tumorigenesis associated with mutations in PRKAR1A and its mouse homolog, Prkar1a. We have previously reported that Prkar1a+/− mice are prone to tumors in cAMP-responsive tissues, including the thyroid (Kirschner et al., 2005). Tissue-specific deletion of Prkar1a in cAMP-responsive tissues such as growth hormone-producing pituitary cells and Schwann cells can result in benign tumorigenesis associated with increased intracellular PKA activity (Jones et al., 2008; Yin et al., 2008b).

In this paper, we sought to extend these observations by generating a tissue-specific knockout (KO) of Prkar1a in the thyroid. We demonstrate that loss of Prkar1a in the thyroid glands leads to thyroid hyperfunction and the formation of FTC. This new model of FTC adds to our understanding of the molecular mechanisms involved in follicular thyroid cancer development and may help guide the development of new therapies.

METHODS AND MATERIALS

Animal Studies

Mice were maintained in a sterile environment under 12-hour light/dark cycles, and animal experiments were carried out in accordance with the highest standards of animal care under an IACUC-approved protocol. The generation of Prkar1aloxP/loxP and Thyroid Peroxidase-cre (TPO-cre) animals has been described (Kirschner et al., 2005; Kusakabe et al., 2004). Prkar1aloxP/loxP and TPO-cre mice were mated in order to generate TPO-cre; Prkar1aloxP/loxP (R1a-TpoKO) mice.

Histology

Immunohistochemistry experiments were performed as described previously (Jones et al., 2008) with the following antibodies: Cell Signaling Technology (Danvers, MA)- Akt (9272), pAktSer473 (3787), Erk (9102), pErkThr202/Tyr204 (9101), cleaved-Caspase 3 (9661); BD Biosciences (San Jose, CA)- Ki67 (550609).

Western Blotting

Proteins from mouse tissues were prepared and run on SDS-PAGE gels and transferred to nitrocellulose, blocked with 5% non-fat dry milk or bovine serum albumin, and probed with the indicated antibodies. Antibodies used in this study were as follows: Cell Signaling Technology (Danvers, MA)- Akt (9272), pAktSer473 (9271), Erk (9102), pErkThr202/Tyr204 (9101), pStat3Tyr705 (9145P), Stat3 (9132), pCREBSer133 (9198), CREB (9197); Santa Cruz Biotechnology (Santa Cruz, CA)- PCNA (sc-56), Spot14 (sc-137178); Sigma (St. Louis, MO)- β-Actin (A5060); Abbiotec (San Diego, CA)- TSHR (250898).

Microarray

RNA was isolated from the thyroids of 1-year old wild-type and R1a-TpoKO mice using the Qiagen miRNeasy kit according to the manufacturer's instructions (Qiagen, Valencia, CA). cDNA was made using the BioRad iScript cDNA Synthesis Kit (BioRad Laboratories, Hercules, CA). cDNA samples were hybridized to the Affymetrix Mouse Exon 1.0 ST Array Chip (Affymetrix, Santa Clara, CA). Pathways were analyzed using Ingenuity Pathways Analysis Software (Ingenuity Systems, www.ingenuity.com).

Quantitative Real-Time PCR

RNA was isolated from mouse thyroids or cultured R1a-TpoKO cells and converted to cDNA with the BioRad iScript cDNA Synthesis Kit (BioRad Laboratories, Hercules, CA). cDNA was subject to qRT-PCR using the iQ SYBR Green Supermix Kit (BioRad Laboratories, Hercules, CA) as per manufacturer's instructions. Reactions were each performed in triplicate. Primers were as follows:

  • Androgen Receptor 5' GGACCATGTTTTACCCATCG

  • 3' TCGTTTCTGCTGGCACATAG

  • Ucp1 5' GGGCCCTTGTAAACAACAAA

  • 3' GTCGGTCCTTCCTTGGTGTA.

  • C3 5' AAGCATCAACACACCCAACA

  • 3' CTTGAGCTCCATTCGTGACA

  • Bcl3 5' TTACTCTACCCCGACGATGG

  • 3' CCAAGCTTGAAAAGGCTGAG

  • Nfil3 5' CGGAAGTTGCATCTCAGTCA

  • 3' GCAAAGCTCTCCAACTCCAC

  • Icam1 5' AGCACCTCCCCACCTACTTT

  • 3' AGCTTGCACGACCCTTCTAA

Primary Cell Culture

Primary culture of thyroid cells was performed as previously described (Jeker et al., 1999). Briefly, cells were cultured on poly-D-lysine coated plates in 5% fetal bovine serum in F12 media supplemented with L-glutamine, non-essential amino acids, sodium bicarbonate, and 6H hormone mix (TSH, Insulin, Hydrocortisone, Glycyl-Histidyl-L-lysine, Transferrin, and Somatostatin). All experiments were performed on cells that were passage 20 or less. Inhibitors used were as follows: LY294002, 10μM and U0126, 10μM (Cell Signaling Technology); myristoylated-PKI, 5μM (Invitrogen); HO-3867, 10 μM (the generous gift of Dr. P. Kuppusamy, The Ohio State University). Cells were incubated in the presence of indicated inhibitors or media for 48 hours (fresh inhibitors were added every 24 hours), followed by MTT assays performed using the MTT Cell Proliferation Assay Kit (Cayman Chemical, Ann Arbor Michigan) according to the manufacturer's instructions. All experiments were performed in triplicate.

