Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jun 17.
Published in final edited form as: Hypertension. 2012 Jan 30;59(3):673–679. doi: 10.1161/HYPERTENSIONAHA.111.190009

OXIDATIVE STRESS PROMOTES HYPERTENSION AND ALBUMINURIA DURING THE AUTOIMMUNE DISEASE SYSTEMIC LUPUS ERYTHEMATOSUS

Keisa W Mathis 1, Marcia Venegas-Pont 1, C Warren Masterson 1, Nicholas J Stewart 1, Katie L Wasson 1, Michael J Ryan 1
PMCID: PMC3683846  NIHMSID: NIHMS355598  PMID: 22291449

Abstract

Several lines of evidence suggest that essential hypertension originates from an autoimmune-mediated mechanism. One consequence of chronic immune activation is the generation of oxygen-derived free radicals, resulting in oxidative stress. Renal oxidative stress has direct pro-hypertensive actions on renal microvascular and tubular function. Whether oxidative stress contributes to the prevalent hypertension associated with autoimmune disease is not clear. We previously showed that female NZBWF1 mice, an established model of the autoimmune disease systemic lupus erythematosus (SLE), develop hypertension associated with renal oxidative stress. In the present study we tested the hypothesis that oxidative stress contributes to autoimmune-mediated hypertension by treating SLE and control (NZW/LacJ) mice with tempol (2 mM) and apocynin (1.5 mM) in the drinking water for 4 weeks (T+A). Although the treatment did not alter SLE disease activity (assessed by plasma double-stranded DNA autoantibodies), blood pressure and renal injury (urinary albumin) were reduced in the treated SLE mice. T+A-treated SLE mice had reduced expression of nitrosylated proteins in the renal cortex, as well as reduced urinary and renal cortical hydrogen peroxide, suggesting that treatment reduced renal markers of oxidative stress. These data suggest that renal oxidative stress plays an important mechanistic role in the development of autoimmune-mediated hypertension.

Keywords: pressure, immune, inflammation, oxidative stress, kidney, renal

INTRODUCTION

Immune system activation and inflammation are now commonly considered as important mediators in the development of hypertension. This is supported in part by studies showing that the treatment of a variety of experimental animal models, or essential hypertensive human patients with the immunosuppressive therapy mycophenolate mofetil, significantly lowers blood pressure 1,2,3,4. Early studies in humans show that auto-antibody levels, a clinical hallmark of and mechanistic contributor to autoimmune disease, are elevated in patients with essential hypertension 5. This suggests that there are potential autoimmune origins to the development of hypertension, an idea that is also recently suggested in rodent models of salt-sensitive hypertension 6. The mechanisms by which autoimmunity can promote hypertension are not clearly defined.

Systemic lupus erythematosus (SLE) is a chronic autoimmune inflammatory disease that predominantly affects young women. SLE in humans is associated with a high prevalence of hypertension 7,8,9,10,11,12 for reasons that are not yet clear. We recently reported that an established female mouse model of SLE (NZBWF1) develops hypertension that can be ameliorated by anti-inflammatory therapy (i.e., TNF-alpha antagonism with etanercept) 13. In these studies, we also showed that oxidative stress (assessed by NADPH oxidase activity) is increased in the renal cortex from mice with SLE and that this is abrogated in animals treated with etanercept. In the present study it was hypothesized that oxidative stress promotes the development of hypertension during SLE. This hypothesis was tested by measuring blood pressure in SLE and control mice chronically treated with an antioxidant therapy.

METHODS

Animal Model

Three to five week old female NZBWF1 and control (NZW/LacJ) mice were obtained from Jackson Laboratories (Bar Habor, ME). As previously described, 30 week old NZBWF1 (and control) mice without any signs of renal injury (urinary albumin <100 mg/dL by dipstick) were included in these studies as previously described 14,13,15. All mice were maintained on a 12-hour light/dark cycle in temperature-controlled rooms with access to food and water ad libitum. All studies were approved by the University of Mississippi Medical Center Institutional Animal Care and Use Committee (IACUC) and were in accordance with National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals.

Auto-Antibody Production

The presence of plasma anti-double-stranded-DNA antibodies (dsDNA), a clinical hallmark of SLE, was measured as previously described by our laboratory14,13,15. Data is presented as antibody activity calculated according to the manufacturer’s instructions.

