Motility Is Crucial for the Infectious Life Cycle of Borrelia burgdorferi

Abstract

The Lyme disease spirochete, Borrelia burgdorferi, exists in a zoonotic cycle involving an arthropod tick and mammalian host. Dissemination of the organism within and between these hosts depends upon the spirochete's ability to traverse through complex tissues. Additionally, the spirochete outruns the host immune cells while migrating through the dermis, suggesting the importance of B. burgdorferi motility in evading host clearance. B. burgdorferi's periplasmic flagellar filaments are composed primarily of a major protein, FlaB, and minor protein, FlaA. By constructing a flaB mutant that is nonmotile, we investigated for the first time the absolute requirement for motility in the mouse-tick life cycle of B. burgdorferi. We found that whereas wild-type cells are motile and have a flat-wave morphology, mutant cells were nonmotile and rod shaped. These mutants were unable to establish infection in C3H/HeN mice via either needle injection or tick bite. In addition, these mutants had decreased viability in fed ticks. Our studies provide substantial evidence that the periplasmic flagella, and consequently motility, are critical not only for optimal survival in ticks but also for infection of the mammalian host by the arthropod tick vector.

INTRODUCTION

Lyme disease is a widespread, systemic disease caused by the spirochete Borrelia burgdorferi, which is transmitted to humans by Ixodes ticks. In nature, B. burgdorferi cycles predominantly between the two physiologically distinct environments represented by the arthropod tick vector and a small rodent host (1–4). To transit from an infected tick to the mammal, B. burgdorferi organisms must migrate through complex and dense tissues to reach the salivary glands, where they are transmitted during tick feeding. In the feeding tick, a fraction of spirochetes colonizing the tick exit the midgut by traversing a layer of epithelial cells and a basement membrane (4, 5). The organisms then migrate out of the midgut into the hemocoel as they navigate toward the salivary glands. Subsequently, spirochetes in the saliva are inoculated into the dermis of its mammalian host. B. burgdorferi spirochetes in the skin cross through the extracellular matrix for hematogenous dissemination to their colonization sites to cause disease (4–7). After residing in the vertebrate host for weeks to years, spirochetes in the skin infect naive feeding ticks to complete the cycle.

Motility and chemotaxis are likely to be important for the colonization as well as dissemination of B. burgdorferi within and between its arthropod vector and mammalian hosts. The fliG1 periplasmic flagellar motor mutant, which shows aberrant swim behavior, is attenuated in mice by needle inoculation (8). In addition, a chemotaxis-deficient cheA2 mutant that exhibits altered motility has recently been shown to be unable to infect mice. Although cheA2 mutant spirochetes survive normally in ticks, those arthropods failed to transmit the spirochetes to naive mice (9). Furthermore, intravital microscopy of needle-injected B. burgdorferi in live mice suggest that the cells' “back-and-forth” movement is important in transendothelial migration (10, 11) as well as for efficiently maneuvering around complex structures in skin tissues. In fact, a recent report demonstrated that B. burgdorferi predominantly exhibits translational back-and-forth motility, as determined by tracking fluorescently labeled spirochetes in mice that were fed upon by ticks (12). Moreover, B. burgdorferi dissemination in murine skin confirms that spirochetal motility allows efficient travel within the dermis and can achieve velocities that are 10 to 100 times faster than any recorded for host immune cell in those tissues, thus promoting evasion of the cellular immune responses (13–17; R. M. Wooten, personal communication).

The Lyme disease spirochete exhibits unique modes of motility and possesses characteristic flat-wave morphology (18). Experimental evidence indicates that there are 7 to 11 periplasmic flagella attached near each pole of the cell cylinder. The flagella that reside between the outer membrane and cell cylinder form an elegant ribbon in the periplasmic space as they wrap around the cell cylinder (18–24). A single periplasmic flagellum is composed of a motor (FliF and many other proteins), hook (FlgE), and filament (FlaB and FlaA) (25–27). B. burgdorferi flagellar filaments consist of a major FlaB and a minor FlaA protein comprising 10 to 14% and less than 0.5% of total cellular protein, respectively (28, 29). FlaB is similar in sequence to flagellar proteins of other bacteria. In other species of spirochetes, there are 1 to 3 different FlaB proteins that form the core of the filament, and 1 or 2 different FlaA proteins correspond to the filament sheath (20, 30–32). flaB mutants have been characterized in Brachyspira hyodysenteriae and Leptospira biflexa. These mutants exhibit aflagellated, decreased, or nonmotile phenotypes (30, 33–38). FlaA homologs are unique to the spirochetes, and the protein is involved in the helical configuration of the periplasmic flagella of B. hyodysenteriae (30, 33, 39). In B. burgdorferi, the relatively small amount of FlaA localizes proximal to the hook and forms a sheath around the FlaB core in that region (29; S. Satoshi, M. Motaleb, S. Aizawa, and N. W. Charon, unpublished data). Site-directed mutagenesis of flaA in B. burgdorferi and other spirochetes resulted in cells that still retain periplasmic flagella and are motile, but their motility is decreased compared to that of wild-type cells (30, 33, 39; M. A. Motaleb and N. W. Charon, unpublished data). In several species of pathogenic bacteria, the requirements for motility and chemotaxis vary from being essential to being expendable for infection (34, 40–44). Among spirochetes, mutants that have altered motility or chemotaxis were reported to be attenuated in virulence in their respective hosts (8, 9, 32, 35, 45, 46).