Statistics

All data, except microarray results, were analyzed via student's t-test using StatCrunch Software (www.statcrunch.com); p-values less than 0.05 were considered significant. For microarray results, signal intensities were quantified by Affymetrix software. Background correction and quantile normalization were performed to adjust technical bias, and gene expression levels were summarized using the RMA method (Irizarry et al., 2003). A filtering method based on percentage of arrays above noise cutoff was applied to filter out low expression genes. A linear model was employed to detect differentially expressed genes. In order to improve the estimates of variability and statistical tests for differential expression, a moderated t-statistic with variance smoothing was employed for this study (Sartor et al., 2006; Yu et al., 2011). The significance level was adjusted by controlling the mean number of false positives (Gordon et al., 2007).

RESULTS

Deletion of Prkar1a in the thyroid results in hyperthyroidism and follicular thyroid neoplasia

In order to generate a thyroid-specific deletion of Prkar1a, we crossed mice harboring the Thyroid Peroxidase (TPO)-cre transgene with Prkar1aloxP/loxP animals to obtain TPO-cre; Prkar1aloxP/loxP animals, hereafter referred to as R1a-TpoKO. R1a-TpoKO mice and wild-type (WT) littermates were followed to one year of age and then euthanized. Blood was collected for analysis of thyroid function and the thyroids were harvested for gross and histological examination. Thyroid hormone (T4) levels in the R1a-TpoKO mice (n=12) were markedly elevated compared to the controls (n=12) (8.3 ± 4.4 μg/dL for KO vs. 3.2 ± 1.1 μg/dL in WT, p=0.0009) indicating biochemical hyperthyroidism. TSH levels were also measured and were found to be lower in the R1a-TpoKO mice (157.25 ± 54.13 ng/mL in KO vs 353 ± 640 ng/mL in WT) although the differences were not statistically significant due to wide variations in the WT. While it is somewhat surprising that TSH levels were not significantly suppressed in these animals, it is a reasonable result given the relatively reduced sensitivity of the assay at the low end of the measurement range. To further show functional hyperthyroidism in these animals, body weights of WT and R1a-TpoKO animals at one-year were compared. Although R1a-TpoKO females (n=5) were on average smaller than their WT counterparts (n=5) (28.75 ± 6.32 g for KO versus 37.91 ± 8.87 g for WT, p=0.0968) the difference did not reach statistical significance. However this data along with the elevated T4 levels in these animals lead us to conclude that the R1a-TpoKO animals are functionally hyperthyroid.

Examination of the thyroids of these animals showed enlargement of the thyroids of 100% in R1a-TpoKO mice (Figures 1A and 1B). At the histological level, the thyroids exhibited increased cellularity but retained a follicular pattern of growth (Figures 1C and 1D). In order to determine if the neoplastic thyroids contained foci of thyroid cancer, we studied them for the presence of cytologic changes, as well as local invasiveness and distant metastasis. There were no morphologic or nuclear changes to suggest papillary thyroid cancer in the specimens. However, we detected invasion through the thyroid capsule and into the surrounding tissues in 10/23 (43%) of the thyroids studied. (Figure 1F). While local invasion was detected in 43% of animals, none of the tumors examined showed widely invasive or angio-invasive behavior. Examination of lymph nodes in the neck, lungs, liver, and brain failed to detect the presence of distant metastases in any tissue studied. Based on the histologic data, we conclude that R1a-TpoKO mice develop FTC at a rate of 43% by one year of age.

Figure 1. R1a-TpoKO thyroid tumors exhibit features of follicular thyroid carcinoma.

Figure 1

Representative wild-type (A) and R1a-TpoKO (B) thyroid glands at one-year of age. Hematoxylin and eosin-stained thyroid sections from wild-type (C, E) and R1a-TpoKO (D, F) thyroids shown at low (C,D) and high (E,F) magnifications. The arrow in panel F indicates tumor invasion into adjacent skeletal muscle. Scale bars in C, D: 500 μm, scale bars in E, F: 50 μm. T: trachea

R1a-TpoKO tumors exhibit increased proliferation independent of the Akt and Erk pathways

We next attempted to elucidate signaling pathways which promote tumorgenesis in this model. Because Ras/Raf/Erk and PI3K/Akt signaling have been reported to be important tumorigenic pathways in FTC, we first attempted to determine if these pathways were activated in the R1a-TpoKO tumors. As shown in Figure 2A, neither Akt nor Erk showed activation in these tumors, as judged by the absence of the phosphorylated (activated) isoforms of the proteins. The Western blotting data was confirmed with immunohistochemical staining of tissue sections, which was also negative for the phosphorylated proteins (data not shown). In attempting to identify other pathways which may be associated with carcinogenesis, we identified activation of Stat as a consistent change found in the tumors (Figure 2A).

Figure 2. Proliferation is increased in R1a-TpoKO tumors.

Figure 2

(A) Western blots of wild-type (WT) and R1a-TpoKO (KO) thyroids for the indicated proteins. Representative immunohistochemical images of wild-type (B) and R1a-TpoKO (C) thyroids stained for Ki-67. These results are quantified in (D). Representative immunohistochemical images of wild-type (E) and R1a-TpoKO (F) thyroids stained for cleaved caspase 3. These results are quantified in (G) (N.S. = not significant). Scale bars in all images: 50 μm.

We also examined the proliferative and apoptotic indices of these tumors using immunohistochemical staining. Ki-67 staining showed that R1a-TpoKO tumors had a much higher number of proliferating cells than wild-type thyroids (Figures 2B and 2C, quantified in 2D). We also found that cleaved caspase 3 staining of these tumors showed no change in apoptosis rates as compared to wild-type (Figures 2E and 2F, quantified in 2G). These results indicate that the formation of these tumors is driven primarily by an increase in proliferation and not due to a failure of apoptosis.

