Abstract
Multilocus sequence typing (MLST) represents the gold standard genotyping method in studies concerning microbial population structure, being particularly helpful in the detection of clonal relatedness. However, its applicability on large-scale genotyping is limited due to the high cost and time spent on the task. The selection of the most informative nucleotide positions simplifies genomic characterization of bacteria. A simple and informative multiplex, SNaPaer assay, was developed and genotyping of Pseudomonas aeruginosa was obtained after a single reaction of multiplex PCR amplification and mini-sequencing. This cost-effective technique allowed the analysis of a Portuguese set of isolates (n = 111) collected from three distinct hospitals and the genotyping data could be obtained in less than six hours. Point mutations were shown to be the most frequent event responsible for diversification of the Portuguese population sample. The Portuguese isolates corroborated the epidemic hypothesis for P. aeruginosa population. SNaPaer genotyping assay provided a discriminatory power of 0.9993 for P. aeruginosa, by testing in silico several hundreds of MLST profiles available online. The newly proposed assay targets less than 0.01% of the total MLST length and guarantees reproducibility, unambiguous analysis and the possibility of comparing and transferring data between different laboratories. The plasticity of the method still supports the addition of extra molecular markers targeting specific purposes/populations. SNaPaer can be of great value to clinical laboratories by facilitating routine genotyping of P. aeruginosa.
Introduction
Pseudomonas aeruginosa is a versatile Gram-negative bacterium frequently found in association with animals and plants, as well as in environmental samples (air, water or soil). It can grow in a broad range of temperatures, although the optimal growth is observed at 37°C [1]. This wide ecological niche implies a high degree genomic plasticity and the presence of several adaptive mechanisms. Indeed, P. aeruginosa is not nutritionally demanding and grows in minimal culture medium with simple molecules or under deprived conditions [2]–[4].
This bacterium represents an opportunistic pathogen with high clinical relevance in intensive care units [5] and it is a common colonizer and infection-associated pathogen in patients with bronchiectasis, and particularly with cystic fibrosis (CF) [6]. In fact, P. aeruginosa is found in more than 50% of CF patients and it is associated with high morbidity and mortality [7]. The early stage of P. aeruginosa colonization is easily controlled with antibiotic treatment which eradicates rough and smooth primary populations [8]. Subsequent re-colonization by the same strain may reveal the appearance of multi-resistant and/or mucoid forms which are much more persistent in lungs. Mucoid forms overproduce alginate and can result from the conversion of smooth or rough colonies over 1.8 years [7]. The immune system of the patient overreacts to the bacteria and alginate works as a barrier to phagocytosis that facilitates bacterial damage of tissues and eventually destroys part of the lung. Genotype-phenotype studies revealed that the risk of P. aeruginosa infection in CF patients depends on the severity of the mutations in cystic fibrosis transmembrane conductance regulator (CFTR) gene [9]. Patients chronically colonized by P. aeruginosa were associated with poor lung function and the decline in lung function was faster in those patients with P. aeruginosa when compared with those colonized with other bacteria [10]. The preservation of normal lung function may require P. aeruginosa eradication before chronic airways colonization is established [11].
Niche adaptation may be the strongest driven force that influences the genetic diversity of P. aeruginosa and might occasionally cause the emergence of new genomic islands on the bacterial genome [12]. The strains causing infection in CF patients may be acquired from the environment and selective pressures may contribute to a successful and ubiquitous ‘core lineage’ within patient lungs. The characterization of a large number of clinical and environmental isolates collected worldwide confirmed an epidemic and largely diverse P. aeruginosa populations but reports of CF clones have not been widespread [13]. The populations of P. aeruginosa have been recently described as presenting a non-clonal structure with frequent occurrence of recombination events [13], [14]. The description of such diversity in P. aeruginosa is critical for infection control strategies and prevention of person-to-person transmission in clinical units [15], [16]. European guidelines recommend the physical isolation in clinics of patients chronically colonized with P. aeruginosa [17].
Multilocus sequence typing (MLST) represents the gold standard genotyping method in studies concerning microbial population structure and evolution. Additionally, MLST may be particularly important on the identification of infection sources and outbreaks, and for definition of extensive and endemic microbial populations [18]. This method was first employed in 1998 to identify virulent lineages of Neisseria meningitidis [19] and, since then, it has been successfully adapted to several prokaryotic and eukaryotic microorganisms. In 2004, MLST was applied to P. aeruginosa by Curran et al. [20]. At present, the information of more than 1,500 strains is freely available online at http://pubmlst.org/paeruginosa/and this number is expected to increase considerably. P. aeruginosa MLST presents a high discriminatory power (above 0.975), and the sequence analysis of seven housekeeping genes ensures reproducibility, unambiguous analysis and the possibility of comparing and transferring data between different laboratories [21], [22]. MLST is more helpful than pulsed-field gel electrophoresis (PFGE), random amplified polymorphic DNA (RAPD) and repetitive element palindromic PCR (Rep-PCR) for the detection of clonal relatedness by labeling more strains as unique that are comparable through a large online database [23]. RAPD and Rep-PCR have advantages of by being practical, fast, and consequently more amenable to high-throughput typing; however, both methods presented limited reproducibility and lower discriminatory power, being useful for identification of major clonal groups [23]–[25]. MLST may present limited value for recognition of recombination events as it considers polymorphisms located in a limited number of genes [23]. However MLST applicability is limited to small-sized collections due to the high cost and time required by the method. Hence, it is necessary to develop alternative methods able to facilitate such studies and to boost bacterial genotyping to allow for large-scale genotyping analysis.