In this study, we demonstrated the absolute requirement for motility by B. burgdorferi in its experimental tick-mouse life cycle by inactivating the major periplasmic flagellar filament encoded by flaB. Specifically, we examined the ability of flaB mutant spirochetes to survive in both mice and ticks and their potential to be transmitted from the tick to the mammalian host. Our previous work with a flaB mutant in a noninfectious, high-passage strain served as a foundation for these experiments. We previously found that this mutant lacked periplasmic flagella, was nonmotile, and was rod shaped (47, 48). Here we show that the periplasmic flagella and, in turn, motility are crucial for the fitness of B. burgdorferi for optimal survival in the tick vector. Additionally, our studies substantially point toward motility being vital for transmission to, and infection of, the mammalian host. A mechanism of spatiotemporal regulation of motility is discussed.

MATERIALS AND METHODS

Ethics statement.

East Carolina University and the Rocky Mountain Laboratories (RML) of the National Institutes of Health are accredited by the International Association for Assessment and Accreditation of Laboratory Animal Care. Protocols for tick and animal experimentations were approved by the East Carolina University and RML institutional animal care and use committees.

Bacterial strains and growth conditions.

Low-passage, virulent B. burgdorferi strain B31-A3 was used as a wild-type clone throughout the study (49). The genome of the virulent B31 strain has been sequenced and was found to contain a total of 21 plasmids, with 12 linear and 9 circular plasmids, in addition to its 960-kbp linear chromosome (50, 51). Clone B31-A3 lacks circular plasmid 9 (cp9) and remains infectious in tick-mouse cycle studies (49, 52). Constructions of two independent flaB mutants and their complemented strains are described below. B. burgdorferi cells were cultured in liquid Barbour-Stoenner-Kelly (BSK-II) medium, and plating BSK was prepared using 0.6% agarose (53, 54). Cells were grown at 35°C in a 2.5% CO₂ incubator as described previously (49, 53).

Construction and complementation of the flaB mutant.

Construction of the flaB inactivation plasmids, electroporation, and plating conditions were described previously (47). Briefly, the flaB gene (gene locus bb0147; 1,011 bp) and adjacent flanking DNA were PCR amplified and cloned into the pGEM-T Easy vector (Promega Inc.). A kanamycin resistance cassette (P_flgB-kan) (55) containing two engineered AgeI sites at the 5′ and 3′ ends was also cloned, followed by restriction digestion and insertion into a unique AgeI site within the flaB gene (47). Competent B31-A3 cells were electroporated with flaB-P_flgB-kan DNA that was linearized by restriction digestion to remove the ampicillin resistance marker of the vector, preventing it from being introduced into B. burgdorferi (47). The transformants were selected with 200 μg/ml of kanamycin. Two independent, kanamycin-resistant transformants from two different electroporations were isolated and confirmed to have the P_flgB-kan cassette integrated within the flaB gene by PCR, as described previously (47), as well as by immunoblotting (see below). These two independently isolated flaB mutants are referred to as ΔflaB#4 and ΔflaB#6. Linear and circular plasmid contents of B. burgdorferi transformants were confirmed by PCR using primers described previously (49, 56, 57).

To complement the flaB mutation, the flaB gene with its promoter (P_flaB-flaB) was PCR amplified from genomic DNA using primers (5′-3′) flaB/com-F (GGATCCTGTCTGTCGCCTCTTGTG) and flaB/com-R (GCATGCTTATCTAAGCAATGACAA) with engineered BamHI and SphI sites, respectively (restriction sites are shown in bold). The amplified DNA was cloned into the pGEM-T Easy vector, yielding plasmid pFlaB.com-Easy. This and the B. burgdorferi shuttle vector pBSV2G (58) were digested with BamHI-SphI and ligated to yield pBSV2G-FlaB.com. Approximately 25 μg of the pBSV2G-FlaB.com DNA with or without CpG methylase M.SssI treatment (59) was electroporated into the ΔflaB cells. Potential transformants were selected with 200 μg/ml of kanamycin plus 40 μg/ml of gentamicin. Resistant transformants were analyzed by PCR for the presence of kan and aaC1. The shuttle vector rescued from complemented flaB⁺ cells and purified from Escherichia coli was used to confirm the integrity of P_flaB-flaB. B. burgdorferi endogenous plasmids were detected using PCR as described previously (49, 56, 57). All flaB⁺ clones lost linear plasmid lp25, which was then reintroduced by electroporation using a selectable copy of lp25 that confers resistance to streptomycin (bbe02::P_flgB-aadA) as described previously (60–62). The complemented flaB⁺ was constructed in the ΔflaB#6 mutant background. Only clones that retained all 20 B. burgdorferi plasmids detected in the wild type were used for successive studies.

SDS-PAGE and immunoblot analyses.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting with an enhanced chemiluminescent detection method (GE Health Inc.) were carried out as reported previously (47). The concentration of protein in cell lysates was determined by a Bio-Rad protein assay kit. Unless otherwise noted, 5 μg of lysate protein was subjected to SDS-PAGE and immunoblotting using specific antibodies. Monoclonal antibodies kindly provided by other investigators included the following: anti-FlaB (H9724) by A. Barbour (University of California, Irvine, CA), anti-DnaK by J. Benach (State University of New York [SUNY], Stony Brook, NY), and polyclonal anti-CheA by R. Silversmith (University of North Carolina [UNC], Chapel Hill, NC). The specific reactivities of these antibodies with B. burgdorferi FlaB, FlaA, CheA2, and DnaK have been demonstrated previously (23, 29, 47, 63).