Experimental Protocol

Mice were administered a combination of tempol (2 mM) and apocynin (1.5 mM) in the drinking water for 4 weeks (T+A). Mice were randomly divided into 4 groups: control mice administered vehicle (Control/Vehicle) or combined antioxidant therapy (Control/T+A) and SLE mice administered vehicle (SLE/Vehicle) or combined antioxidant therapy (SLE/T+A). Preliminary studies using these therapies separately showed a trend for a reduction in blood pressure that did not reach statistical significance (data not shown).

Blood Pressure

At 34 weeks of age, catheters were implanted into the left carotid artery and animals were allowed 24 hours to recover from surgery. Blood pressure was recorded in conscious, unrestrained mice via pressure transducers on at least two consecutive days as previously described by our laboratory 14,13,15. Animals were sacrificed and tissues were harvested at the end of the 34th week.

Albuminuria

Urinary albumin was monitored weekly throughout the study using dipstick analysis of 24 hour urine samples collected from mice placed in metabolic cages. Mice were considered positive for urinary albumin at 100 mg/dL (2+). Consistent with our previous work14, 35% of SLE/Vehicle mice developed albuminuria over the course of the study. Only 25% of the SLE/T+A mice and none of the control mice developed albuminuria during the study. At the conclusion of the study, urinary albumin was measured by ELISA (Alpha Diagnostic Int, San Antonio, TX) as previously published by our laboratory 14,13,15.

Hydrogen Peroxide

Urinary and renal cortical hydrogen peroxide was measured as an index of oxidative stress according to manufacturer’s instructions (Invitrogen, Eugene, OR). Urinary hydrogen peroxide is normalized to urinary creatinine. Data is presented as the percent change between treated and untreated, control and SLE mice.

Immunoblots

Renal cortical protein expression of nitrosylated proteins was determined using standard Western Blot methods as previously described 16. A mouse monoclonal anti-nitrotyrosine, clone 1A6 antibody (1:1000; Millipore, Billerica, MA) and rabbit anti-β-actin (1:2500, Abcam Inc, Cambridge, MA) were used. Proteins were visualized using an IR700-conjugated donkey anti-mouse IgG (1:4000) and IR800-conjugated donkey anti-mouse IgG (1:2000; Rockland Immunologicals, Gilbertsville, PA).

Renal cortical protein expression of antioxidant enzymes were determined using a sheep monoclonal anti-copper-zinc superoxide dismutase (CuZnSOD; 1:4000; Meridian Life Sciences), rabbit monoclonal anti-extracellular superoxide dismutase (ECSOD; 1:1000; Enzo Life Sciences, Plymouth Meeting, PA), and rabbit monoclonal anti-manganese superoxide dismutase (MnSOD; 1:1000; Enzo Life Sciences), each along with a mouse anti-β-actin (1:5000, Abcam Inc, Cambridge, MA). Proteins were visualized using an IR700-conjugated donkey anti-sheep IgG (1:10000) (or IR700-conjugated donkey anti-rabbit for MnSOD and ECSOD) and IR800-conjugated donkey anti-mouse IgG (1:2000; Rockland Immunologicals, Gilbertsville, PA).

All blots were analyzed using the Odyssey Infrared Scanner (LI-COR Biosciences, Lincoln, NE). Data are presented as a ratio of densitometry units of protein, based on band optical density, and normalized to β-actin.

Real-Time PCR

Renal cortical mRNA expression of the NADPH oxidase subunits p22phox, p47phox, and gp91phox, was measured using RNA isolation, reverse transcription and real time RT-PCR methods as previously described 17,14. The following primer sequences were used: p22 phox (forward 5′aaagaggaaaaaggggtcca, reverse 5′ taggctcaatgggagtccac), p47phox (forward 5′ atacttcaacggcctcatgg, reverse 5′ ctgttcccgaactcttctcg), gp91phox (forward 5′ tccatttccttcctggagtg, reverse 5′ cccaaccagtacagccactt), β actin (forward 5′ tgttaccaactgggacgaca, reverse 5′ ggggtgttgaaggtctcaaa). Primer pairs were located in different exons spanning at least one intronic sequence. A product-melt curve was generated at the end of the experiment to confirm the presence of a single PCR product. Data are presented as the degree of change relative to control expression levels calculated as previously described 17,14. Changes were calculated according to the Δ/Δ ct method.