Single nucleotide polymorphism (SNP) based methods have been tested for few bacteria, mainly for identification purposes [26], although occasionally they have also been used in the differentiation of specific lineages [27], [28]. This methodology is practical and sensitive to simultaneous analysis of some polymorphisms [29], [30]. It involves multiplex PCR of target genomic regions containing the polymorphisms, which are detected by mini-sequencing. The mini-sequencing is performed using a multiplex single base extension (SBE) primer strategy in the presence of fluorescent labeled dideoxy nucleoside triphosphates (ddNTPs). By employing SBE primers of different lengths (nucleotide tails can be added at 5′), this methodology allows the recognition of multiple size fragments by automated capillary electrophoresis. The result is a set of peaks with distinct colors that represent site-specific genomic variation.
Aiming to optimize a method able to overcome the limitations of MLST to genotype large numbers of bacterial isolates, in the present study we present a SNP based method, hereby designated SNaPaer assay, targeting a set of 23 polymorphisms located at seven genes. The standard MLST method requires sequencing of more than 3,300 nucleotides but only some of these are important for most applications (since most positions are conserved while a few others are extremely variable). The selection of the most informative nucleotide positions might simplify genomic characterization of bacterial isolates particularly in complex samples with multiple strains and, the technique proposed herein, by exploring the variable positions represents a practical assay for genotyping the isolates of P. aeruginosa allowing extensive microbial population studies. Using SNaPaer, an informative and simple genotyping profile is obtained with a single reaction of multiplex PCR amplification and mini-sequencing.
Materials and Methods
P. aeruginosa Isolates and DNA Extraction
A total of 111 Portuguese isolates were obtained from sputum and blood samples of patients with pulmonary diseases (CF and patients admitted into intensive care units). The isolates were collected from three different Portuguese hospitals (Coimbra, Lisbon and Oporto) between 2009 and 2011. P. aeruginosa isolates were kept frozen at −80°C and cultured in Cetramide medium dishes before DNA extraction. Single colonies of each isolate were suspended in 5 mL of Lysogeny broth (LB) medium and grown overnight with 180 rpm agitation, at 37°C. DNA was extracted from cells according to a protocol suggested by Cheng and Jiang [31]. At the end, two DNA purification steps with ethanol (70%) were added to the protocol. Bacterial DNA was finally resuspended in 50 µl of ultrapure water and stored at −20°C.
MLST Genotyping: Amplification and Sequencing
MLST was performed by using seven loci of housekeeping genes acsA, aroE, guaA, nuoD, mutL, ppsA and trpE, as previously described by Curran et al. [20]. The primers described by Curran et al. [20] were used and new ones were designed in cases of amplification problems. Primer 3 (v 0.4.0) was used for primer design (http://frodo.wi.mit.edu/) [32]. Subsequently, hairpin and primer-dimer secondary structures were avoided by using AutoDimer v1 (http://www.cstl.nist.gov/strbase/AutoDimerHomepage/AutoDimerProgramHomepage.htm) [33]. The final set of primers employed for the amplification of MLST gene fragments is shown in Table S1. The PCR reaction was conducted in a final volume of 5 µL, containing 2.5 µL of 2x Qiagen multiplex PCR master mix (Qiagen), 1 µL of bacterial DNA (50–250 ng), 0.5 µL of primer mix (each one at 2 µM), 0.5 µL of Q-solution (Qiagen) and 0.5 µL of ultrapure water. PCR thermo-cycling conditions were: denaturation for 15 min at 95°C; 4 cycles with denaturation for 1 min at 95°C, primer annealing for 30 s at 68°C and extension for 2 min at 72°C; 4 cycles with denaturation for 1 min at 95°C, primer annealing for 30 s at 64°C and extension for 2 min at 72°C; 4 cycles with denaturation for 1 min at 95°C, primer annealing for 30 s at 61°C and extension for 2 min at 72°C; 23 cycles with denaturation for 1 min at 95°C, primer annealing for 30 s at 58°C and extension for 2 min at 72°C; and final extension for 10 min at 72°C. Amplicon sizes were confirmed after separation by polyacrylamide gel electrophoresis and standard silver-staining detection [34].
PCR products were purified with ExoSap-IT (E. coli exonuclease I and shrimp alkaline phosphatase; USB Corporation), according to the manufacturer instructions. Sequencing reactions were carried out using the ABI Big Dye terminator cycle sequencing ready reaction kit (Applied Biosystems). The sequencing reactions included incubation for 2 min at 96°C, followed by 35 cycles with denaturation for 15 s at 96°C, primer annealing for 9 s at 50°C, extension for 2 min at 60°C, and then 10 min at 60°C. Finally, the sequencing product was purified using SEPHADEX™ (Expansys) columns and a volume of 8.0 µL HiDi™ formamide (Applied Biosystems) was added before sequencing analysis in an ABI PRISM 3100 (Applied Biosystems) genetic analyzer.