Dark-field microscopy and swarm plate motility assays.

Growing B. burgdorferi clones were imaged using a dark-field microscope (Zeiss Imager M1) connected to a digital camera to determine morphology. Swarm plate motility assays were performed as described previously (47, 53, 64). Approximately 1 × 10⁶ cells in a 5-μl volume were spotted into 0.35% agarose plates containing BSK medium diluted in 1:10 in Dulbecco's phosphate-buffered saline. Since B. burgdorferi is a slow-growing organism, with a 5- to 12-h generation time (see below) (65), swarm plates were incubated for 5 days; swarming images were documented using a digital camera (64).

Mouse and tick-mouse infection studies.

Mouse and tick-mouse infection studies were performed as described previously (66–68). Briefly, Mus musculus C3H/HeN mice and a genetically heterogeneous rodent population from an outbred colony of Swiss-Webster mice maintained at RML called the “RML mice” were used for mouse infectious studies as described previously (49, 69). For infection via needle, either 5 × 10³ or 1 × 10⁹ in vitro-grown spirochetes were injected subcutaneously (s.c.) or via tail vein (C3H/HeN mice) or subcutaneously and intraperitoneally (i.p.) (RML mice) as described previously (49, 70). The number of spirochetes was determined using a Petroff-Hausser chamber and verified by CFU counts in semisolid BSK medium. For either inoculation scheme, mice were bled (retro-orbital) 2 weeks postinfection for immunoblot analysis of mouse sera; reisolation of B. burgdorferi from mouse skin, bladder, and joint tissues was performed 3 to 4 weeks postinfection. Mouse tissues in the BSK-II growth medium were incubated for up to 35 days, and the presence of spirochetes was determined by dark-field microscopy (49, 66, 67).

For tick infection studies, naive Ixodes scapularis larvae were purchased from Oklahoma State University. Naive larvae were artificially inoculated by immersion in equal-density, exponential-phase (5 × 10⁷ cells/ml) cultures from B. burgdorferi clones, as described previously (68, 69, 71). Ticks were subsequently fed to repletion on separate naive mice (2 or 3 mice per bacterial strain; ∼200 larvae/mouse) for 5 to 7 days and collected once they dropped off the mice. Mouse sera obtained 2 weeks after tick feeding were tested against B. burgdorferi lysates to determine infectivity, as described previously (49, 65, 72). Reisolation of spirochetes from mouse ears, joints, and bladders was performed 3 weeks postrepletion (49, 66, 69) to assess the ability of spirochetes to infect mice by tick bite. Subsets of larvae were dissected individually 7 days after repletion, and the isolated midguts were analyzed by immunofluorescence assay (IFA; see below) for the presence of spirochetes (69). A second group of fed larvae was surface sterilized using 3% H₂O₂ followed by 70% ethanol, crushed individually in BSK-II medium, and plated to determine the CFU per tick. Seven days after drop-off, a third subset of fed larvae was crushed individually and genomic DNA was extracted using a DNeasy blood and tissue kit (Qiagen Inc.) according to the manufacturer's instructions. Spirochete burdens in infected ticks were assessed by quantitative PCR (qPCR) to detect the B. burgdorferi enolase gene with specific primers as described previously (56, 73, 74). Copies of the B. burgdorferi enolase gene per tick were determined from a standard curve generated using a known amount of plasmid DNA containing the enolase gene as the template. Statistical analyses were performed using Student's t test to calculate the significance of the normalized values between wild-type and mutant samples. A P value of 0.05 between samples was considered significant. A fourth subset of fed larvae was allowed to molt. Two to 3 weeks after the molt, nymphal ticks (10 or 30 ticks/mouse; 2 or 3 mice/strain/assay) were allowed to feed to repletion on naive mice for 3 to 5 days. Seven days after drop-off, replete ticks were individually crushed to determine spirochete burden per tick using solid-phase plating as well as qPCR. Mice that were fed upon by nymphs were sacrificed 3 weeks postrepletion and evaluated for the transmission of spirochetes as described above.

Assessment of spirochete transmission to mice by encapsulated nymphs.

Naive nymphal ticks were experimentally infected with B. burgdorferi clones by immersion as described above. Mice were anesthetized and groups of 10 to 30 immersed nymphs were confined to capsules affixed to the shaved backs of naive C3H/HeN mice (3 mice per strain; 10 nymphs/mouse for the wild type or 30 nymphs/mouse for the ΔflaB mutant) (75, 76). The ticks were allowed to feed until repletion (3 to 5 days) and then collected from the capsules. At 7 days postrepletion, ticks were crushed individually, and spirochete burdens were determined by solid-phase plating and qPCR as described above. Mice were euthanized 72 h postrepletion, and the tick bite sites were extensively washed with sterile distilled water (dH₂O) to remove tick excreta. A 2-cm by 2-cm section of skin encompassing the feeding site was excised and was cut into equal portions, rinsed in 70% isopropanol, and cultured in BSK-II medium for up to 35 days. In addition, the bite site skin or a control site (neck skin) was processed for PCR to detect B. burgdorferi DNA using enolase gene-specific primers (56). Complemented flaB⁺ encapsulated nymphs were similarly processed except that the mice were sacrificed at drop-off or 3 weeks after the ticks fell off the mice.

IFAs.