Statistical Analysis

Data are presented as mean ± standard error of means (SEM). Statistical analyses were performed using Sigmastat 3.0 software (Systat, Richmond, CA). A two-way ANOVA was used to assess group and treatment effects followed by a one-way ANOVA with a Holm-Sidak post-hoc test (Holm-Sidak) to determine individual difference. A students t-test was used when comparing only two groups. Values were considered statistically different at p values < 0.05.

RESULTS

Antioxidant therapy does not alter progression of SLE

SLE disease activity, as measured by plasma levels of characteristic dsDNA autoantibodies, is increased in SLE mice compared to controls (4.2±0.6 vs. 0.6±0.1 Units; p < 0.001). Treatment with T+A therapy did not alter this activity (data not shown).

Antioxidant therapy reduces blood pressure and albuminuria during SLE

Blood pressure was increased in SLE mice compared to controls (Figure 1A; 138±4 vs. 115±3 mmHg; p < 0.001). T+A treated SLE mice had significantly reduced blood pressure in (121±1 mmHg; p = 0.005), but the treatment did not affect pressure in control mice (114±2 mmHg). As previously shown by us and others 18,15,17,13, urinary albumin was increased in SLE mice compared to controls (Figure 1B; 75404±41338 vs. 56±6 μg/mg creatinine). In T+A treated SLE mice the levels of urinary albumin were reduced (6740±6168 μg/mg creatinine) but treatment had no effect on urinary albumin in control mice.

Figure 1. Antioxidant therapy reduces blood pressure and albuminuria in SLE mice.

Figure 1

Open in a new tab

1A) Mean arterial pressure (mmHg) was significantly increased in SLE animals compared to controls (n = 6-20). Tempol + apocynin (T+A) decreased blood pressure in SLE animals, but not controls. *p < 0.05 vs. corresponding Control; +p<0.05 vs. SLE/Vehicle. 1B) Urinary albumin excretion (μg/mg creatinine) was increased in SLE animals compared to controls (n = 8-19). Tempol + apocynin (T+A) decreased albuminuria in SLE animals, but not controls.

Antioxidant therapy reduces renal oxidative stress in SLE mice

In order to assess the efficacy of the antioxidant treatment on renal oxidative stress, we measured protein nitrosylation in the renal cortex by Western Blot. Four major proteins were easily discernable on the blot at 15, 25, 42 and 50 kDa. Nitrosylation of the 15 kDa protein was significantly greater in the (22±4%, p<0.05) in SLE mice compared to controls; however, nitrosylation of this protein was not increased in SLE mice treated with T+A (Figure 2; −4±3%). The remaining nitrosylated proteins analyzed (25, 42, and 50 kDa) were not significantly increased in mice with SLE although the expression of the 25 kDa protein was reduced in control mice treated with T+A. Taken together, these data show that the antioxidant treatment was successful in reducing renal oxidative stress during SLE.

Figure 2. Antioxidant therapy reduces renal oxidative stress in SLE mice.

Figure 2

Open in a new tab

Renal cortical protein expression of the 15 kDa nitrosylated protein (measured by Western blot) was increased in SLE mice compared to controls (n=3-4). Tempol + apocynin (T+A) decreased expression in SLE mice, but not controls. *p<0.05 vs. corresponding Control; +p<0.05 vs. corresponding Vehicle.

Hydrogen peroxide measurements were made in the renal cortex and urine as a second method to demonstrate that T+A effectively reduced renal oxidative stress. Baseline renal cortical hydrogen peroxide levels were not significantly different between SLE (29 ±13 uM, n=3) and control (32±13 uM, n=3, p=0.87) mice, nor where there statistical differences between urinary hydrogen peroxide levels in vehicle treated SLE (16 ±9 uM, n=4) and control (37±3 uM, n=3, p=0.14) mice. However, treatment with T+A reduced renal cortical (Figure 3A, p=0.08) and urinary hydrogen peroxide (Figure 3B) in SLE mice but not controls (p<0.05).

Figure 3. Antioxidant therapy reduces hydrogen peroxide in SLE mice.

Figure 3

Open in a new tab

3A and 3B) Renal cortical and urinary hydrogen peroxide was reduced in SLE mice treated with tempol and apocynin but was unchanged in control animals. *p<0.05 vs. Control.