SNaPaer Assay
A set of 23 polymorphisms was selected from MLST genes for development of SNaPaer assay. Extension primers were designed with a forecasted Tm of approximately 60°C, at location near the target polymorphic position. A non-homologous tail was added at the 5′ end of extension primers for the separation by capillary electrophoresis. The final size of each primer ranged from 16 to 109 bp differing generally from each other by more than 3bp (Table 1). Hairpin and primer-dimer secondary structures were avoided by using AutoDimer v1. The assays were carried out in a final volume of 5 µL, containing 1.5 µL of PCR product (purified with ExoSap-IT, as described above), 1 µL of SNaPaer primer mix (each one at 1 µM), 1 µL of ABI Prism SNaPshot® Multiplex Kit (Applied Biosystems), and 1.5 µL of ultrapure water. The reaction was performed in 25 cycles at the following conditions: denaturation for 10 s at 96°C, primer annealing for 5 s at 55°C, and extension for 30 s at 60°C. Unincorporated ddNTPs were removed with 1 U of SAP (shrimp alkaline phosphatase; USB Corporation), after incubation for 1 h at 37°C and 15 min at 85°C. SNaPaer products (0.5 µL) were mixed with 9.0 µl of HiDi™ formamide (Applied Biosystems) and 0.5 µL of GeneScan-120 LIZ size standard (Applied Biosystems). Electrophoresis was performed on a 3130xl Genetic Analyzer (Applied Biosystems) using filter set E5 and the data analyzed with the software GeneMapper v 4.0 (Applied Biosystems).
Table 1. Primers used for single nucleotide polymorphism multiplex (SNaPaer).
| Name* | Expected SNP§ | Primer sequence (5′ to 3′) | Primerlenghtφ | Expectedpeakφ | Simpsonindex | Garza-Williamsonindex |
| Ac7 | A/C/T | CCTACATCGTCTATGGYCCG | 72 | 75–76 | 0.50 | 0.75 |
| Ac78 | A/G | TGACCCGCGTGGCGAA | 26 | 33–34 | 0.38 | 0.67 |
| Ac336 | A/C/T | GCCCGGCTTCATCGC | 66 | 68–69 | 0.50 | 0.75 |
| Ac387 | A/C/G | GCCGAGGTTGTCCACCAG | 105 | 106–107 | 0.45 | 1.00 |
| A98 | C/G/T | GAACACCCTGATCCGCCT | 47 | 50–52 | 0.41 | 1.00 |
| A264 | C/G/T | CGGTTGGCGATCAGCA | 16 | 26–27 | 0.33 | 1.00 |
| A491 | C/G/T | ATGTAYGSCAAGGAACCGAC | 93 | 95–96 | 0.40 | 1.00 |
| G6 | A/C/G/T | GGTTCCTCCAAGGTCCTGCT | 69 | 70–71 | 0.51 | 1.00 |
| G49 | A/C/G/T | CCGATGGCCTTGTGCA | 62 | 62–63 | 0.34 | 1.00 |
| G219 | C/T | TTGCGCTTCTCTTCCGG | 39 | 46–47 | 0.33 | 0.67 |
| G264 | A/C/G/T | GGCCGCGCTTTCATCGAAGT | 35 | 40–41 | 0.38 | 1.00 |
| M9 | A/G | GCCAGGCGCTTGATGAC | 57 | 59–61 | 0.49 | 1.00 |
| M36 | C/G/T | GTGGAAAGCCACGTCGAA | 78 | 80–82 | 0.50 | 0.67 |
| M204 | G/C/T | GCCTGCACCTGTGGGG | 50 | 53–55 | 0.37 | 0.67 |
| M228 | A/C/G/T | CAGGTCCGGCTGGCTGCG | 90 | 92–93 | 0.16 | 1.00 |
| N162 | C/T | CCAGTCCTGGCACAGTTTCAT | 26 | 35–37 | 0.37 | 0.67 |
| N255 | C/G | GCCGGGATCAAGGTGCC | 54 | 57–58 | 0.47 | 1.00 |
| N288 | C/G/T | GGTTCAGGATRCGGAAGAACTC | 96 | 98–99 | 0.04 | 1.00 |
| P100 | A/C/G/T | GCTGGCCGATGGCACG | 84 | 85–87 | 0.37 | 1.00 |
| P268 | A/C/G/T | GTCACCAACCGAGGAGGGCG | 43 | 48–49 | 0.49 | 1.00 |
| T205 | C/G/T | TGGGGCGGGTGTCCGA | 101 | 101–102 | 0.32 | 1.00 |
| T331 | A/C/T | ACGCGCTGCGGGCGAT | 75 | 77–78 | 0.49 | 0.75 |
| T349 | A/G | TGCCGGCGGGYACKCT | 109 | 107–109 | 0.46 | 0.67 |
The name of primers is composed by MLST gene and polymorphic position.