Microarray analysis identifies enhanced proliferation and altered differentiation pathways in R1a-TpoKO tumors

In order to further elucidate the pathways involved in tumorgenesis in this model, we performed microarray analysis on thyroids from one-year old wild-type (n=8) and R1a-TpoKO (n=8) animals. The complete list of genes (Supplementary Table 1) was then analyzed using Ingenuity Pathways Analysis Software (IPA) which identified transcriptional networks altered in the tumors. Table 1 lists the four networks showing the highest scores for alterations in the tumors, and the genes that comprise each network are included in Supplementary Table 2. The top 4 networks are shown as they had the highest IPA scores, with a dramatic drop in score seen for network 5. The IPA score represents the likelihood that the genes identified in the network would all be found by random chance (Calvano et al., 2005). In this analysis, altered cellular proliferation was identified as the third most prominent network (IPA score of 28), confirming that increased cell proliferation is the driving force in tumor growth in this model. In order to validate the microarray data, we selected 8 genes that were highly altered in the R1a-TpoKO tumors and performed quantitative real-time PCR. These results confirmed the alteration of these genes indicated by the microarray (Supplementary Table 3).

Additionally, pathways related to development were associated with all four of these highly altered networks, suggesting that differentiation may also be altered in these tumors. This data is consistent with our previously published work which suggests PKA is involved in differentiation and development in a number of cAMP responsive tissues (Jones et al., 2010; Nadella et al., 2008; Yin et al., 2008a). However, genes associated with thyrocyte terminal differentiation including, Thyroid Peroxidase, Thyroglobulin, and the Sodium-Iodide Symporter were all expressed at normal or even higher levels than WT in the R1a-TpoKO tumors (Supplementary Table 4). This data highlights the fact that thyrocyte differentiation is inherently more complicated than the expression levels of these genes may indicate.

Microarray analyses points to TRβ as a modulator of tumorgenesis

In addition to the networks described above, the IPA analysis identified a signaling network which involved the Thyroid Hormone Receptor β (TRβ, encoded by Thrb) (Figure 3). Although TRβ mRNA expression was not altered in the microarray study, several genes known to be targets of TRβ signaling were identified, including mRNAs encoding the Androgen Receptor (Ar); Spot14 (Thrsp1), and Uncoupling Protein 1 (Ucp1). In order to validate this result, we performed quantitative real-time PCR and western blot analyses on these targets (Figure 4). qRT-PCR confirmed that both Ar and Ucp1 were downregulated in the R1a-TpoKO thyroids compared to wild-type (Figure 4A and B). Western blot analysis of Spot14 indicated a reduction and/or loss of protein expression in the R1a-TpoKO thyroids (Figure 4C).

Figure 3. IPA analysis of microarray data indicates TRβ as a signaling node.

Figure 3

IPA software indicated a network involving THRB, circled. Genes marked with ^ represent those that were upregulated according to the microarray, those marked with # were downregulated. The intensity of the shading represents the significance of the p-value associated with change in expression.

Figure 4. qRT-PCR and Western blot analyses confirm possible involvement of TRβ signaling.

Figure 4

qRT-PCR experiments of Ar (A) and Ucp1 (B) in the R1a-TpoKO (KO) thyroids compared to wild-type (WT) thyroids (n=3). (C) Western blot analysis of Spot 14 (Thrsp) in wild type and R1a-TpoKO thyroids.

Primary cells cultured from R1a-TpoKO thyroids exhibit growth factor independence but require Stat3 signaling

In order to provide an in vitro model system for the study of signaling mechanisms, we established primary cultures of cells derived from R1a-TpoKO thyroid tumors. Upwards of 90% of cultured cells expressed Thyroglobulin at a level similar to FRTL5 cells through passage 15 (Supplementary Figure 1), confirming their ability to proliferate and retain thyroid differentiation in vitro. Because WT mouse thyroid cells do not proliferate in vitro, we used the well established FRTL5 rat thyroid cell line as a control for these studies (Ambesi-Impiombato et al., 1980).

Primary thyroid cultures typically require the inclusion of TSH and insulin in the medium as growth factors to enable cell proliferation. As shown in Figure 5A, removal of TSH, insulin, or both from the medium results in significant reduction of proliferation in FRTL5 cells when compared to cells grown in complete (6H) medium. In contrast, R1a-TpoKO cells retained their capacity to proliferate independent of the presence of these growth factors (Figure 5B). Expression of TSHR on both primary tumors and tumor cells grown in culture was validated (Supplementary Figure 1C) in order to confirm that this TSH-independent growth was not a consequence of loss of the receptor.

Figure 5. Cells derived from R1a-TpoKO thyroids show differing responses from normal thyroid cells in the absence of growth factors and presence of inhibitors.

Figure 5

(A) MTT assay of FRTL5 cells, treated with indicated media, were grown in complete medium (6H) or in medium lacking Insulin (5H- INS), TSH (5H –TSH), or both (4H). (B) R1a-TpoKO cells, treated as in A. (C) FRTL5 cells treated with the indicated inhibitors at the following concentrations: LY294002, 10 μM; U0126 10 μM; PKI, 5 μM; HO-3867, 1 μM, 3 μM, and 10 μM as indicated. (D) R1a-TpoKO cells, treated as in C. In A and B, *p<0.05 as compared to cells grown in 6H medium; in C and D, *p<0.05 as compared to vehicle treatment.