Ticks were dissected in 30 μl of phosphate-buffered saline (PBS)-5 mM MgCl₂ on Teflon-coated microscopic slides, mixed by pipetting, and then air dried. To avoid quenching by hemin in the blood, dissected tick contents were 10-fold serially diluted (57, 68). Slides were blocked with 0.75% bovine serum albumin (BSA) in PBS-5 mM MgCl₂ for 30 min and then washed twice with PBS-5 mM MgCl₂. Spirochetes were detected using a 1:100 dilution of goat anti-B. burgdorferi antisera labeled with fluorescein isothiocyanate (Kirkegaard & Perry Laboratories, Inc.). Images were captured using a Zeiss Axio Imager M1 microscope connected to a digital camera.

RESULTS

Construction of flaB mutant and complementation in trans.

Genome sequence and transcriptional analyses indicate that the flaB gene is located on the large linear chromosome (locus number bb0147) and is transcribed as a monocistronic mRNA (50, 77, 78). Gene promoter analysis indicated that flaB transcription is driven by a σ⁷⁰ promoter and is expressed constitutively throughout the organism's life cycle (79–81). To investigate the role of flaB during infection of the mouse or transmission from the tick to the mouse, we inactivated the gene in the low-passage, infectious B. burgdorferi clone B31-A3 (Fig. 1A). Two independent kanamycin-resistant flaB mutant strains were constructed in the B31-A3 background, and they are referred to as ΔflaB#4 and ΔflaB#6. PCR analysis indicated that P_flgB-kan was inserted in the flaB gene (data not shown), and immunoblots confirmed that the FlaB protein was not present in the mutants (Fig. 2). Because flaB is monocistronic, the possibility of a polar effect on downstream genes is unlikely. Note that FlaA protein synthesis is also inhibited in the mutant cells, although other proteins encoded within the same operon as FlaA (Fig. 1A), such as CheA2, are not (Fig. 2). As previously observed, FlaA and FlaB synthesis, though not genetically linked, appears to be posttranscriptionally controlled (26, 29).

Fig 1.

Construction of flaB mutant and complemented strains. (A) Inactivation of flaB using the P_flgB-kan cassette is described elsewhere (47, 55). Wild-type B. burgdorferi with the monocistronic flaB gene and polycistronic flaA operon (complete operon, flaA-cheA2-cheW3-cheX-cheY3) is shown, with the NCBI nucleotide coordinates at the top. The flaB target gene is separated from adjacent fliD and bb0146 genes by 127 bp and 154 bp, respectively. The P_flgB-kan cassette containing two AgeI sites was inserted within a unique AgeI restriction site in flaB to inactivate the gene by allelic exchange (47). (B) Construction and complementation of flaB::P_flgB-kan (ΔflaB) cells in trans using shuttle vector pBSV2G are described in Materials and Methods. Arrows indicate the direction of transcription. DNAs and plasmids are not drawn to scale.

Fig 2.

Immunoblot analysis of B. burgdorferi strains (5 μg in each lane) probed with a monoclonal anti-FlaB antibody. A single 41-kDa band is seen in the wild-type cells but is missing from the ΔflaB cells, indicative of the loss of FlaB protein synthesis in the mutant cells. The FlaB protein is restored to the wild-type level in the complemented flaB⁺ strain. A mutation in flaB affects FlaA synthesis but not other motility or chemotaxis gene products (CheA2) located in the same operon as flaA (Fig. 1A), as reported previously (29). DnaK (2 μg of lysate) was used as a loading control. Only data for the ΔflaB#6 mutant are shown, as the two independently isolated ΔflaB mutants (ΔflaB#4 and ΔflaB#6) exhibited the same phenotype.

We complemented both flaB mutants using the shuttle vector pBSV2G (58), containing an intact flaB gene that is transcribed from its native promoter (Fig. 1B). Immunoblot analysis indicated that the complemented flaB (flaB⁺) cells restored the synthesis of FlaB protein to the wild-type level (Fig. 2). However, endogenous plasmid profiling by PCR indicated that the complemented flaB⁺ clones harbored all plasmids seen in the wild type except linear plasmid lp25 (data not shown). Four independent attempts to isolate a complemented flaB⁺ clone retaining lp25 were unsuccessful. Since lp25 is critical for infection (61, 82–84), we reintroduced a selectable copy of lp25 into those flaB⁺ cells, as described previously (60, 61). The newly isolated flaB⁺ cells (constructed in ΔflaB#6) that retained a selectable copy of lp25 restored the in vitro phenotypes exhibited by the flaB mutant cells (see below), indicating that the phenotype of the mutant cells was not due to a secondary mutation.

In vitro phenotype of the ΔflaB mutants.

We analyzed the flaB mutants with respect to morphology and motility phenotypes using dark-field microscopy and swarm plate motility assays. Dark-field microscopic analysis indicated that whereas the wild-type and the complemented flaB⁺ cells had a flat-wave morphology, the flaB mutants (ΔflaB#4 and ΔflaB#6) were distinct in that they had a rod-shaped morphology (Fig. 3A). Additionally, the mutants were nonmotile, whereas the wild-type and the complemented cells were motile. In swarm plate assays, the mutants' swarm diameters were smaller than those of the wild-type cells, confirming a defect in motility (Fig. 3B). As expected, the complemented flaB⁺ cells exhibited the wild-type pattern of motility, and in swarm plate assays, wild-type diameters were observed with the complemented flaB⁺ cells (Fig. 3B). Together, these and our previous results indicate that flaB is essential for B. burgdorferi motility and influences the spirochete's flat-wave morphology (47, 48, 85).