Expected base on MLST profile.
Length of the primer plus tail of bases.
Expected position in the SNaPaer electropherogram.
SNaPaer assay was applied on a set of 111 P. aeruginosa isolates. A group of 20 isolates was initially tested in four independent experiments, being each experiment conducted more than two weeks apart; the remaining group of P. aeruginosa isolates was tested in duplicate with an interval of more than 3 weeks.
Data and Statistical Analysis
In silico analyses were performed on MLST information from 1,177 online entries of P. aeruginosa (downloaded from http://pubmlst.org/paeruginosa/) grouped with MLST data of Portuguese bacteria. Network analysis was performed with the Network 4.6.1.0 program (www.fluxus-engineering.com/sharenet.htm) [35]. Minimum spanning trees were performed at MLST website (http://pubmlst.org/perl/mlstanalyse/mlstanalyse.pl?site=pubmlst&page=mst&referer=pubmlst.org). Statistical analysis was performed using Arlequin 3.1 software (http://cmpg.unibe.ch/software/arlequin3/) [36] and Microsoft Office Excel 2010 (Microsoft Corporation). Simpson's diversity index was used to determine the discriminatory power of individual SNPs and of the proposed multiplex strategy, according to the following formula:
where, ni is the number of entities belonging to the ith type and N is the total number of entities in the dataset.
Results
Amplification of MLST Gene Fragments in a Single Multiplex Reaction
Curran et al. [20] published a MLST genotyping strategy for P. aeruginosa based on singleplex amplifications of the housekeeping genes acsA, aroE, guaA, mutL, nuoD, ppsA and trpE. The primers described by Curran et al. [20] for the amplification of MLST targets were shown to be inadequate for multiplex amplification. Therefore, new primers were designed (see Table S1) and alternative touchdown PCR conditions (final temperature of 58°C) proposed for the amplification of seven MLST fragments in a single multiplex reaction. The newly designed genotyping protocol provided high reproducibility and hence enabled the detection and sequencing analysis of the gene fragments. The result of the multiplex amplification of a group of unrelated isolates of P. aeruginosa is shown in Figure 1.
Figure 1. Polyacrylamide gel electrophoresis of MLST fragments amplified by SNaPaer multiplex PCR (L- Ladder; PA1 to PA8 - Different isolates of Pseudomonas aeruginosa ).
Selection of Polymorphisms for SNaPaer Assay
For SNP selection, MLST sequences available online (at http://pubmlst.org/paeruginosa/) were downloaded to a new database that included the genomic data of 30 unrelated P. aeruginosa strains from our collection. Key polymorphic positions located at MLST genes were selected based on its ability to discriminate P. aeruginosa strains. Non-polymorphic, redundant and low polymorphic positions were discarded. In addition, positions that are difficult to characterize on some MLST sequences were also excluded (a few examples of those ambiguous positions are shown in Figure S1). A last group of polymorphisms were removed due to difficulties in the design of primers. A set of 23 polymorphisms were finally selected on the seven housekeeping genes for inclusion in the SNaPaer assay, representing 0.01% of the total MLST nucleotides. The final analysis of the complete collection revealed that the target positions have a high discriminatory capacity within the collection of MLST profiles available online. Combining all selected markers, only a few online available sequence types were not differentiated (around 70% of the profiles were unique and the remaining were only shared by pairs of closely related sequence type; see complete list in Table S2). This set of 23 polymorphisms allows a theoretical number of possible combinations of more than 15 billion, which guarantees a high diversity of profiles that can be discriminated in P. aeruginosa employing SNaPaer assay (see Table 1 for the discriminatory power of each polymorphic position; only two polymorphisms showed diversity indexes below 0.3).
Mini-sequencing primers ensured a distinct peak by automated capillary electrophoresis (Figure 2A); primers were individually tested facilitating the definition of the expected position on the electropherogram (Table 1). No primer interactions (namely primer dimers or hairpins) were observed when tested in multiplex. SNaPaer assay was further tested in the complete group of 111 clinical isolates of P. aeruginosa obtained from three distinct Portuguese Hospitals (located at Coimbra, Lisbon and Oporto). An example of a SNaP profile observed following the application of SNaPaer assay is shown in Figure 2; peaks with an intensity greater than 100 and in the expected electropherogram position (genomic fragments with the expected length) were considered valid. SNaPaer assay was highly reproducible and the same profile was obtained by distinct researchers testing the isolates in duplicate. The final SNaP profile was obtained following the SNaPaer data analysis; the markers were ordered in accordance with Table 1 facilitating the comparison of the genotypes with MLST data (genes are presented in alphabetic order). The analysis of our collection revealed 86 distinct SNaP profiles and a final discriminatory power of 0.9997 was observed in the Portuguese collection of P. aeruginosa; a similar value was observed when including the complete collection of sequence types available online (0.9993). Sequencing of MLST genes conducted in our group of isolates confirmed SNaP profiles, with a single exception corresponding to a new polymorphism in aroE.