Next, we sought to assess the effects of pharmacologic inhibitors on cell proliferation. Based on the data shown above, we hypothesized that inhibition of the Akt or Mek/Erk pathways would not lead to growth inhibition, while inhibition of PKA or Stat3 would slow cell growth. Surprisingly, LY294002, an inhibitor of Akt, significantly reduced cell proliferation as compared to vehicle (Figure 5D). Conversely, myristoylated PKI, a cell permeable specific inhibitor of PKA, failed to reduce cell growth (Figure 5D). A novel Stat3 inhibitor, HO-3867 (Selvendiran et al., 2010) was able to significantly reduce cell proliferation at the highest dose. In order to compare our primary tumor cells to normal thyroid cells, we also examined the growth of FRTL5 cells in the presence of these inhibitors (Figure 5C). All of these inhibitors were able to inhibit growth of FRTL5 cells at the highest concentrations. Western blot analysis of pAkt, pErk, and pCREB, were performed to validate the inhibition of their intended targets (Supplementary Figure 2).

In order to confirm inhibition of cell growth by HO-3867 was due to Stat3 mediated effects, we first confirmed that treatment with HO-3867 reduces phosphorylation of Stat3 as shown in Figure 6A. Additionally, we performed quantitative real-time PCR analysis of known Stat3 target genes (Dauer et al., 2005). Figure 6B shows that of the four Stat3 target genes tested (C3, Bcl3, Nfil3, and Icam1), three were significantly downregulated after 48 hours of treatment with HO-3867 as compared to cells treated with vehicle. Together, these data confirm the inhibition of Stat3's transcriptional activity by HO-3867.

Figure 6. Treatment of R1a-TpoKO cells with a Stat3 inhibitor reduces expression of Stat3 target genes.

Figure 6

(A) Protein lysates from FRTL5 and R1a-TpoKO cells treated with the indicated inhibitors for 48 hours were probed with antibodies against pStat3 and Stat3 as indicated. (B) qRT-PCR experiments of C3, Bcl3, Nfil3, and Icam1 in R1a-TpoKO cells treated with HO-3867 compared to vehicle treatment. *p<0.0001 as compared to vehicle treatment.

DISCUSSION

As rates of thyroid cancer continue to rise, it remains relevant to identify new murine models which can lead to insights into the mechanisms of thyroid cancer formation as well as serve as pre-clinical drug testing models. In this study, we observed that thyroid-specific KO of Prkar1a leads to hyperthyroidism and thyroid cancer. R1a-TpoKO mice develop large tumors with 43% being classified as FTC (total n=23). Notably, no distant metastases were seen in any of our animals, suggesting that another genetic mutation may be necessary to elicit metastases in the context of Prkar1a mutation in the thyroid.

It is well known that TSH stimulates PKA activity via activation of adenylyl cyclase and the production of cAMP. Additionally, elevated levels of TSH are also known to be associated with the development of thyroid cancer in humans (Hargadine et al., 1970; Haymart et al., 2008). However, a mouse model of elevated TSH signaling in a genetically wild-type background does not develop thyroid cancer (Brewer et al., 2007). The reason behind this discrepancy between mice and humans remains to be determined, and PKA activity has not been directly examined in the previously mentioned model of elevated TSH. In contrast to elevated TSH levels leading to increased PKA signaling, our mice are hyperthyroid, exhibiting low levels of TSH along with activated PKA. These data suggest that TSH signaling may also activate alternate pathways which provide negative feedback on cell growth. This hypothesis may explain why mice with PKA activation develop FTC, while tumors driven by elevated TSH do not form cancers.

It is interesting to note that ablation of PRKAR1A/Prkar1a from the thyroid is the only genetic change described to date which produces FTC in both humans and mice. There have been other mouse lines made to generate FTC; however, none of these models mimics both the genetics and phenotypes seen in humans. PTEN mutations have been described in patients with FTC, but the mouse model harboring a deletion of Pten in the thyroid does not develop FTC, and instead exhibits thyroid hyperplasia (Yeager et al., 2007). We have also recapitulated this data in our lab (data not shown). A small number of FTC patients exhibit mutations in RAS (Niepomniszcze et al., 2006); however, mice expressing the oncogenic allele of Kras in the thyroid show no thyroid abnormalities up to one year of age (Miller et al., 2009). In contrast, mice harboring a Pten deletion as well as an oncogenic allele of Kras in the thyroid develop aggressive FTC and lung metastases (Miller et al., 2009), which supports our hypothesis that more than one genetic alteration may be necessary to elicit metastatic thyroid cancer. The mouse expressing a transgene of the PAX8-PPARγ fusion protein in the thyroid also fails to develop the FTC seen in patients harboring this genetic translocation (Diallo-Krou et al., 2009). Similar to the Kras mouse model, it has very recently been shown that mice harboring both the PAX8-PPARγ fusion protein as well as Pten deletion in the thyroid develop aggressive and metastatic FTC (Dobson et al., 2011), again indicating that multiple genetic hits are necessary for FTC progression to metastatic disease.

The only other previously published mouse model of FTC, which does develop aggressive FTC, harbors a mutation in Thrb known as the PV mutation (ThrbPV/PV) (Kato et al., 2004). However, mutations in THRB in human patients have, to date, only been seen in patients presenting with thyroid hormone resistance and not FTC (Rocha et al., 2007). Interestingly, ThrbPV/PV mice exhibit strikingly high levels of TSH. Thus, the possibility of PKA driving tumor formation in these animals cannot be ruled out. While the effects of TSH stimulation versus the effects of the Thrb mutation on thyrocyte proliferation in this model have been initially examined (Lu et al., 2011); it is still unclear what role the activation of PKA, if any, plays in this model.