Fig 3.

(A) Dark-field microscopic images showing the distinct rod-shaped morphology of ΔflaB spirochetes. The flat-wave morphology seen in the wild-type cells was restored when the ΔflaB was complemented in trans (flaB⁺). (B) Swarm plate motility assays indicate a defect in motility exhibited by the ΔflaB mutants. Late-logarithmic-phase B. burgdorferi cells from indicated strains were spotted into 0.3% soft-agarose plates and incubated for 5 days. The swarm diameter of each clone is measured in millimeters. Only data for the ΔflaB#6 mutant are shown, as the two independently isolated ΔflaB mutants exhibited the same phenotype.

B. burgdorferi ΔflaB mutants are unable to survive in mice by needle inoculation.

To evaluate the ability of the flaB mutants to establish infection in a mammalian host, C3H/HeN mice were needle inoculated by subcutaneous (s.c.) injection with 5 × 10³ wild-type, ΔflaB (ΔflaB#4 and ΔflaB#6), or isogenic complemented flaB⁺ cells. These strains retained their full plasmid profile as confirmed by PCR immediately prior to injection (data not shown) (49, 56, 57). Two weeks postinoculation, the mice were bled, and the sera were assessed for reactivity with B. burgdorferi antigens. B. burgdorferi membrane protein A (BmpA), also known as P39, was used as a marker for infection in animals (70, 72). None of the 5 mice inoculated with ΔflaB mutants showed evidence of seroconversion, while 5 out of 5 mice infected with wild-type spirochetes did seroconvert (data not shown; see Table 1). Furthermore, intravenous (i.v.) inoculation of 5 × 10³ cells into the tail veins of mice resulted in seroconversion with wild-type cells but not with ΔflaB#4 or ΔflaB#6 cells (Table 1). To confirm the serological results, mice were sacrificed 4 weeks postinoculation and tissue samples (ear, joint, and bladder) were aseptically isolated and assessed for the presence of B. burgdorferi (Table 1). Whereas wild-type cells were reisolated from all tissues, demonstrating that these cells had established an infection, the flaB mutants (ΔflaB#4 and ΔflaB#6) were not isolated from any tissues (Table 1). The complemented flaB⁺ cells were not able to establish infection in mice at this dose; however, at a higher inoculum (1 × 10⁶ cells), flaB⁺ cells were reisolated from all tissue samples (Table 1). Since complementation did not fully restore a wild-type phenotype, and naive mice fed upon by flaB⁺-immersed ticks did not become infected (see below for nymphal immersion and Table S1 and Fig. S1 in the supplemental material), we did not include the complemented strain in subsequent in vivo studies but continued our analyses with the two independently isolated flaB mutants (ΔflaB#4 and ΔflaB#6).

Table 1.

ΔflaB mutants are unable to establish infection in mice by needle inoculation^a

Mode of inoculation and relevant genotype	Inoculum	No. of mice positive by serology/no. tested	No. of tissues positive/no. examined			No. of mice infected/no. tested
			Ear	Bladder	Joint
Subcutaneous injection
WT	5 × 103	5/5	5/5	5/5	5/5	5/5
ΔflaB#4	5 × 103	0/5	0/5	0/5	0/5	0/5
ΔflaB#6	5 × 103	0/5	0/5	0/5	0/5	0/5
Complemented flaB+	5 × 103	0/5	0/5	0/5	0/5	0/5
Complemented flaB+	1 × 106	Not done	5/5	5/5	5/5	5/5
WT	1 × 109	4/4	4/4	4/4	4/4	4/4
ΔflaB#4	1 × 109	4/4	0/4	0/4	0/4	0/4
ΔflaB#6	1 × 109	4/4	0/4	0/4	0/4	0/4
Tail vein injection
WT	5 × 103	4/4	3/4	4/4	4/4	4/4
ΔflaB#4	5 × 103	4/4	0/4	0/4	0/4	0/4
ΔflaB#6	5 × 103	4/4	0/4	0/4	0/4	0/4

^aC3H/HeN mice were injected subcutaneously or via tail vein. Infectivity results with RML mice (5 × 10³ spirochetes/mouse; 4 mice per strain) were the same as for the C3H/HeN mice but are not included. RML mice were injected via subcutaneous and intraperitoneal routes. Infectivity was determined by reisolation of B. burgdorferi from tissue samples from sacrificed mice. WT, wild type.

Mice were next inoculated with 1 × 10⁹ cells per mouse, a very high inoculum (Table 1). Although inoculation with this high dose resulted in seroconversion in all mice, wild-type, but not ΔflaB, cells were able to establish an infection (Table 1), suggesting that seroconversion resulted from immunization, as the flaB mutant spirochetes were cleared by the host immune response. Taken together, these results indicate that flaB is necessary for B. burgdorferi to survive in the mouse, regardless of the route of inoculation (s.c., i.p., or i.v.).