Figure 2. SNaPaer assay: A) position of each marker on the automated electropherogram (a total of 23 markers were included in SNaPaer assay); and B) example of Pseudomonas aeruginosa profile (peaks: orange – ladder; blue – guanine; black – cytosine; green – adenine; red – thymine); C) final SNaP profile of the isolate presented above obtained according to Table 1 (e.g. Ac7, Ac78, … T349) in order to facilitate comparison with MLST data.
When markers are amplified using reverse primers (e.g. A264) the complementary base should be included in the SNaP profile.
Population Analysis of Portuguese Clinical P. aeruginosa
The population analysis of P. aeruginosa isolates was conducted by employing Arlequin 3.1 software. The haplotype frequency revealed 72 novel and exclusive SNaP profiles not previously described at MLST database. The population profiles observed in clinical isolates from Oporto could not be distinguished from those collected in Lisbon or Coimbra; very few SNaP profiles (n = 3) were identified in populations from different hospitals (Figure 3). In contrast, isolates with similar SNaP profile were identified in distinct patients admitted to the same institution. Cases of microvariation (difference in a single marker) were frequently observed, particularly among the few isolates from our collection that came from the same patient along two years (Figure 4). Interestingly, this small group of patients monitored for two years was not only colonized by closely related strains (as shown in the network of Figure 4A) but also by strains with very distinct SNaP profile (Table S3).
Figure 3. Network of the tested Portuguese strains (colors represent strains collected from three Hospitals: light blue – in Oporto, red - in Lisbon, yellow - in Coimbra; circles are representative of the proportion of profiles included in the network).
Figure 4. Network of Portuguese haplotypes of Pseudomonas aeruginosa showing microevolutionary events (difference in a single marker).
(A) Black, green, red and yellow circles represent different sets of events shown in the population of P. aeruginosa and presenting the SNaP profiles shown in the table (B); light blue circles represent the remaining haplotypes.
We also analyzed in silico a set of 1,177 online MLST unique entries of P. aeruginosa (obtained from pubMLST at April 7, 2012) from different countries, between 1969 and 2011, in addition to the group of 111 Portuguese P. aeruginosa from this study. SNaP profiles found exclusively in Australia, Canada, China and Portugal were compared with the complete group of profiles by network analysis and application of minimum spanning tree; similar subpopulations were selected from profiles observed exclusively in two temporal intervals 1980–95 and 2005–11. No sub-groups of isolates could be observed in both spatial and temporal datasets (networks can be seen in Figures S2 and S3; minimum spanning tree resulted in similar distributions). Bacterial populations showed a widespread distribution along the networks, in concordance with Garza-Williamson (G-W) index value, which suggested absence of bottleneck events (Table 1).
Discussion
The present study introduces an innovative methodology for genotyping P. aeruginosa based on the automatic analysis of 23 SNPs. SNaPaer assay represents a practical, reproducible, and sensitive alternative to MLST that allows the analysis of multiple polymorphisms in a single amplification and mini-sequencing reaction. Despite MLST being a widely employed methodology, the associated high costs and time consumption impose serious limitations to the study of large collections of bacterial isolates. Nonetheless, P. aeruginosa MLST database is one of the largest available online, which is justified by the enormous interest in this bacterium worldwide. SNaPaer assay uses a subset of MLST neutral genetic polymorphisms [37], responsible for synonym and non-synonym amino acid changes, that can be used to improve the diagnosis and surveillance of P. aeruginosa strains. A restriction fragment length polymorphism based assay had previously highlighted the advantage of SNP markers located in conserved genes for genotyping of clinical and environmental P. aeruginosa [28]. The newly proposed method allows P. aeruginosa genotyping in a single molecular reaction, in opposition to MLST which requires individual amplification and sequencing for each housekeeping gene. Thus, SNaPaer can cost six to seven times less than MLST and produces genotyping results in less than six hours. A weakness of SNaPaer is the loss of some genomic information compared to MLST particularly considering few point mutations, large deletions or insertions occasionally observed in the complete MLST genes; such differences were observed in a small group of closely relates isolates, as reported in the results section. Nevertheless, the theoretical number of possible combinations (more than 15 billion when employing 23 markers) guarantees a great potential for genetic diversity assessment.
SNaPaer genotyping may result in a low-cost test being particularly useful in cases of patients colonized or infected by multiple strains. Few alternatives have been recently developed for genome analysis of P. aeruginosa, reflecting the need for high throughput molecular approaches for epidemiological analysis. AT biochips [38] and high resolution melting curve-based SNP typing profile assay [39] represent good alternatives but are limited by biochip fabrication steps and expensive equipment required, and are prone to genotyping inaccuracies caused by background/non-specific fluorescence [40]. In 2011, Woo et al. [41] analyzed 35 P. aeruginosa MLST profiles and, aiming to promote cost-effectiveness of this strategy, suggested the reduction of seven to six housekeeping genes (removal of trpE) in P. aeruginosa. However, our study detected some informative polymorphic positions in trpE, and, therefore, we do not recommend such strategy. Instead SNaPaer assay uses less than 0.01% of the total length of MLST and presents a final discriminatory power of 0.9993. Moreover the limited number of polymorphisms tested with SNaPaer significantly reduces genotyping data analysis burden and the number of errors in contrast with the relative abundance of ambiguous results observed in MLST data.