Although THRB may not be a tumor suppressor gene in humans, our microarray data support the hypothesis that TRβ may play a role in tumorigenesis in the thyroid. IPA analyses of this data pointed to an altered signaling network involving TRβ (Figure 3). Interestingly, it has been shown that Spot14 and Ucp1 mRNA and protein as well as Androgen Receptor levels increase in a hyperthyroid state or after administration of thyroid hormone to hypothyroid mice and rats (Kinlaw et al., 1989; Lee et al., 2007; Martinez de Mena et al., 2010; Narayan and Towle, 1985). However, in our animals the levels of all three mRNAs and the levels of Spot14 protein dramatically decreased, converse to the expected increases in a hyperthyroid animal. Although the mechanisms of action still require more research, our data indicate that elevated PKA signaling may lead to alteration of TRβ's normal transcriptional activity which suggests that the importance of TRβ in FTC development may lie in modulation of its transcriptional activity by other molecules. While these hypotheses require further experimentation, we believe our data together suggest that PKA has effects on TRβ transcriptional function, which may shed light on how elevated TSH levels lead to FTC formation in humans.

The Ras/Raf/Mek/Erk and PI3K/Akt pathways have long been thought to be major players in the development of FTC (reviewed in (Brzezianska and Pastuszak-Lewandoska, 2011)), however our data suggests that this may not be the case, as we have shown FTC formation in the absence of activated Erk or Akt. This data is consistent with our previously published data in both mouse embryonic fibroblasts and Schwann cells which shows that cellular proliferation in the context of elevated PKA activity is independent of Erk and Akt (Jones et al., 2008; Nadella and Kirschner, 2005).

Surprisingly, inhibition of Akt proved to decrease in vitro proliferation of these cells. While this result seems contradictory to our in vivo data, Supplementary Figure 2 shows that once in culture, these cells do show activation of Akt and Erk, indicating an alteration in signaling compared to the in vivo tumors. While these results suggest that this culture system does not perfectly mimic the in vivo tumor conditions, these cells still provide a unique setting for studying the molecular mechanisms of FTC.

In contrast to Akt and Erk, Stat3 was shown to be highly activated in tumors as well as the cultured cells (Figure 2 and Supplementary Figure 2). Inhibition of Stat3 with HO-3867 did show a significant reduction in cell growth in these cells. Additionally, our quantitative real-time PCR data indicates this growth inhibition is mediated by effects on Stat3, as treatment of cells with HO-3867 leads to a reduction of mRNA levels of several Stat3 target genes (Figure 6). While the mRNA levels of Nfil3 were found to be slightly upregulated, this could be due to other regulatory elements on the promoter of this gene as Nfil3 has been shown to be sensitive to levels of insulin and subsequent Akt activation (Tong et al., 2010). As our in vitro data suggests that the tumor cells are dependent on Akt in culture, this may explain the lack of downregulation of Nfil3 upon treatment with HO-3867. While it is impossible to fully rule out off-target effects of this inhibitor, we believe that, together, our data suggest a possible role for Stat3 in the development of FTC in this mouse model.

Stat3 has been implicated in progression and metastases of papillary, anaplastic, and medullary thyroid cancer (Hwang et al., 2003; Kim et al., 2009; Plaza-Menacho et al., 2007; Trovato et al., 2003), but its implications in FTC are not well described. Trovato et al (2003) described activated STAT3 as only occurring in PTC and not any of a large set of FTC which was examined. To our knowledge, our mouse model is the only report of activated Stat3 in FTC. Recent work has also shown that nuclear Jak2 enhances the stability of activated CREB in the mouse and rat adrenal gland (Lefrancois-Martinez et al., 2011), suggesting that the JAK/STAT pathway may be linked to PKA in endocrine tissues.

Taken together, these data indicate that Prkar1a is indeed a tumor suppressor in the thyroid and that loss of this gene leads to hyperthyroidism and FTC. Our model is the first described model of FTC which is independent of Akt and develops FTC while engineered to harbor a single genetic alteration known to be associated with FTC in humans. In summary, we believe that this mouse is a novel and highly reproducible model of FTC which may help elucidate how the TSH/PKA signaling axis contributes to the development of thyroid cancer as well as suggesting new targets, such as Stat3, for the development of FTC therapies.

Supplementary Material

Supp Fig2
Supp Table 1
Supp Tables 2–4
SuppFig 1

ACKNOWLEDGMENTS

The authors would like to acknowledge Alan Flechtner, HTL(ASCP) of the Ohio State University College of Veterinary Medicine Comparative Pathology & Mouse Phenotyping Core for his help with processing, sectioning, and staining tissues for this study; Lisa Rawahneh, Ohio State University Comprehensive Cancer Center, for her assistance in sectioning and H/E staining. We also thank Motoyasu Saji, MD, PhD, Ohio State University, Division of Internal Medicine, for his valuable technical assistance in establishing primary thyroid cell cultures. Additionally, we would like to acknowledge Periannan Kuppusamy, PhD and Brian Rivera of the Davis Heart and Lung Research Institute, The Ohio State University for providing us with the HO-3867 compound.

FUNDING SUPPORT This work was supported in part by NIH grants: CA112268 (to LSK), PO1CA124570 (DRP, LY, DJ, KMDL, LSK) and CA16058 (to the OSU Comprehensive Cancer Center). DRP was supported by the Jeffrey J. Seilhamer Memorial Fellowship.