B. burgdorferi flaB mutants are unable to infect mice by tick bite.

The B. burgdorferi infectious life cycle includes persistent infection of and survival within tick and mammalian hosts. Because flaB mutants were unable to establish infection in mice by needle inoculation, it was not possible to assess the ability of these bacteria to infect naive ticks by natural acquisition via feeding on infected mice. Therefore, Ixodes scapularis tick larvae were artificially inoculated by immersion with wild-type, ΔflaB#4, or ΔflaB#6 cells. Tick immersion studies (57, 68, 69, 86) allow for direct artificial tick infection and serve two purposes: (i) to optimally infect naive ticks with the wild-type or mutant spirochetes and determine their colonization and survivability within the tick vector and (ii) to examine the spirochete's potential to migrate from the midgut to the salivary glands of the arthropod vector and be transmitted to the mammalian host. The immersed larval ticks were allowed to feed to repletion on naive mice, and 7 days later, tick midguts were examined for the presence of spirochetes by indirect immunofluorescence assays (IFAs). As shown in Fig. S2 in the supplemental material, both the wild type and the ΔflaB mutants were detected in the ticks. Furthermore, spirochete loads in fed ticks were determined using qPCR as well as by plating on B. burgdorferi growth plates to determine viable CFU per tick (Table 2 and Fig. 4). We found that the number of viable mutant spirochetes was significantly lower than the number of wild-type spirochetes, as confirmed by both methods (Table 2 and Fig. 4). While wild-type spirochetes were transmitted by feeding ticks and infected naive mice, no mutant bacteria from the ΔflaB-immersed ticks were recovered from the tissues of any mice (n = 5) on which these ticks had fed (Table 2).

Table 2.

Larval ticks artificially infected with ΔflaB mutants do not transmit the spirochetes to naive mice

B. burgdorferi clone in larval ticks	No. of mice infected/no. challengeda	No. of viable spirochetes per fed larvab
Wild type	5/5	14,792 ± 6,033c
ΔflaB#4 mutant	0/5	811 ± 798
ΔflaB#6 mutant	0/5	1,920 ± 1,893

^aApproximately 200 artificially infected larvae were allowed to feed per C3H/HeN mouse. Mouse infectivity was determined by reisolation of B. burgdorferi from tissues from sacrificed mice.

^bSpirochete burden was determined 7 days postrepletion by crushing individual ticks, plating, and counting CFU (average ± standard error of the mean; 4 or 5 positive ticks/strain). Results shown are representative of two independent assays.

^cP = 0.029 (calculated by Student's t test) for wild-type to ΔflaB spirochete burden in the tick.

Fig 4.

ΔflaB spirochete burdens are significantly lower than wild-type (WT) burdens in fed larvae. Quantitative PCR was used to measure B. burgdorferi (Bb) loads in fed larvae 7 days after repletion. Copies of the B. burgdorferi enolase gene were determined from a standard curve generated using the known amount of enolase template. Representative data of two independent studies are shown. Bars represent the mean enolase copies per larva ± the standard error of the mean for each isolate (4 positive ticks per strain). The asterisk indicates significantly (P < 0.01) lower values for ΔflaB#4 (or ΔflaB#6) mutant-infected ticks than for the corresponding wild-type parent.

To determine if nymphal ticks can transmit the mutant spirochetes, a portion of the fed larvae were allowed to molt into nymphs. Two weeks after the molt, nymphal ticks were allowed to feed on naive mice. Seven days postrepletion, we found that the spirochete burden in the ΔflaB#4 or ΔflaB#6 strain-infected ticks was significantly lower than in the wild-type-infected ticks (Table 3 and Fig. 5) as determined by solid-phase plating and qPCR. Moreover, when the ΔflaB strain-infected nymphs fed on naive mice, none of the mice became infected, whereas all naive mice were infected by nymphs containing wild-type spirochetes (Table 3). Additionally, we failed to detect borrelial DNA by PCR in any skin tissues of mice that were fed upon by the ΔflaB mutant-infected ticks, whereas tissues of mice fed upon by ticks infected with the wild type were readily detectable (data not shown). The failure of the ΔflaB mutant-infected ticks to transmit the spirochetes to naive mice was not due to the number of nymphal ticks allowed to feed on mice. Even though the percentages of spirochete-infected ticks were comparable between the wild type and the mutants (78% for the wild type versus 60% for the ΔflaB#4 mutant and 81% for the ΔflaB#6 mutant), the spirochete burden was lower in the mutant-infected ticks; thus, 30 ΔflaB#4 or ΔflaB#6 mutant-infected nymphs were allowed to feed on a naive mouse versus only 10 nymphs for the wild type. Together, these results indicate that B. burgdorferi FlaB, and by extension motility, is a decisive factor for optimal viability in ticks as well as for establishing infection in mice by tick bite.

Table 3.

ΔflaB mutant-infected nymphal ticks do not transmit the organism to naive mice

B. burgdorferi clone in nymphal ticks	No. of mice infected/no. challengeda	No. of viable spirochetes per fed nymphb
Wild type	4/4	43,167 ± 4,527c
ΔflaB#4 mutant	0/5	4,800 ± 944
ΔflaB#6 mutant	0/5	3,117 ± 1,577

^aTen wild-type- or 30 mutant-infected nymphs were allowed to feed per C3H/HeN mouse. Mouse infectivity was determined by reisolation of B. burgdorferi from sacrificed mouse tissues.

^bSpirochete burden in infected nymphs was determined 7 days postrepletion as described for Table 2 (average ± standard error of the mean; 4 or 5 positive ticks/strain). Results shown are representative of two independent assays.

^cP = 0.0001 (calculated by Student's t test) for wild-type to ΔflaB spirochete burden in the tick.

Fig 5.