We tested SNaPaer assay in a group of clinical isolates collected from distinct Portuguese hospitals. Point mutations were found to be the most abundant event in the diversification of these Portuguese samples and microevolution was frequently observed. Point mutations are also the major source of genetic variation observed among bacterial housekeeping genes [42]. The present analysis of Portuguese SNaP profiles corroborates the previously reported epidemic hypothesis of P. aeruginosa population [13], [28]; no spatial or temporal subpopulations could be identified. Multiple mutations were found in a small group of strains obtained from chronic colonized patients, suggesting either the reinfection by new strains or, in last instance, the occurrence of recombination or horizontal transfer events. Recombination events have been suggested and observed in few housekeeping genes, particularly among bacteria forced to adapt after clinical interventions [43].
In conclusion, SNaPaer assay represents a novel tool useful for identification and genotyping of P. aeruginosa strains. Moreover the primers used in the present work can be easily modified and extra markers accommodated when relevant for specific purposes/populations. This feature may be especially advantageous as the progress in the generation of sequence data [44] can substantially increase the number of target polymorphisms useful for P. aeruginosa genotyping. An online platform is presently under development and might become an alternative or a complement to the former successful MLST database. SNaPaer is also suitable for studying large collections of P. aeruginosa in a short period of time, due to its low cost high throughput and speed of analysis.
Ethics Statement
The Ethics commissions of Hospital de São João and Hospitais da Universidade de Coimbra have approved the study. A written informed consent was provided by study participants and/or their legal guardians.
Supporting Information
Fragments of mutL and ppsA MLST genes. Position 283 in mutL and 181 in ppsA present are ambiguous, thus these positions are difficult to define the final MLST profile.
(DOCX)
Networks for P. aeruginosa profiles according to the place of isolation (data obtained from MLST website in addition to our collection). MLST profiles from the online database were converted in SNaP profiles in order to design the networks: Australian (A), Canadian (B), Chinese (C) and Portuguese (D) haplotypes were marked dark blue; the remaining isolates are marked light blue.
(DOCX)
Networks for P. aeruginosa profiles according to the isolation date (data obtained from the MLST website in addition to our collection). MLST profiles from the online database were converted in SNaP profiles in order to design the network. Profiles detected in several years were excluded; isolates found from 1980 to 1995 were marked dark blue, while the isolates found from 2005 to 2011 were marked with light blue circles.
(DOCX)
Dideoxyoligonucleotide primers used for multilocus sequence typing of Pseudomonas aeruginosa .
(DOCX)
Groups of online profiles that could not be separable by SNaPaer (allelic differences are marked blue).
(XLSX)
SNaP profiles of Pseudomonas aeruginosa isolates obtained from the same patient.
(DOCX)
Funding Statement
This work was supported by grants from Fundação Calouste Gulbenkian (n°. 35-9924-S/2009), REQUIMTE (PEst-C/EQB/LA0006/2011), University of Porto and Santander Totta. RA is supported by Fundação para a Ciência e a Tecnologia (FCT) Ciência 2007 and by the European Social Fund. LG is supported by an Invited Professor grant from CAPES/Brazil. IPATIMUP is an Associate Laboratory of the Portuguese Ministry of Science, Technology and Higher Education and is partially supported by FCT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Pollack M (2000) Pseudomonas aeruginosa. In: In G. I M, J. E Bennett, and R Dolin, editor. Principles and practice of infectious diseases. Churchill Livingstone, Edinburgh, Scotland. 2310–2335. [Google Scholar]
- 2. Higashi T (1960) Physiological study on the oxygen- and nitrate respiration of Pseudomonas aeruginosa . J Biochem 47: 326–334. [Google Scholar]
- 3. Favero MS, Carson LA, Bond WW, Petersen NJ (1971) Pseudomonas aeruginosa: growth in distilled water from hospitals. Science 173: 836–838. [DOI] [PubMed] [Google Scholar]
- 4. Schreiber K, Krieger R, Benkert B, Eschbach M, Arai H, et al. (2007) The anaerobic regulatory network required for Pseudomonas aeruginosa nitrate respiration. J Bacteriol 189: 4310–4314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Cuttelod M, Senn L, Terletskiy V, Nahimana I, Petignat C, et al. (2011) Molecular epidemiology of Pseudomonas aeruginosa in intensive care units over a 10-year period (1998–2007). Clin Microbiol Infect 17: 57–62. [DOI] [PubMed] [Google Scholar]
- 6. Vonberg R, Peter MD, Gastmeier PMD (2005) Isolation of Infectious Cystic Fibrosis Patients: Results of a Systematic Review. Infect Control Hosp Epidemiol 26: 401–409. [DOI] [PubMed] [Google Scholar]
- 7. Vernez I, Hauser P, Bernasconi MV, Blanc DS (2005) Population genetic analysis of Pseudomonas aeruginosa using multilocus sequence typing. FEMS Immunol Med Microbiol 43: 29–35. [DOI] [PubMed] [Google Scholar]
- 8. Burns JL, Gibson RL, McNamara S, Yim D, Emerson J, et al. (2001) Longitudinal Assessment of Pseudomonas aeruginosa in Young Children with Cystic Fibrosis. J Infect Dis 183: 444–452. [DOI] [PubMed] [Google Scholar]
- 9. Green D, McDougal K, Blackman S, Sosnay P, Henderson L, et al. (2010) Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients. Respir Res 11: 140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Evans SA, Turner SM, Bosch BJ, Hardy CC, Woodhead MA (1996) Lung function in bronchiectasis: the influence of Pseudomonas aeruginosa . Eur Respir J 9: 1601–1604. [DOI] [PubMed] [Google Scholar]
- 11. Stuart B, Lin JH, Mogayzel PJ Jr (2010) Early eradication of Pseudomonas aeruginosa in patients with cystic fibrosis. Paediatr Respir Rev 11: 177–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Mathee K, Narasimhan G, Valdes C, Qiu X, Matewish J, et al. (2008) Dynamics of Pseudomonas aeruginosa genome evolution. Proc Natl Acad Sci USA 105: 3100–3105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Pirnay J-P, Bilocq F, Pot B, Cornelis P, Zizi M, et al. (2009) Pseudomonas aeruginosa Population Structure Revisited. PLoS ONE 4: e7740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Maatallah M, Cheriaa J, Backhrouf A, Iversen A, Grundmann H, et al. (2011) Population Structure of Pseudomonas aeruginosa from Five Mediterranean Countries: Evidence for Frequent Recombination and Epidemic Occurrence of CC235. PLoS ONE 6: e25617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Jones AM, Govan JRW, Doherty CJ, Dodd ME, Isalska BJ, et al. (2001) Spread of a multiresistant strain of Pseudomonas aeruginosa in an adult cystic fibrosis clinic. Lancet 358: 557–558. [DOI] [PubMed] [Google Scholar]
- 16. Scott FW, Pitt TL (2004) Identification and characterization of transmissible Pseudomonas aeruginosa strains in cystic fibrosis patients in England and Wales. J Med Microbiol 53: 609–615. [DOI] [PubMed] [Google Scholar]
- 17. Kerem E, Conway S, Elborn S, Heijerman H (2005) Standards of care for patients with cystic fibrosis: a European consensus. J Cyst Fibros 4: 7–26. [DOI] [PubMed] [Google Scholar]
- 18. Maiden MCJ (2006) Multilocus Sequence Typing of Bacteria. Annu Rev Microbiol 60: 561–588. [DOI] [PubMed] [Google Scholar]
- 19. Maiden MCJ, Bygraves JA, Feil E, Morelli G, Russell JE, et al. (1998) Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA 95: 3140–3145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Curran B, Jonas D, Grundmann H, Pitt T, Dowson CG (2004) Development of a Multilocus Sequence Typing Scheme for the Opportunistic Pathogen Pseudomonas aeruginosa . J Clin Microbiol 42: 5644–5649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Jolley K, Chan M-S, Maiden M (2004) mlstdbNet - distributed multi-locus sequence typing (MLST) databases. BMC Bioinformatics 5: 86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Griffiths D, Fawley W, Kachrimanidou M, Bowden R, Crook DW, et al. (2010) Multilocus Sequence Typing of Clostridium difficile . J Clin Microbiol 48: 770–778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Waters V, Zlosnik J, Yau Y, Speert D, Aaron S, et al.. (2012) Comparison of three typing methods for Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Eur J Clin Microbiol Infect Dis: 1–10. [DOI] [PubMed] [Google Scholar]
- 24. Syrmis MW, O'Carroll MR, Sloots TP, Coulter C, Wainwright CE, Bell SC, Nissen MD (2004) Rapid genotyping of Pseudomonas aeruginosa isolates harboured by adult and paediatric patients with cystic fibrosis using repetitive-element-based PCR assays. J Med Microbiol 53: 1089–1096. [DOI] [PubMed] [Google Scholar]
- 25. Kidd TJ, Grimwood K, Ramsay KA, Rainey PB, Bell SC (2010) Comparison of three molecular techniques for typing Pseudomonas aeruginosa isolates in cystic fibrosis sputum. J Clin Microbiol 49: 263–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Dalmasso A, Civera T, Bottero MT (2009) Multiplex primer-extension assay for identification of six pathogenic vibrios. Int J Food Microbiol 129: 21–25. [DOI] [PubMed] [Google Scholar]
- 27. Lomonaco S, Knabel SJ, Dalmasso A, Civera T, Bottero MT (2011) Novel Multiplex Single Nucleotide Polymorphism-Based Method for Identifying Epidemic Clones of Listeria monocytogenes . Appl Environ Microbiol 77: 6290–6294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Morales G, Wiehlmann L, Gudowius P, van Delden C, Tümmler B, et al. (2004) Structure of Pseudomonas aeruginosa populations analyzed by single nucleotide polymorphism and pulsed-field gel electrophoresis genotyping. J Bacteriol 186: 4228–4237. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Aydin A, Baron H, Bähring S, Schuster H, Luft FC (2001) Efficient and cost-effective single nucleotide polymorphism detection with different fluorescent applications. Biotechniques 31: 920–926. [DOI] [PubMed] [Google Scholar]
- 30. Ben-Darif E, Jury F, De Pinna E, Threlfall EJ, Bolton FJ, et al. (2010) Development of a Multiplex Primer Extension Assay for Rapid Detection of Salmonella Isolates of Diverse Serotypes. J Clin Microbiol 48: 1055–1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Cheng H-R, Jiang N (2006) Extremely rapid extraction of DNA from bacteria and yeasts. Biotechnol Lett 28: 55–59. [DOI] [PubMed] [Google Scholar]
- 32.Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ: Humana Press. 365–386. [DOI] [PubMed] [Google Scholar]
- 33. Vallone PM, Butler JM (2004) AutoDimer: a screening tool for primer-dimer and hairpin structures Biotechniques. 37: 226–231. [DOI] [PubMed] [Google Scholar]
- 34. Qu L, Li X, Wu G, Yang N (2005) Efficient and sensitive method of DNA silver staining in polyacrylamide gels. Electrophoresis 26: 99–101. [DOI] [PubMed] [Google Scholar]
- 35. Polzin T, Daneschmand SV (2003) On Steiner trees and minimum spanning trees in hypergraphs. Oper Res Lett 31: 12–20. [Google Scholar]
- 36. Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol Bioinform Online 1: 47–50. [PMC free article] [PubMed] [Google Scholar]
- 37. Lemee L, Dhalluin A, Pestel-Caron M, Lemeland JF, Pons JL (2004) Multilocus sequence typing analysis of human and animal Clostridium difficile isolates of various toxigenic types. J Clin Microbiol 42: 2609–2617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Hansen SK, Rau MH, Johansen HK, Ciofu O, Jelsbak L, et al. (2012) Evolution and diversification of Pseudomonas aeruginosa in the paranasal sinuses of cystic fibrosis children have implications for chronic lung infection. ISME J 6: 31–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Anuj SN, Whiley DM, Kidd TJ, Ramsay KA, Bell SC, et al. (2011) Rapid single-nucleotide polymorphism-based identification of clonal Pseudomonas aeruginosa isolates from patients with cystic fibrosis by the use of real-time PCR and high-resolution melting curve analysis. Clin Microbiol Infect 17: 1403–1408. [DOI] [PubMed] [Google Scholar]
- 40. Vezenegho S, Bass C, Puinean M, Williamson M, Field L, et al. (2009) Development of multiplex real-time PCR assays for identification of members of the Anopheles funestus species group. Malar J 8: 282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Woo PCY, Tsang AKL, Wong AYP, Chen H, Chu J, et al. (2011) Analysis of multilocus sequence typing schemes for 35 different bacteria revealed that gene loci of 10 bacteria could be replaced to improve cost-effectiveness. Diagn Microbiol Infect Dis 70: 316–323. [DOI] [PubMed] [Google Scholar]
- 42. Selander RK, Beltran P, Smith NH, Barker RM, Crichton PB, et al. (1990) Genetic population structure, clonal phylogeny, and pathogenicity of Salmonella paratyphi B. Infect Immun. 58: 1891–1901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Feil EJ, Maiden MC, Achtman M, Spratt BG (1999) The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis . Mol Biol Evol 16: 1496–1502. [DOI] [PubMed] [Google Scholar]
- 44. Boers SA, van der Reijden WA, Jansen R (2012) High-Throughput Multilocus Sequence Typing: Bringing Molecular Typing to the Next Level. PLoS ONE 7: e39630. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fragments of mutL and ppsA MLST genes. Position 283 in mutL and 181 in ppsA present are ambiguous, thus these positions are difficult to define the final MLST profile.
(DOCX)
Networks for P. aeruginosa profiles according to the place of isolation (data obtained from MLST website in addition to our collection). MLST profiles from the online database were converted in SNaP profiles in order to design the networks: Australian (A), Canadian (B), Chinese (C) and Portuguese (D) haplotypes were marked dark blue; the remaining isolates are marked light blue.
(DOCX)
Networks for P. aeruginosa profiles according to the isolation date (data obtained from the MLST website in addition to our collection). MLST profiles from the online database were converted in SNaP profiles in order to design the network. Profiles detected in several years were excluded; isolates found from 1980 to 1995 were marked dark blue, while the isolates found from 2005 to 2011 were marked with light blue circles.
(DOCX)
Dideoxyoligonucleotide primers used for multilocus sequence typing of Pseudomonas aeruginosa .
(DOCX)
Groups of online profiles that could not be separable by SNaPaer (allelic differences are marked blue).
(XLSX)
SNaP profiles of Pseudomonas aeruginosa isolates obtained from the same patient.
(DOCX)