Footnotes

CONFLICTS OF INTEREST The authors declare no conflicts of interest.

REFERENCES

  1. Ambesi-Impiombato FS, Parks LA, Coon HG. Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci U S A. 1980;77:3455–3459. doi: 10.1073/pnas.77.6.3455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aschebrook-Kilfoy B, Ward MH, Sabra MM, Devesa SS. Thyroid Cancer Incidence Patterns in the United States by Histologic Type, 1992–2006. Thyroid. 2010 doi: 10.1089/thy.2010.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bertherat J, Horvath A, Groussin L, Grabar S, Boikos S, Cazabat L, Libe R, Rene-Corail F, Stergiopoulos S, Bourdeau I, et al. Mutations in regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A): phenotype analysis in 353 patients and 80 different genotypes. J Clin Endocrinol Metab. 2009;94:2085–2091. doi: 10.1210/jc.2008-2333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Besic N, Auersperg M, Golouh R. Prognostic factors in follicular carcinoma of the thyroid--a multivariate survival analysis. Eur J Surg Oncol. 1999;25:599–605. doi: 10.1053/ejso.1999.0714. [DOI] [PubMed] [Google Scholar]
  5. Brewer C, Yeager N, Di Cristofano A. Thyroid-stimulating hormone initiated proliferative signals converge in vivo on the mTOR kinase without activating AKT. Cancer Res. 2007;67:8002–8006. doi: 10.1158/0008-5472.CAN-07-2471. [DOI] [PubMed] [Google Scholar]
  6. Brzezianska E, Pastuszak-Lewandoska D. A minireview: the role of MAPK/ERK and PI3K/Akt pathways in thyroid follicular cell-derived neoplasm. Front Biosci. 2011;16:422–439. doi: 10.2741/3696. [DOI] [PubMed] [Google Scholar]
  7. Calvano SE, Xiao W, Richards DR, Felciano RM, Baker HV, Cho RJ, Chen RO, Brownstein BH, Cobb JP, Tschoeke SK, et al. A network-based analysis of systemic inflammation in humans. Nature. 2005;437:1032–1037. doi: 10.1038/nature03985. [DOI] [PubMed] [Google Scholar]
  8. Dauer DJ, Ferraro B, Song L, Yu B, Mora L, Buettner R, Enkemann S, Jove R, Haura EB. Stat3 regulates genes common to both wound healing and cancer. Oncogene. 2005;24:3397–3408. doi: 10.1038/sj.onc.1208469. [DOI] [PubMed] [Google Scholar]
  9. Diallo-Krou E, Yu J, Colby LA, Inoki K, Wilkinson JE, Thomas DG, Giordano TJ, Koenig RJ. Paired box gene 8-peroxisome proliferator-activated receptor-gamma fusion protein and loss of phosphatase and tensin homolog synergistically cause thyroid hyperplasia in transgenic mice. Endocrinology. 2009;150:5181–5190. doi: 10.1210/en.2009-0701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dobson ME, Diallo-Krou E, Grachtchouk V, Yu J, Colby LA, Wilkinson JE, Giordano TJ, Koenig RJ. Pioglitazone Induces a Proadipogenic Antitumor Response in Mice with PAX8-PPAR{gamma} Fusion Protein Thyroid Carcinoma. Endocrinology. 2011;152:4455–4465. doi: 10.1210/en.2011-1178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gordon A, Glazko G, Qiu X, Yakovlev A. Control of the Mean Number of False Discoveries, Bonferroni and Stability of Multiple Testing. Ann Appl Stat. 2007;1:179–190. [Google Scholar]
  12. Hargadine HR, Lowenstein JM, Greenspan FS. Elevated serum TSH in human thyroid cancer. Oncology. 1970;24:172–180. doi: 10.1159/000224517. [DOI] [PubMed] [Google Scholar]
  13. Haymart MR, Repplinger DJ, Leverson GE, Elson DF, Sippel RS, Jaume JC, Chen H. Higher serum thyroid stimulating hormone level in thyroid nodule patients is associated with greater risks of differentiated thyroid cancer and advanced tumor stage. J Clin Endocrinol Metab. 2008;93:809–814. doi: 10.1210/jc.2007-2215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hollander MC, Blumenthal GM, Dennis PA. PTEN loss in the continuum of common cancers, rare syndromes and mouse models. Nat Rev Cancer. 2011;11:289–301. doi: 10.1038/nrc3037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hwang JH, Kim DW, Suh JM, Kim H, Song JH, Hwang ES, Park KC, Chung HK, Kim JM, Lee TH, et al. Activation of signal transducer and activator of transcription 3 by oncogenic RET/PTC (rearranged in transformation/papillary thyroid carcinoma) tyrosine kinase: roles in specific gene regulation and cellular transformation. Mol Endocrinol. 2003;17:1155–1166. doi: 10.1210/me.2002-0401. [DOI] [PubMed] [Google Scholar]
  16. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003;4:249–264. doi: 10.1093/biostatistics/4.2.249. [DOI] [PubMed] [Google Scholar]
  17. Jeker LT, Hejazi M, Burek CL, Rose NR, Caturegli P. Mouse thyroid primary culture. Biochem Biophys Res Commun. 1999;257:511–515. doi: 10.1006/bbrc.1999.0468. [DOI] [PubMed] [Google Scholar]