Renal pro- and antioxidant enzymes are altered in SLE

Renal cortical protein expression of MnSOD was increased by 88±27% in SLE mice compared to controls but was unchanged in T+A-treated mice of either group (Figure 4A; p = 0.044). No significant differences in renal cortical expression of ECSOD (Figure 4B) or CuZnSOD (Figure 4C) were detected among any of the experimental groups. In a subgroup of vehicle treated and T+A treated SLE mice, renal expression of the p22, p47, and gp91 phox subunits of the NADPH oxidase were measured by real time PCR (Figure 5). p47 phox expression was significantly increased in the kidneys from T+A treated SLE mice compared to vehicle treated SLE mice. The expression of p22 and gp91 was not different between the groups.

Figure 4. Antioxidants do not affect renal cortical expression of superoxide dismutases in SLE mice.

Figure 4

Open in a new tab

Renal cortical protein expression (measured by Western blot) of manganese superoxide dismutase (5A; MnSOD) was increased in SLE mice compared to controls (n=3-4), whereas expression of extracellular superoxide dismutase (5B; ECSOD) and copper zinc superoxide dismutase (5B; CuZnSOD) where unchanged. Tempol + apocynin (T+A) had no effect on any of the superoxide dismutases in either SLE or control animals. *p<0.05 vs. corresponding Control.

Figure 5. Antioxidant therapy increases renal cortical mRNA expression of subunits of NADPH oxidase in SLE mice.

Figure 5

Open in a new tab

Renal cortical mRNA expression of p47phox (measured by RT-PCR) was increased in SLE mice treated with tempol + apocynin (T+A) compared to vehicle-treated SLE mice (n=3-4). Expression of p22phox and gp91 phox was not altered in mice treated with T+A. *p<0.05 vs. SLE/Vehicle.

DISCUSSION

In the present study, we investigated whether antioxidant therapy reduces blood pressure and protects the kidneys in a model of autoimmune disease with hypertension. The major new findings of this study are 1) oxidative stress is an important mediator of autoimmune-mediated hypertension; 2) renal oxidative stress is reduced in mice treated with antioxidant therapy; 3) antioxidant therapy reduces urinary albumin excretion in mice with SLE; and 4) SLE disease activity is not altered by treatment with antioxidants.

Oxidative stress and inflammation promote hypertension

The generation of oxygen free radicals in the kidneys is widely recognized as a mechanistic contributor to the development of hypertension 19,20,21. Oxidative stress in the kidney promotes hypertension both by vascular and tubular mechanisms. For example, superoxide directly contributes to increased afferent arteriolar sensitivity to angiotensin II and promotes the myogenic response in renal microvessels 22,23,24. The net effect of this is to increase renal vascular resistance, a key mechanism in the development of hypertension. In addition to direct renal vascular effects of oxidative stress, there are renal tubular actions that promote hypertension. For example, data shows that reactive oxygen species can promote an increase in thick ascending limb expression of the sodium potassium 2 chloride transporter (NKCC) 25 leading to increased sodium and water reabsorption.

One mechanism by which oxidative stress is generated in the kidneys is through immune system activation and inflammation. This is directly supported by studies showing that angiotensin II-induced hypertension is blunted in adaptive immune deficient RAG1−/− mice replete with T lymphocytes from p47phox −/− mice 26. In addition, recent work shows an important mechanistic role for renal interstitial inflammation and oxidative stress in salt-sensitive hypertension 27. This combination of work has led to the common hypothesis that sustained hypertension results from an initial insult (i.e., angiotensin II, high salt) that causes local injury, the production of neoantigens and subsequent activation of adaptive immunity. The identity of these antigens is not yet clear, although at least in salt-sensitive hypertension, some evidence suggests that antigenic heat shock proteins may underlie the autoimmune origin for hypertension 6.

Hypertension, oxidative stress, and autoimmune disease

Data from the present study, further advances the idea that hypertension has autoimmune origins and tests whether oxidative stress is a contributing factor. Female NZBWF1 mice are a widely used and long established experimental model of SLE with hypertension. Our laboratory recently showed that NADPH oxidase activity is increased in the renal cortex from SLE mice and that treatment with etanercept, to block TNF-alpha activity, not only reduces blood pressure but also abrogates the oxidative stress 13. This led to the question addressed in the present study of whether oxidative stress mechanistically contributes to hypertension during chronic autoimmune disease. The data show that SLE mice treated with antioxidant therapy have significantly lower blood pressure than vehicle-treated animals and strongly supports an important role for oxidative stress as a contributor to autoimmune- and inflammatory-induced hypertension.