ΔflaB spirochete burdens are significantly lower than wild-type burdens in fed nymphs. Quantitative PCR was used to measure B. burgdorferi loads in fed nymphs 7 days after repletion. Copies of the B. burgdorferi enolase gene were determined from a standard curve generated using the known amount of enolase template. Representative data of two independent studies are shown. Bars represent the mean enolase copies per nymph ± standard error of the mean for each isolate (4 positive ticks per strain). The asterisk indicates significantly (P < 0.001) lower values for ΔflaB#4 (or ΔflaB#6) mutant-infected ticks than for the corresponding wild-type parent.

ΔflaB mutant-immersed nymphal ticks failed to transmit the spirochetes to mice.

One limitation with the above-described nymphal studies was that those ΔflaB mutant-infected ticks already had a lowered spirochete burden while they were in the (fed) larval stage. Although we allowed 3 times more mutant-infected than wild-type-infected nymphs to feed on a mouse, one could still argue that the reduced ΔflaB spirochete burden in ticks was likely the reason for their inability to transmit the spirochetes, rather than a true transmission defect. To overcome this problem and to determine if the ΔflaB mutant-infected nymphs are actually able to transmit the organism into the mouse dermis, we immersed nymphal ticks with wild-type or mutant spirochetes and then contained these nymphs within capsules attached to naive mice (3 mice per strain; 10 nymphs/mouse for the wild type or 30 nymphs/mouse for the ΔflaB mutants). Nymphs were allowed to feed to repletion (3 to 5 days), and 72-h postfeeding skin samples at the bite site were analyzed by PCR (to detect B. burgdorferi DNA) and by culture to reisolate the spirochetes. None of the tissue samples from the mice fed upon by the mutant-infected nymphs were positive for DNA or live spirochetes, whereas all bite site skin specimens collected from the wild type were positive using either protocol (data not shown). These results indicate that either FlaB is critical for the transmission of B. burgdorferi or the mutants deposited in the skin were cleared by the mammalian host within 72 h. At 7 days postrepletion, spirochete burdens were found to be significantly lower in the ΔflaB mutant-infected nymphs than in the wild-type-infected nymphs, thus reinforcing the larval tick studies whose results are shown in Table 2.

Nonmotile mutants exhibit a significant growth defect in vitro.

The studies described above indicate that the spirochete loads in the ΔflaB mutant-infected ticks were significantly lower than in the wild-type-infected ticks. One reason for these reduced burdens could be related to altered growth of the ΔflaB mutants. Flagellinless, nonmotile spirochetes were found by dark-field microscopy to grow in chains (long, undivided filamentous bacteria [Fig. 3A]). To determine if these cells exhibit a growth defect in vitro, we enumerated B. burgdorferi cultures for 7 days or until the bacteria reached stationary phase (2 × 10⁸ to 3 × 10⁸ cells per ml). We counted a chain of ΔflaB cells as one bacterium, and based on the growth curve analysis, we found that the ΔflaB mutants (ΔflaB#4 and ΔflaB#6) have a significantly longer lag phase than the parental wild-type cells (P > 0.05), suggesting a growth defect in vitro (Fig. 6). The average doubling time for the wild-type, ΔflaB#4, or ΔflaB#6 cells was determined to be 8.03, 9.95, or 9.40 h, respectively.

Fig 6.

Growth curves of the wild type and the ΔflaB#4 and ΔflaB#6 mutants grown at 35°C in standard BSK-II medium. The starting cell densities were 2.5 × 10⁵ spirochetes per milliliter. Cells were counted using a Petroff-Hausser counting chamber under a Zeiss Imager M1 dark-field microscope. A representative result of two independent studies is shown. Each data point represents the mean ± standard deviation from three independent cultures (triplicates of each culture per strain). Student's t test was used to calculate the P values at each day. Asterisks indicate a significantly reduced growth rate (P > 0.05) for the ΔflaB#4 or ΔflaB#6 mutant than for the parent cells.

DISCUSSION

B. burgdorferi motility is provided by its periplasmic flagella. Our previous and current studies with flagellinless mutants indicate that FlaB is indispensable for both spirochetal motility and the flat-wave morphology (18, 24, 47, 48, 85). The in vitro phenotype exhibited by the ΔflaB cells was observed in different B. burgdorferi background strains (i.e., a high-passage, avirulent strain and a low-passage, virulent strain). The contribution of the periplasmic flagella to B. burgdorferi's flat-wave morphology is striking, especially considering that similar nonflagellated mutants of Treponema phagedenis (37), Treponema denticola (38), and Leptospira biflexa (36) retain their basic helical morphology. Moreover, we also found that ΔflaB and other nonmotile mutants examined (e.g., ΔmotB, ΔflgE, and ΔfliF mutants) exhibit defects with respect to their growth as well as cell division (reference 26 and our unpublished observations). Investigations of nonmotile mutants among spirochetes as well as other bacteria indicate that these organisms typically grow in long chains, suggesting a defect in cell division (8, 26, 32, 37, 38, 47, 87). Recently, the flagellar protein FlhG of Campylobacter jejuni has been shown to markedly influence cell division (88). We postulate that B. burgdorferi flagellar proteins are also required for proper cell division.