  18. Jones GN, Pringle DR, Yin Z, Carlton MM, Powell KA, Weinstein MB, Toribio RE, La Perle KM, Kirschner LS. Neural crest-specific loss of Prkar1a causes perinatal lethality resulting from defects in intramembranous ossification. Mol Endocrinol. 2010;24:1559–1568. doi: 10.1210/me.2009-0439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jones GN, Tep C, Towns WH, 2nd, Mihai G, Tonks ID, Kay GF, Schmalbrock PM, Stemmer-Rachamimov AO, Yoon SO, Kirschner LS. Tissue-specific ablation of Prkar1a causes schwannomas by suppressing neurofibromatosis protein production. Neoplasia. 2008;10:1213–1221. doi: 10.1593/neo.08652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kato Y, Ying H, Willingham MC, Cheng SY. A tumor suppressor role for thyroid hormone beta receptor in a mouse model of thyroid carcinogenesis. Endocrinology. 2004;145:4430–4438. doi: 10.1210/en.2004-0612. [DOI] [PubMed] [Google Scholar]
  21. Kim TH, Lee SY, Rho JH, Jeong NY, Soung YH, Jo WS, Kang DY, Kim SH, Yoo YH. Mutant p53 (G199V) gains antiapoptotic function through signal transducer and activator of transcription 3 in anaplastic thyroid cancer cells. Mol Cancer Res. 2009;7:1645–1654. doi: 10.1158/1541-7786.MCR-09-0117. [DOI] [PubMed] [Google Scholar]
  22. Kinlaw WB, Ling NC, Oppenheimer JH. Identification of rat S14 protein and comparison of its regulation with that of mRNA S14 employing synthetic peptide antisera. J Biol Chem. 1989;264:19779–19783. [PubMed] [Google Scholar]
  23. Kirschner LS, Kusewitt DF, Matyakhina L, Towns WH, 2nd, Carney JA, Westphal H, Stratakis CA. A mouse model for the Carney complex tumor syndrome develops neoplasia in cyclic AMP-responsive tissues. Cancer Res. 2005;65:4506–4514. doi: 10.1158/0008-5472.CAN-05-0580. [DOI] [PubMed] [Google Scholar]
  24. Kirschner LS, Sandrini F, Monbo J, Lin JP, Carney JA, Stratakis CA. Genetic heterogeneity and spectrum of mutations of the PRKAR1A gene in patients with the carney complex. Hum Mol Genet. 2000;9:3037–3046. doi: 10.1093/hmg/9.20.3037. [DOI] [PubMed] [Google Scholar]
  25. Kusakabe T, Kawaguchi A, Kawaguchi R, Feigenbaum L, Kimura S. Thyrocyte-specific expression of Cre recombinase in transgenic mice. Genesis. 2004;39:212–216. doi: 10.1002/gene.20043. [DOI] [PubMed] [Google Scholar]
  26. Lacroix L, Lazar V, Michiels S, Ripoche H, Dessen P, Talbot M, Caillou B, Levillain JP, Schlumberger M, Bidart JM. Follicular thyroid tumors with the PAX8-PPARgamma1 rearrangement display characteristic genetic alterations. Am J Pathol. 2005;167:223–231. doi: 10.1016/s0002-9440(10)62967-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee E, Ahn MY, Kim HJ, Kim IY, Han SY, Kang TS, Hong JH, Park KL, Lee BM, Kim HS. Effect of di(n-butyl) phthalate on testicular oxidative damage and antioxidant enzymes in hyperthyroid rats. Environ Toxicol. 2007;22:245–255. doi: 10.1002/tox.20259. [DOI] [PubMed] [Google Scholar]
  28. Lefrancois-Martinez AM, Blondet-Trichard A, Binart N, Val P, Chambon C, Sahut-Barnola I, Pointud JC, Martinez A. Transcriptional control of adrenal steroidogenesis : novel connection between JAK2 and PKA through stabilization of transcription factor CREB. J Biol Chem. 2011 doi: 10.1074/jbc.M111.218016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lu C, Zhu X, Willingham MC, Cheng SY. Activation of tumor cell proliferation by thyroid hormone in a mouse model of follicular thyroid carcinoma. Oncogene. 2011 doi: 10.1038/onc.2011.390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Martinez de Mena R, Scanlan TS, Obregon MJ. The T3 receptor beta1 isoform regulates UCP1 and D2 deiodinase in rat brown adipocytes. Endocrinology. 2010;151:5074–5083. doi: 10.1210/en.2010-0533. [DOI] [PubMed] [Google Scholar]
  31. Miller KA, Yeager N, Baker K, Liao XH, Refetoff S, Di Cristofano A. Oncogenic Kras requires simultaneous PI3K signaling to induce ERK activation and transform thyroid epithelial cells in vivo. Cancer Res. 2009;69:3689–3694. doi: 10.1158/0008-5472.CAN-09-0024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nadella KS, Jones GN, Trimboli A, Stratakis CA, Leone G, Kirschner LS. Targeted deletion of Prkar1a reveals a role for protein kinase A in mesenchymal-to-epithelial transition. Cancer Res. 2008;68:2671–2677. doi: 10.1158/0008-5472.CAN-07-6002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nadella KS, Kirschner LS. Disruption of protein kinase a regulation causes immortalization and dysregulation of D-type cyclins. Cancer Res. 2005;65:10307–10315. doi: 10.1158/0008-5472.CAN-05-3183. [DOI] [PubMed] [Google Scholar]