Importantly, treatment with antioxidants in mice with SLE reduced two markers of oxidative stress in the renal cortex. First, the increased protein nitrosylation in the renal cortex is ameliorated in SLE mice treated with antioxidants. Protein nitrosylation blots from renal homogenates is commonly used as a marker for oxidative stress 28,29,30. Increased renal cortical oxidative stress can directly affect renal vascular function and our published work suggests that hypertension during SLE is mediated, in part, through a renal vascular mechanism. This is based on our data showing a parallel rightward shift in the chronic pressure natriuresis relationship and that renal vascular resistance is increased in mice with SLE 15,31. Therefore, the impaired renal hemodynamics associated with SLE hypertension is consistent with the current understanding of the potential effects that reactive oxygen species have on renal vascular function 24,23,22.

The second marker of oxidative stress reduced by antioxidant treatment in mice with SLE was renal cortical and urinary hydrogen peroxide. The possibility that hydrogen peroxide is mechanistically involved in the development of SLE hypertension is intriguing because previous studies in NZBWF1 mice show that N-acetylcysteine (hydrogen peroxide scavenger) reduces renal injury and delays mortality 32.

Importantly, the data derived from experimental mouse models of SLE are consistent with evidence for oxidative stress in human SLE. For example, patients with SLE have increased serum levels of malondialdehyde and decreased serum levels of antioxidants such as glutathione peroxidase 33,34. In addition, SLE disease activity scores positively correlate with the level of superoxide generated by polymorphonuclear cells isolated from patients with SLE 33. Therefore, clinical and animal studies suggest that oxidative stress promotes SLE disease activity and the present work indicates that it is likely to contribute to the prevalent hypertension found in patients with SLE.

Pro- and anti-oxidant enzymes during SLE hypertension

Although the cell specific source of oxidative stress in the kidneys during SLE remains unclear, increased macrophage infiltration in the renal cortex suggests a role for immune cells 13. However, local inflammatory processes within the renal cortex likely promote the generation of reactive oxygen species from vascular (endothelial, smooth muscle) and tubular sources as well. Regardless of the cell types contributing to oxidative stress in the renal cortex, our previously published work suggests that NADPH oxidase activity is increased 13.

Superoxide is normally dismuted by superoxide dismutase to molecular oxygen and hydrogen peroxide, another reactive oxygen species. Therefore, we assessed renal cortical protein expression of CuZnSOD, ECSOD and MnSOD anticipating that expression of these antioxidant enzymes would be decreased during SLE. However, the data show that CuZnSOD and ECSOD expression was not different between the groups and MnSOD expression was significantly increased in the renal cortex from SLE mice. One interpretation of this data is that antioxidant enzymes like the SODs do not contribute to the initiation of oxidative stress in this model and that the increased renal cortical MnSOD is a compensatory change in response to elevated reactive oxygen species. The increased MnSOD expression may also provide some insight into the potential intracellular source of reactive oxygen species given that it is predominantly a mitochondrial enzyme. Ultimately, the conclusions from this data must be made with caution given that protein expression does not necessarily reflect the activity for these antioxidant enzymes. Detailed studies will be required to determine if there is altered mitochondrial function in the renal cortex of mice with SLE (as suggested by the MnSOD) and whether chronic treatment with scavengers of hydrogen peroxide also reduces blood pressure in SLE mice. Nevertheless, the data from this study suggest that oral antioxidants are able to reduce renal oxidative stress.

In addition to antioxidant enzymes, we measured renal cortical mRNA expression of the p22, p47 and gp91 phox subunits of the NADPH oxidase in vehicle and tempol/apocynin treated SLE mice. Somewhat unexpectedly, the expression of p47phox subunit was significantly increased in SLE mice treated with antioxidant therapy. We interpret this to suggest that the reduced oxidative stress facilitated by antioxidant treatment creates a sink leading to a compensatory increase in components of the NADPH oxidase. Therefore, the treatment with antioxidants in this study is most likely acting as a scavenger for reactive oxygen species, but not changing the underlying factors driving the oxidative stress.