The monocistronically transcribed flaB gene is constitutively expressed in its disparate host (tick or mammalian) environments, suggesting that the periplasmic flagella and, in turn, motility are important for the life cycle of B. burgdorferi (80, 81, 89, 90). In fact, FlaB is one of the few B. burgdorferi antigens that the Centers for Disease Control and Prevention (CDC) uses as a serodiagnostic marker for Lyme disease (91, 92). Furthermore, antibodies against FlaB are detected in all stages (early or late) of Lyme disease (93). Although flaB is expressed throughout the spirochete's life cycle, recent reports indicate that the translation of flaB is regulated by carbon storage regulator A (CsrA) (94, 95), suggesting that motility is likely to be necessary for a specific stage of the organism's infectious cycle (see below).

The inability of two independently isolated B. burgdorferi flaB mutants to establish infection in mice indicates that periplasmic flagella and motility are important for virulence. The failure to establish infection in the mouse was likely not due to a secondary mutation in the flaB mutants, as both were independently derived and the morphology and motility phenotypes were restored upon complementation (Fig. 3). The complemented flaB⁺ cells restored the infectivity, albeit at a higher dose than that of the wild-type cells (5 × 10³ versus 1 × 10⁶ [Table 1]). However, flaB⁺ spirochetes failed to be transmitted from infected nymphs to naive mice even though the B. burgdorferi load was normal in those ticks (see Table S1 and Fig. S1 in the supplemental material). This somewhat attenuated phenotype of the flaB⁺ strain is likely due to the fact that the mutant was complemented in trans, which sometimes results in decreased infectivity (63, 96, 97). Since genetic manipulations in B. burgdorferi are difficult (1, 64, 65, 98, 99), we report our findings with the two independently isolated mutants as others have done in the past (69, 81, 98, 100).

Bacterial flagella have been shown to be involved in the infection and disease processes in several bacteria by promoting motility, adherence, or invasion of host cells (101–105). While flagella of these other bacterial cells are external and thus directly adhere to the host cells for colonization, the spirochete's flagella are located in the periplasmic space, where they are not exposed to the cell surface. Consequently, we postulate that B. burgdorferi's dissemination through the collagen-rich extracellular matrix of skin, hematogenous transmission, and escape of the vascular endothelium necessitates spirochete's active periplasmic flagella and motility for promoting tissue colonization and disease production (10, 12). Consistent with this hypothesis is the evidence that B. burgdorferi mutants that are flagellated but paralyzed (ΔmotB), have aberrant motility (ΔfliG1), or are generally nonchemotactic but exhibit altered motility (ΔcheA2 and ΔpdeA/Δbb0363) are also attenuated in animal infection studies (8, 9, 46, 57; M. Motaleb, S. Sultan, T. Boquoi, unpublished data).

Because mammalian infection represents only one phase of B. burgdorferi's life cycle, we evaluated the flaB mutants' ability to colonize and replicate in I. scapularis ticks and to transmit the spirochete into the mouse host. These experiments revealed that while the flaB mutants (ΔflaB#4 and ΔflaB#6) were able to colonize the ticks (in larvae or nymphs), the spirochete burdens were 5- to 10-fold lower than those of the wild type (Tables 2 and 3 and Fig. 4 and 5). As discussed above, bacterial flagella have been shown to be required for initial attachment to the host for successful colonization, and motility has been shown to enable bacteria to escape from detrimental host microenvironments (106–109). Conceivably, spirochetal motility facilitates appropriate orientation of the bacteria in the tick's midgut, allowing these spirochetes to interact with the tick epithelium for optimal survivability (5, 110–112) and/or to protect them from potential harm in the midgut of the fed tick (113–116). Nevertheless, we cannot exclude the possibility that the reduced burdens of the ΔflaB spirochetes in ticks (Tables 2 and 3 and Fig. 4 and 5) could be related to the mutants' altered growth found in vitro (Fig. 6) rather than the loss of motility. Alternatively, the reduced burden may stem from the possibility that the ticks immersed in the ΔflaB mutant cultures ingested fewer bacteria than did the wild-type-immersed ticks, even though the two groups of ticks were inoculated with equal densities (5 × 10⁷/ml) of spirochetes. Although our nymphal studies do not explicitly confirm that the mutant spirochetes were transmitted from tick midgut to hemolymph en route to the dermis of the mice, failure to reisolate or detect mutant B. burgdorferi in the skin tissues suggests that the nonmotile ΔflaB cells were unable to migrate out of the midgut. Recent reports provide evidence in support of this contention. Specifically, tick studies imply that motility and adhesion are necessary for the migration of spirochetes from the tick midgut to the hemolymph through the tight junctions of the epithelial cells and basement membrane in the tick midgut (5, 117).

When and where is motility important for B. burgdorferi infection? Spatiotemporal regulation of motility during the life cycle of B. burgdorferi is unknown. We propose that motility and thus the requirement for FlaB may not be vital for B. burgdorferi's survival within the unfed tick, in which nutrients are depleted and the B. burgdorferi cells are likely to have diminished motility to save energy. Although not studied, we postulate that CsrA, or other unknown regulators, may likely inhibit FlaB synthesis or periplasmic flagellar motor rotation at this stage in order to inhibit motility. During a tick's blood meal, B. burgdorferi must migrate from the tick midgut to the salivary glands of the vector in order to be transmitted to the mammalian host, and when B. burgdorferi is in the mammalian host, it must disseminate from the site of a tick bite to the colonization sites (heart, joint, brain, etc.), causing disease. We predict that during a tick's blood meal or once B. burgdorferi is in the mammalian dermis after the tick bite, motility is activated (by releasing the inhibitory effect of CsrA or by unknown regulators), enabling B. burgdorferi to be transmitted from the tick to the mammalian host and establish infection (5, 18).