  34. Nagy R, Ganapathi S, Comeras I, Peterson C, Orloff M, Porter K, Eng C, Ringel MD, Kloos RT. Frequency of germline PTEN mutations in differentiated thyroid cancer. Thyroid. 2011;21:505–510. doi: 10.1089/thy.2010.0365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Narayan P, Towle HC. Stabilization of a specific nuclear mRNA precursor by thyroid hormone. Mol Cell Biol. 1985;5:2642–2646. doi: 10.1128/mcb.5.10.2642-2646.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Niepomniszcze H, Suarez H, Pitoia F, Pignatta A, Danilowicz K, Manavela M, Elsner B, Bruno OD. Follicular carcinoma presenting as autonomous functioning thyroid nodule and containing an activating mutation of the TSH receptor (T620I) and a mutation of the Ki-RAS (G12C) genes. Thyroid. 2006;16:497–503. doi: 10.1089/thy.2006.16.497. [DOI] [PubMed] [Google Scholar]
  37. Nikiforov YE. Molecular diagnostics of thyroid tumors. Arch Pathol Lab Med. 2011;135:569–577. doi: 10.5858/2010-0664-RAIR.1. [DOI] [PubMed] [Google Scholar]
  38. Plaza-Menacho I, van der Sluis T, Hollema H, Gimm O, Buys CH, Magee AI, Isacke CM, Hofstra RM, Eggen BJ. Ras/ERK1/2-mediated STAT3 Ser727 phosphorylation by familial medullary thyroid carcinoma-associated RET mutants induces full activation of STAT3 and is required for c-fos promoter activation, cell mitogenicity, and transformation. J Biol Chem. 2007;282:6415–6424. doi: 10.1074/jbc.M608952200. [DOI] [PubMed] [Google Scholar]
  39. Rocha AS, Marques R, Bento I, Soares R, Magalhaes J, de Castro IV, Soares P. Thyroid hormone receptor beta mutations in the `hot-spot region' are rare events in thyroid carcinomas. J Endocrinol. 2007;192:83–86. doi: 10.1677/JOE-06-0009. [DOI] [PubMed] [Google Scholar]
  40. Sandrini F, Matyakhina L, Sarlis NJ, Kirschner LS, Farmakidis C, Gimm O, Stratakis CA. Regulatory subunit type I-alpha of protein kinase A (PRKAR1A): a tumor-suppressor gene for sporadic thyroid cancer. Genes Chromosomes Cancer. 2002;35:182–192. doi: 10.1002/gcc.10112. [DOI] [PubMed] [Google Scholar]
  41. Sartor MA, Tomlinson CR, Wesselkamper SC, Sivaganesan S, Leikauf GD, Medvedovic M. Intensity-based hierarchical Bayes method improves testing for differentially expressed genes in microarray experiments. BMC Bioinformatics. 2006;7:538. doi: 10.1186/1471-2105-7-538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Selvendiran K, Ahmed S, Dayton A, Kuppusamy ML, Tazi M, Bratasz A, Tong L, Rivera BK, Kalai T, Hideg K, Kuppusamy P. Safe and targeted anticancer efficacy of a novel class of antioxidant-conjugated difluorodiarylidenyl piperidones: differential cytotoxicity in healthy and cancer cells. Free Radic Biol Med. 2010;48:1228–1235. doi: 10.1016/j.freeradbiomed.2010.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Stratakis CA, Kirschner LS, Carney JA. Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab. 2001;86:4041–4046. doi: 10.1210/jcem.86.9.7903. [DOI] [PubMed] [Google Scholar]
  44. Tong X, Muchnik M, Chen Z, Patel M, Wu N, Joshi S, Rui L, Lazar MA, Yin L. Transcriptional repressor E4-binding protein 4 (E4BP4) regulates metabolic hormone fibroblast growth factor 21 (FGF21) during circadian cycles and feeding. J Biol Chem. 2010;285:36401–36409. doi: 10.1074/jbc.M110.172866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Trovato M, Grosso M, Vitarelli E, Ruggeri RM, Alesci S, Trimarchi F, Barresi G, Benvenga S. Distinctive expression of STAT3 in papillary thyroid carcinomas and a subset of follicular adenomas. Histol Histopathol. 2003;18:393–399. doi: 10.14670/HH-18.393. [DOI] [PubMed] [Google Scholar]
  46. Yeager N, Klein-Szanto A, Kimura S, Di Cristofano A. Pten loss in the mouse thyroid causes goiter and follicular adenomas: insights into thyroid function and Cowden disease pathogenesis. Cancer Res. 2007;67:959–966. doi: 10.1158/0008-5472.CAN-06-3524. [DOI] [PubMed] [Google Scholar]
  47. Yin Z, Jones GN, Towns WH, 2nd, Zhang X, Abel ED, Binkley PF, Jarjoura D, Kirschner LS. Heart-specific ablation of Prkar1a causes failure of heart development and myxomagenesis. Circulation. 2008a;117:1414–1422. doi: 10.1161/CIRCULATIONAHA.107.759233. [DOI] [PubMed] [Google Scholar]
  48. Yin Z, Williams-Simons L, Parlow AF, Asa S, Kirschner LS. Pituitary-specific knockout of the Carney complex gene Prkar1a leads to pituitary tumorigenesis. Mol Endocrinol. 2008b;22:380–387. doi: 10.1210/me.2006-0428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yu LB, Gulati P, Fernandez S, Pennell M, Kirschner L, Jarjoura D. Fully Moderated T-statistic for Small Sample Size Gene Expression Arrays. Stat Appl Genet Mol. 2011;10 doi: 10.2202/1544-6115.1701. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig2
Supp Table 1
Supp Tables 2–4
SuppFig 1

RESOURCES