PERSPECTIVES

The NZBWF1 mouse is a widely used model of autoimmune disease that closely mimics many of the characteristics of SLE in humans, including the generation of auto-antibodies, increased markers of oxidative stress, prevalent hypertension and renal damage. The data here show that oxidative stress plays an important mechanistic role in the prevalent hypertension associated with SLE. Given the speculation that hypertension has autoimmune origins, SLE is a particularly relevant and timely disease model to consider for advancing the understanding of immune mechanisms that promote hypertension. Although carefully controlled studies will be required to better define the mechanisms by which oxidative stress promotes hypertension during SLE, the present study provides some provocative leads. For example, our recently published work shows that renal vascular responses to angiotensin II are enhanced in this model 31, a physiological response that is mediated by oxidative stress in other experimental models 23,22. Moreover, the data suggests a possible role of the mitochondria and the reactive oxygen intermediate, hydrogen peroxide, as important contributor to autoimmune hypertension. Therefore, these findings advance the field by providing insight into the mechanisms that promote autoimmune induced-hypertension and provides a basis from which to design further experiments.

NOVELTY AND SIGNIFICANCE.

What is known?

  • - Chronic inflammation and oxidative stress are strongly linked to the development of hypertension.

  • - Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder with prevalent hypertension for reasons that remain unclear.

What is New?

  • - Oxidative stress is an important mechanism that contributes to the development of hypertension and albuminuria during autoimmune disease.

  • - Oxidative stress does not promote SLE disease activity, but rather likely occurs as a result of autoimmune-mediated local tissue injury and inflammation.

What is Relevant?

  • - A growing body of evidence suggests that autoimmunity is an underlying factor that promotes the development of essential (primary) hypertension in humans.

  • - Therefore, understanding mechanisms that drive the high prevalence of hypertension during autoimmune disease may have direct relevance to understanding the underpinnings of essential hypertension.

Acknowledgments

SOURCES OF FUNDING This work was supported by the National Institutes of Health (HL085907, HL085907S3, HL092284 to MJR and HL051971 to UMMC-Physiology) and the American Heart Association (postdoctoral fellowships 4350019 to KWM and 2260874 to MVP).

Footnotes

DISCLOSURES None.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.De Miguel C, Das S, Lund H, Mattson DL. T lymphocytes mediate hypertension and kidney damage in Dahl salt-sensitive rats. Am J Physiol Regul Integr Comp Physiol. 2010;298:R1136–R1142. doi: 10.1152/ajpregu.00298.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ferro CJ, Edwards NC, Hutchison C, Cockwell P, Steeds RP, Savage CO, Townend JN, Harper L. Does immunosuppressant medication lower blood pressure and arterial stiffness in patients with chronic kidney disease? An observational study. Hypertens Res. 2011;34:113–119. doi: 10.1038/hr.2010.193. [DOI] [PubMed] [Google Scholar]
  • 3.Herrera J, Ferrebuz A, MacGregor EG, Rodriguez-Iturbe B. Mycophenolate mofetil treatment improves hypertension in patients with psoriasis and rheumatoid arthritis. J Am Soc Nephrol. 2006;17:S218–S225. doi: 10.1681/ASN.2006080918. [DOI] [PubMed] [Google Scholar]
  • 4.Rodriguez-Iturbe B, Quiroz Y, Nava M, Bonet L, Chavez M, Herrera-Acosta J, Johnson RJ, Pons HA. Reduction of renal immune cell infiltration results in blood pressure control in genetically hypertensive rats. Am J Physiol Renal Physiol. 2002;282:F191–F201. doi: 10.1152/ajprenal.0197.2001. [DOI] [PubMed] [Google Scholar]
  • 5.Gudbrandsson T, Hansson L, Herlitz H, Lindholm L, Nilsson LA. Immunological changes in patients with previous malignant essential hypertension. Lancet. 1981;1:406–408. doi: 10.1016/s0140-6736(81)91790-6. [DOI] [PubMed] [Google Scholar]
  • 6.Rodriguez-Iturbe B, Franco M, Tapia E, Quiroz Y, Johnson RJ. Renal inflammation, autoimmunity and salt-sensitive hypertension. Clin Exp Pharmacol Physiol. 2012;39:96–103. doi: 10.1111/j.1440-1681.2011.05482.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Al-Herz A, Ensworth S, Shojania K, Esdaile JM. Cardiovascular risk factor screening in systemic lupus erythematosus. J Rheumatol. 2003;30:493–496. [PubMed] [Google Scholar]
  • 8.Budman DR, Steinberg AD. Hypertension and renal disease in systemic lupus erythematosus. Arch Intern Med. 1976;136:1003–1007. [PubMed] [Google Scholar]
  • 9.Petri M. Detection of coronary artery disease and the role of traditional risk factors in the Hopkins Lupus Cohort. Lupus. 2000;9:170–175. doi: 10.1191/096120300678828226. [DOI] [PubMed] [Google Scholar]
  • 10.Sabio JM, Vargas-Hitos JA, Navarrete-Navarrete N, Mediavilla JD, Jimenez-Jaimez J, Diaz-Chamorro A, Jimenez-Alonso J. Prevalence of and Factors Associated with Hypertension in Young and Old Women with Systemic Lupus Erythematosus. J Rheumatol. 2011;38:1026–1032. doi: 10.3899/jrheum.101132. [DOI] [PubMed] [Google Scholar]
  • 11.Sella EM, Sato EI, Leite WA, Oliveira Filho JA, Barbieri A. Myocardial perfusion scintigraphy and coronary disease risk factors in systemic lupus erythematosus. Ann Rheum Dis. 2003;62:1066–1070. doi: 10.1136/ard.62.11.1066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Selzer F, Sutton-Tyrrell K, Fitzgerald S, Tracy R, Kuller L, Manzi S. Vascular stiffness in women with systemic lupus erythematosus. Hypertension. 2001;37:1075–1082. doi: 10.1161/01.hyp.37.4.1075. [DOI] [PubMed] [Google Scholar]
  • 13.Venegas-Pont M, Manigrasso MB, Grifoni SC, LaMarca BB, Maric C, Racusen LC, Glover PH, Jones AV, Drummond HA, Ryan MJ. Tumor necrosis factor-alpha antagonist etanercept decreases blood pressure and protects the kidney in a mouse model of systemic lupus erythematosus. Hypertension. 2010;56:643–649. doi: 10.1161/HYPERTENSIONAHA.110.157685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Venegas-Pont M, Sartori-Valinotti JC, Maric C, Racusen LC, Glover PH, McLemore GR, Jr., Jones AV, Reckelhoff JF, Ryan MJ. Rosiglitazone decreases blood pressure and renal injury in a female mouse model of systemic lupus erythematosus. Am J Physiol Regul Integr Comp Physiol. 2009;296:R1282–R1289. doi: 10.1152/ajpregu.90992.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mathis KW, Venegas-Pont MR, Masterson CW, Wasson KL, Ryan MJ. Blood pressure in a hypertensive mouse model of SLE is not salt-sensitive. Am J Physiol Regul Integr Comp Physiol. 2011;301:R1281–R1285. doi: 10.1152/ajpregu.00386.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Venegas-Pont M, Manigrasso MB, Grifoni SC, LaMarca BB, Maric C, Racusen LC, Glover PH, Jones AV, Drummond HA, Ryan MJ. Tumor necrosis factor-alpha antagonist etanercept decreases blood pressure and protects the kidney in a mouse model of systemic lupus erythematosus. Hypertension. 2010;56:643–649. doi: 10.1161/HYPERTENSIONAHA.110.157685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ryan MJ, McLemore GR., Jr. Hypertension and Impaired Vascular Function in a Female Mouse Model of Systemic Lupus Erythematosus. Am J Physiol Regul Integr Comp Physiol. 2007;292:R736–R742. doi: 10.1152/ajpregu.00168.2006. [DOI] [PubMed] [Google Scholar]
  • 18.Burnett R, Ravel G, Descotes J. Clinical and histopathological progression of lesions in lupus-prone (NZB x NZW) F1 mice. Exp Toxicol Pathol. 2004;56:37–44. doi: 10.1016/j.etp.2004.04.010. [DOI] [PubMed] [Google Scholar]
  • 19.Wilcox CS. Reactive oxygen species: roles in blood pressure and kidney function. Curr Hypertens Rep. 2002;4:160–166. doi: 10.1007/s11906-002-0041-2. [DOI] [PubMed] [Google Scholar]
  • 20.Reckelhoff JF, Romero JC. Role of oxidative stress in angiotensin-induced hypertension. Am J Physiol Regul Integr Comp Physiol. 2003;284:R893–R912. doi: 10.1152/ajpregu.00491.2002. [DOI] [PubMed] [Google Scholar]
  • 21.Meng S, Cason GW, Gannon AW, Racusen LC, Manning RD., Jr Oxidative stress in Dahl salt-sensitive hypertension. Hypertension. 2003;41:1346–1352. doi: 10.1161/01.HYP.0000070028.99408.E8. [DOI] [PubMed] [Google Scholar]
  • 22.Just A, Olson AJ, Whitten CL, Arendshorst WJ. Superoxide mediates acute renal vasoconstriction produced by angiotensin II and catecholamines by a mechanism independent of nitric oxide. Am J Physiol Heart Circ Physiol. 2007;292:H83–H92. doi: 10.1152/ajpheart.00715.2006. [DOI] [PubMed] [Google Scholar]
  • 23.Carlstrom M, Lai EY, Ma Z, Steege A, Patzak A, Eriksson UJ, Lundberg JO, Wilcox CS, Persson AE. Superoxide dismutase 1 limits renal microvascular remodeling and attenuates arteriole and blood pressure responses to angiotensin II via modulation of nitric oxide bioavailability. Hypertension. 2010;56:907–913. doi: 10.1161/HYPERTENSIONAHA.110.159301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lai EY, Wellstein A, Welch WJ, Wilcox CS. Superoxide modulates myogenic contractions of mouse afferent arterioles. Hypertension. 2011;58:650–656. doi: 10.1161/HYPERTENSIONAHA.111.170472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ortiz PA, Garvin JL. Superoxide stimulates NaCl absorption by the thick ascending limb. Am J Physiol Renal Physiol. 2002;283:F957–F962. doi: 10.1152/ajprenal.00102.2002. [DOI] [PubMed] [Google Scholar]
  • 26.Guzik TJ, Hoch NE, Brown KA, McCann LA, Rahman A, Dikalov S, Goronzy J, Weyand C, Harrison DG. Role of the T cell in the genesis of angiotensin II induced hypertension and vascular dysfunction. J Exp Med. 2007;204:2449–2460. doi: 10.1084/jem.20070657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.De Miguel C, Guo C, Lund H, Feng D, Mattson DL. Infiltrating T lymphocytes in the kidney increase oxidative stress and participate in the development of hypertension and renal disease. Am J Physiol Renal Physiol. 2011;300:F734–F742. doi: 10.1152/ajprenal.00454.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Javeshghani D, Schiffrin EL, Sairam MR, Touyz RM. Potentiation of vascular oxidative stress and nitric oxide-mediated endothelial dysfunction by high-fat diet in a mouse model of estrogen deficiency and hyperandrogenemia. J Am Soc Hypertens. 2009;3:295–305. doi: 10.1016/j.jash.2009.07.002. [DOI] [PubMed] [Google Scholar]
  • 29.Schneider MP, Sullivan JC, Wach PF, Boesen EI, Yamamoto T, Fukai T, Harrison DG, Pollock DM, Pollock JS. Protective role of extracellular superoxide dismutase in renal ischemia/reperfusion injury. Kidney Int. 2010;78:374–381. doi: 10.1038/ki.2010.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Moningka NC, Sindler AL, Muller-Delp JM, Baylis C. Twelve Weeks of Treadmill Exercise Does Not Alter Age-Dependent Chronic Kidney Disease in the Fisher 344 Male Rat. J Physiol. 2011;589:6129–6138. doi: 10.1113/jphysiol.2011.214569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Venegas-Pont M, Mathis KW, Iliescu R, Ray WH, Glover PH, Ryan MJ. Blood pressure and renal hemodynamic responses to acute angiotension II infusion are enhanced in a female mouse model of systemic lupus erythematosus. Am J Physiol Regul Integr Comp Physiol. 2011;301:R1286–R1292. doi: 10.1152/ajpregu.00079.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Weimann BJ, Hermann D. Inhibition of autoimmune deterioration in MRL/lpr mice by vitamin E. Int J Vitam Nutr Res. 1999;69:255–261. doi: 10.1024/0300-9831.69.4.255. [DOI] [PubMed] [Google Scholar]
  • 33.Avalos I, Chung CP, Oeser A, Milne GL, Morrow JD, Gebretsadik T, Shintani A, Yu C, Stein CM. Oxidative stress in systemic lupus erythematosus: relationship to disease activity and symptoms. Lupus. 2007;16:195–200. doi: 10.1177/0961203306075802. [DOI] [PubMed] [Google Scholar]
  • 34.Waszczykowska E, Robak E, Wozniacka A, Narbutt J, Torzecka JD, Sysa-Jedrzejowska A. Estimation of SLE activity based on the serum level of chosen cytokines and superoxide radical generation. Mediators Inflamm. 1999;8:93–100. doi: 10.1080/09629359990586. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES