Abstract
CD25, the alpha chain of the interleukin-2 receptor, is expressed in activated T cells and plays a significant role in autoimmune disease and tumorigenesis; however, the mechanisms regulating transcription of CD25 remain elusive. Here we identify the Src-associated substrate during mitosis of 68kDa (Sam68) as a novel non-Rel component in the nuclear factor-kappaB (NF-κB) complex that confers CD25 transcription. Our results demonstrate that Sam68 plays an essential role in the induction and maintenance of CD25 in T cells. T cell receptor engagement triggers translocation of the inhibitor of NF-κB kinase alpha (IKKα) from the cytoplasm to the nucleus, where it phosphorylates Sam68, causing complex formation with NF-κB in the nucleus. These findings reveal the important roles of KH domain-containing components and their spatial interactions with IKKs in determining the binding targets of NF-κB complexes, thus shedding novel insights into the regulatory specificity of NF-κB.
Introduction
CD25, the alpha chain of interleukin-2 receptor (IL-2R), is inducibly expressed and required for formation of the high affinity IL-2R. Elevated expression of CD25 has been detected in T cells in an array of autoimmune diseases, allograft rejection and lymphoid neoplasms 1, and a large variety of cancers 2. Moreover, soluble CD25 shed from the cell surface has been proposed as a prognostic indicator in cancer patients, with high plasma levels correlating with poor survival rates 2. It is well known that the promoter in the CD25 gene contains multiple DNA regulatory elements that bind to key transcription factors, in particular nuclear factor-kappaB (NF-κB) and nuclear factor of activated T-cells (NF-AT); however, the mechanism(s) governing the specific transcription of CD25 in normal and tumor cells remains elusive.
Diverse stimuli can activate NF-κB and induce an ever-increasing list of target genes, which involve manifold biological activities 3–6. NF-κB binds 10 nucleotide cognate sites called κB sites that appear to be a minimal requirement for regulation, but insufficient for gene induction 7, 8. It is still a long-standing question how NF-κB selectively recognizes a small subset of relevant κB sites from the large excess of potential binding sites 6. Furthermore, the molecular size and affinity of the native NF-κB complex are of greater magnitude than can be accounted for by reconstituted heterodimers of Rel proteins 9, 10. Beyond the Rel components, we recently identified ribosomal protein S3 (RPS3) as an integral and functional component in NF-κB complexes 7. RPS3 appears to select particular genomic κB sites to be activated and preferentially directs high affinity binding to κB sites with certain sequence specificities, therefore serving as a “specifier” subunit of NF-κB 7. The identification of RPS3 suggested a new mechanism in which DNA binding activity could be regulated within NF-κB complexes by the synergistic interactions between Rel and non-Rel components 7, 8. Moreover, the significance of RPS3-dependent specific NF-κB transcription has been highlighted in an increasing number of key pathophysiological processes 7, 11–18. However, the full regulatory spectra of NF-κB cannot be fully explained by the inclusion of RPS3. There are conditions in which NF-κB accumulates in the nucleus while there is no CD25 expression, implying that NF-κB is necessary but not sufficient for CD25 induction 2. In particular, CD25 is among those NF-κB target genes whose transcription does not require RPS3 during T cell activation 7. Given its critical role in autoimmune diseases and diverse malignancies, deciphering the NF-κB-mediated specific transcription of CD25 will better our understanding of the regulatory specificity of NF-κB and elucidate novel target molecules for pharmacological interventions.
Sam68 (Src-associated substrate during mitosis of 68 kDa) belongs to the heteronulear ribonuleoprotein particle K (hnRNP K) homology (KH) domain family of RNA-binding proteins 19, 20. Sam68 is versatile protein functioning in a variety of cellular processes, ranging from regulating RNA stability, RNA alternative splicing, adipogenesis, spermatogenesis, carcinogenesis, and others 19–29. Emerging evidence suggests Sam68 functions as a signaling molecule in multiple signaling pathways 30, in particular a recently-revealed role of Sam68 in both NF-κB activation and apoptosis initiated through the TNF receptor 31. However, it remains largely unknown whether Sam68, as a preferentially nuclear protein, plays an important role in signal transduction and gene regulation in the nucleus, in spite of its emerging role in regulating transcriptional activity implicated by recent studies 32–34.
Here we identify Sam68 as a novel DNA binding component that is critical for NF-κB to specifically recognize the CD25 κB site. T cell receptor (TCR) engagement triggered the inhibitor of NF-κB kinase alpha (IKKα) translocate from the cytoplasm to the nucleus, where it phosphorylated Sam68. Phosphorylated Sam68 associated with nuclearly translocated NF-κB complexes, and facilitated binding to the CD25 κB site for full gene induction. Our results demonstrate there can be at least two biochemically distinct p65-p50 NF-κB complexes in the nucleus of the same cells at the same time, reinforcing the notion that NF-κB consists of both Rel and non-Rel subunits that actually comprise multiple protein complexes with different gene activation specificities.
Results
Recognition of CD25 κB DNA by NF-κB does not depend on RPS3
We recently identified RPS3 as non-Rel component of NF-κB that targets the NF-κB DNA binding complex to certain κB motifs 7. To examine whether RPS3 is required for recruiting the NF-κB complex to target genes during T cell activation, we performed chromatin immunoprecipitation (ChIP) to analyze the endogenous p65 recruitment to the promoters of known NF-κB target genes CD25, IL8, and NFKBIA35–37. Knockdown of RPS3 by small interfering RNAs (siRNA) remarkably attenuated the TCR stimulation-induced p65 recruitment to the κB regions of NFKBIA and IL8 promoters 7 (Fig. 1a). The p65 enrichment was specific since there was negligible recruitment of p65 to the ACTB promoter that does not contain any κB sites (Fig. 1a). By contrast, the transcription and the recruitment of p65 to the CD25 κB site was undiminished and perhaps even slightly augmented 7 (Fig. 1a). Moreover, ablation of RPS3 specifically abolished the TCR stimulation-induced NF-κB gel shift complex formed with NFKBIA κB probe (Fig. 1b, compare lanes 2 and 4), without affecting the complex formed with CD25 κB probe (Fig. 1c, compare lanes 6 and 8). These data suggest that RPS3 is not required for NF-κB to form a stable complex with CD25 κB DNA. We performed supershift assays and determined that both p65 and p50 exist in the CD25 κB DNA binding complex (Fig. 1c, lanes 10 and 11). Of note, the migration of the complexes formed with the NFKBIA κB site and the CD25 κB site opens up the possibility that they have different biochemical compositions (Fig. 1b–c). Furthermore, heterodimers formed by recombinant p65 and p50 bind poorly, whereas the nuclear extracts from NF-κB constitutively activated HUT102 lymphoma cells exhibit high-affinity to CD25 κB DNA (Fig. 1d, lanes 12 and 13). These data suggest that Rel components are not sufficient for the high affinity to CD25 κB DNA. Therefore, at least one other RPS3-like “specifier” component in the NF-κB complex could confer the recognition of CD25 κB DNA.
Sam68 is associated with the CD25 κB DNA binding complex
To explore this possibility, we utilized the human T-lymphotropic virus type I (HTLV-I)-carrying T-cell lymphoma cell line HUT102, where the NF-κB signaling and CD25 expression are constitutively activated 38 (Fig. 1d, 2a). We hypothesized the NF-κB complex binding to CD25 κB DNA could contain other KH domain proteins, as KH domains can bind both proteins and nucleic acids and therefore can potentially serve as a platform facilitating protein/protein-protein/DNA interaction 39, and they have been illustrated as essential functional components of several transcriptional complexes 40. To evaluate this hypothesis, we immunoprecipitated p65 from nuclear extracts derived from HUT102 cells and screened the immunoprecipitate with antibodies against various KH domain proteins (Table 1). RPS3 was shown to interact strongly with p65 (Table 1), indicating the active transcription of some RPS3-dependent genes in HUT102 cells. In support of this notion, the IL2 gene, whose transcription requires RPS3 7, is consistently activated by NF-κB in HUT102 cells 38. Interestingly, Sam68, another KH domain protein with remarkable nucleic acid binding capability 41, 42, exhibited strong interaction with p65 (Table 1, Fig. 2b). Moreover, the specific Sam68-p65 interaction was verified by a pull-down assay using GST-tagged Sam68 and HUT102 cell nuclear extracts (Supplementary Fig. S1).
Table 1.
KH domain proteins | p65 interaction |
---|---|
Ribosomal protein S3 (RPS3) | ++ |
Src-associated substrate during mitosis of 68 kDa (Sam68) | ++ |
Quaking homology, KH domain RNA binding (QKI) | − |
ERA G protein like 1 (ERAL1) | − |
KH domain containing, RNA binding, signal transduction associated 3 | − |
Activating signal cointegrator 1 complex subunit 1 | − |
ES cell associated transcript 1 | − |
Splicing factor 1 | − |
HRB2 | − |
Far upstream element binding protein 1 (FUBP1) | − |
Far upstream element binding protein 3 (FUBP3) | − |
Heterogeneous nuclear ribonucleoprotein K (hnRNP K) | + |
Nuclear extracts derived from HUT102 cells were immunoprecipitated with p65 antibody. The immunoprecipitates were separated on SDS-PAGE gel and immunoblotted by antibodies against indicated KH domain-containing proteins. Their binding capabilities to p65 were summarized from three experiments as ++, strong interaction; +, detectable interaction; −, undetectable interaction.
To examine whether Sam68 is a protein component that determines the recognition of CD25 κB DNA by NF-κB, we separated the nuclear extracts from HUT102 cells into sequential fractions. The CD25 κB DNA binding active fractions were collected for a subsequent DNA affinity purification to separate the potential binding protein(s) (Fig. 2c). Unexpectedly, the peaks of the CD25 κB DNA binding activities in the sequential nuclear fractions through gel filtration (Fig. 2d) did not coincide with the distribution peaks of neither p65 nor p50 in the fractions (Fig. 2e), suggesting that the p65 or p50 is not the limiting factor for NF-κB to bind the CD25 κB site as long believed. In contrast, the distribution of Sam68 better approximated the CD25 κB DNA binding activities (Fig. 2e), which hints that Sam68 could be a prerequisite for NF-κB recognizing the CD25 κB DNA. We then isolated the putative candidate(s) conferring NF-κB binding specificity to the CD25 κB site by DNA affinity purification using the enriched active fractions (26 to 30 in Fig. 2d). Both p65 and Sam68 were enriched in the affinity eluate from biotin-labeled double-stranded DNA containing 5 copies of CD25 κB sites but not in the control DNA (Fig. 2f). RPS3 was not observed in the NF-κB complex binding to the CD25 κB DNA (Fig. 2f), independently demonstrating that RPS3 is not required for NF-κB binding to the CD25 κB site 7, despite the fact that abundant RPS3 was in the nucleus and associated with p65 (Table 1). These results suggest that Sam68 could be an integral component of NF-κB DNA binding complex to the CD25 κB site.
Sam68 is an integral component in the CD25 NF-κB complex
Provided that Sam68 preferentially localizes in the nucleus (Supplementary Fig. S2) 19, we first performed chromatin immunoprecipitation (ChIP) assays to examine whether Sam68 could be recruited to the CD25 promoter. We found precipitation of either p65 or Sam68, but not isotype control, gave almost identical signal for the 200–300 base-pair CD25 promoter region containing κB sites, in HUT102 cells (Fig. 3a). In contrast, neither Sam68 nor p65 gave a significant enrichment signal for the ACTB promoter that lacks κB sites (Fig. 3a). These results suggest that Sam68 could be a component of the NF-κB complex formed at the CD25 κB site, which validates, in intact nuclear chromatin, our biochemical observation that both Sam68 and p65 were co-enriched in the affinity purification eluate using CD25 κB DNA (Fig. 2f).
To determine whether Sam68 is incorporated into the NF-κB DNA-binding complex, we utilized electrophoretic mobility shift assays (EMSAs) with nuclear extracts derived from either resting or stimulated Jurkat cells. PMA stimulation strongly induced formation of an NF-κB band as probed by CD25 κB oligonucleotides (Fig. 3b, compare lane 2 and to lane 1). The specificity of the band was confirmed by cold oligonucleotide competition: CD25 κB oligonucleotides competed away, whereas OCT1 oligonucleotides did not diminish, the induced band (Supplementary Fig. S3). The addition of p65 antibody indicated that the induced band contains the NF-κB p65 subunit (Fig. 3b, lane 3), consistent with previous reports 7. More importantly, Sam68 antibody blocked the formation of CD25 κB DNA binding complexes, in a dose-dependent manner (Fig. 3b, lanes 4 and 5), verifying that endogenous Sam68 is an integral component for the NF-κB complex that forms with the CD25 κB oligonucleotides. A similar result was obtained in nuclear extracts from HUT102 cells, where CD25 is constitutively activated through NF-κB (Fig. 3b, lanes 7–10). Of note, the distinct migration of PMA-induced CD25 κB DNA binding complex in Jurkat cells and constitutively activated CD25 κB DNA binding complex in HUT102 cells (Fig. 3b, compare lane 2 and to lane 7), suggests again that other component(s) beyond Rel subunits complex with the CD25 κB DNA and at least Sam68 is one of such protein(s).
The notion that Sam68 and p65 could be jointly recruited as an NF-κB complex to the CD25 κB site was further supported by a structure-function study (Fig. 3c–e, Supplementary Fig. S4). Using various truncations of Sam68, we sought to understand the key domain(s) in Sam68 for its interaction with p65. We detected the association of full length, ΔN, and ΔC truncated Sam68 to p65, but not GFP vehicle (Fig. 3d). In contrast, deletion of the essential core of KH domain (a.a. 165–224) of Sam68 abolished the Sam68-p65 association (Fig. 3d). In a reverse immunoprecipitation, we obtained similar results (Fig. 3e), thus confirming the KH domain of Sam68 is required for p65 binding. The corresponding analysis of p65 revealed the Rel homolog domain (RHD, a.a. 1–311) was necessary, whereas neither the N-terminal portion nor the dimerization domain of p65 was sufficient for Sam68 binding (Supplementary Fig. S4). The RHD domain of p65 and the KH domain of Sam68 both possess nucleic acid binding capabilities, thus Sam68 could regulate the binding of NF-κB complexes to CD25 κB DNA.
Sam68 is critical for CD25 gene transcription
To evaluate the role of Sam68 in NF-κB-mediated CD25 gene transcription, we examined luciferase reporter genes in Jurkat cells following Sam68 knockdown. Corresponding to the knockdown efficiency (Fig. 4a), Sam68 silencing dramatically attenuated p65 overexpression-induced luciferase reporter expression driven by a CD25 κB promoter (Fig. 4b). By contrast, knockdown of Sam68 did not decrease the induced expression of a luciferase reporter driven by either the activator protein 1 (AP-1) or NF-AT promoter (Supplementary Fig. S5). Moreover, Sam68 knockdown remarkably attenuated the CD25 mRNA levels in Jurkat cells stimulated with PMA plus ionomycin (PMA/I) (Fig. 4c) and HUT102 cells (Supplementary Fig. S6). Taken together, these data indicate a specific role of Sam68 in CD25 transcription.
CD25, a transmembrane protein, is critical for hematologic cells to achieve a high affinity binding of IL-2 (ref 1). TCR engagement causes resting human T lymphocytes to transcriptionally upregulate several activation/proliferation mediators, in particular CD25 whose inducible expression depends on p65 but not RPS3 (ref 7). Interestingly, knockdown of either Sam68 or p65, compared to non-specific scramble siRNA oligonucleotides, retarded the PMA/I-or TCR engagement-induced CD25 induction in human T lymphocytes (Fig. 4d and Supplementary Fig. S7). Consequently, attenuated cell surface CD25 expression due to Sam68 or p65 knockdown impaired TCR-induced human T lymphocyte proliferation (Fig. 4d). We further examined whether Sam68 is required to maintain the elevated CD25 in lymphocytes by transfecting siRNAs into activated human CD4+CD25+ cells. As expected, nonspecific siRNA silenced cells still maintained high surface CD25 expression (Fig. 4e). In contrast, Sam68 knockdown markedly attenuated surface CD25 expression, to a similar extent as p65 knockdown 7 (Fig. 4e). Together these results indicate that Sam68 is an important component of the CD25 NF-κB complex in both resting and activated T lymphocytes.
To assess the impact of Sam68 on the TCR engagement-induced NF-κB gene transcription, which is critical for lymphocyte activation and proliferation 7, 43, 44, we examined the effect of Sam68 knockdown on the induction of a subset of NF-κB genes in Jurkat cells. Compared to non-specific scramble siRNA transfected cells, Sam68 knockdown significantly attenuated the TCR stimulation-induced CD25, BIRC3, NFKB2, and CD83 genes (Supplementary Fig. S8). In contrast, Sam68 knockdown augmented the BIRC2 and IL8 gene expression, and had no effect on the induction of CCL1, USP12, NFKBIA, and TNFAIP3 genes (Supplementary Fig. S8). Analogous with RPS3, as we reported previously 7, 8, Sam68 appears to control transcription of a selective subset of NF-κB target genes, in line with the evidence that it was only detected in a fraction of NF-κB DNA binding complexes (Fig. 2e).
Sam68 does not function as an adaptor in TCR signaling
Containing several consensus domains to interact with SH3 domain-containing proteins and tyrosine kinases, Sam68 was proposed to function as an adaptor protein in lymphocyte activation signaling 19, 34. Moreover, Sam68 was recently shown to participate in the TNF signaling pathway 31. We thus tested whether it functions as a signaling adaptor in TCR engagement-induced NF-κB signaling. We first verified that the Sam68 expression was not regulated during T cell activation (Fig. 5a and Supplementary Fig. S9). The CD3/CD28 antibodies and PMA/I-induced IκBα degradation in Jurkat cells with Sam68 knockdown was identical, if not more dramatic, to that in the cells transfected with nonspecific siRNA (Fig. 5a). Moreover, PMA/I-induced an identical portion of p65 translocation from the cytosol to the nucleus in the control and Sam68 knockdown Jurkat cells (Fig. 5b). We further verified this result by immunofluorescence staining of p65 in Jurkat cells (Fig. 5c), and our quantified results showed that PMA/I-triggered a significant p65 nuclear translocation in Sam68 knockdown cells, similar to the control cells (Fig. 5d). Together all these results demonstrate that Sam68 is not essential for the TCR engagement-initiated cytoplasmic signaling, which suggests that Sam68 most likely does not function as an adaptor molecule for TCR stimulation-induced NF-κB signaling.
Sam68 is phosphorylated by IKKα in the nucleus
Sam68 appeared to not be associated with p65 in resting Jurkat cells; however, they complexed in the nucleus upon stimulation (Supplementary Fig. S10), indicating an inducible interaction between Sam68 and p65 during T cell activation. To understand how Sam68 participates in the NF-κB complex for CD25 gene transcription, we explored the post-translational modulation(s) of Sam68 during TCR engagement-induced NF-κB activation. Phosphorylation of Sam68 was previously shown to be critical for its nucleic acid binding activity 19, 24, which led us to examine Sam68 phosphorylation during NF-κB activation. Our results revealed that Sam68 was phosphorylated at certain serine residue(s) in the nucleus following PMA/I stimulation (Fig. 6a). The IKK complex is an important group of serine/threonine kinases in NF-κB activation, which mainly consists of a regulatory subunit IKKγ and two catalytic subunits, IKKα and IKKβ4, 5. Among them, IKKβ is almost an entirely cytoplasmic protein, whereas IKKα possesses a nuclear localization sequence (NLS) 4, 5 that permits its nuclear translocation for NF-κB-dependent gene transcription 45, 46. In line with these findings, we observed a dramatic nuclear translocation of IKKα, in contrast to a modest nuclear accumulation of IKKβ in stimulated Jurkat cells, as shown by subcellular fractionation (Fig. 6b) and immunofluorescence microscopy (Fig. 6c). Moreover, Sam68, which preferentially localizes in the nucleus, did not appear to move from the cytoplasm in response to stimulation (Fig. 5b, c), thus apparently ruling out the possibility that IKKβcould phosphorylate Sam68 in the cytoplasm. Furthermore, the Sam68 serine-phosphorylation occurred in parallel with increased IKKα nuclear accumulation in activated Jurkat cells (Fig. 6a, b), hinting that IKKα could phosphorylate Sam68 in the nucleus. In support of this notion, IKKα as well as its active form was detected in the nucleus of HUT102 cells with high CD25 expression, but not Jurkat cells with low levels of surface CD25 (Supplementary Fig. S11). Together these results suggest a potential link between IKKα nuclear translocation and CD25 expression via the phosphorylation of Sam68.
By sequence alignment, a region within Sam68 (a. a. 112–117) was revealed to be similar to the characterized IKK consensus motif, DpSGµXpS/T 4 (Fig. 6d). We therefore examined whether Sam68 could be a novel substrate of IKKα by an in vitro kinase assay. Besides autophosphorylation, recombinant IKKα strongly phosphorylated GST-Sam68, but not GST control (Fig. 6e), indicating that Sam68 is an IKKα substrate. To address the importance of the serines 113 and 117 (S113/S117) phosphorylation for Sam68’s function in NF-κB signaling, we generated a S113A/S117A (SSAA) mutant Sam68 with the serines substituted with alanines, and examined the association of Sam68 to p65 and its ability to drive the CD25 κB site-luciferase reporter expression. The p65-Sam68 interaction was substantially attenuated by the alanine substitution in the stimulated Jurkat cells (Fig. 6f). This result suggests that the S113/S117 phosphorylation is critical for Sam68 to associate with p65, in line with the induced Sam68-p65 interaction during T cell activation (Supplementary Fig. S10). Moreover, ectopic expression of wild-type Sam68, together with p65, induced the CD25 κB-driven luciferase reporter expression. By contrast, the SSAA mutant Sam68 overexpression induced luciferase reporter gene expression was reduced 55%, compared with the wild-type Sam68 (Fig. 6g), suggesting that the alanine substitution dampens the Sam68- and p65-dependent CD25 reporter gene transactivation. Similarly, the induction of the CD25 κB luciferase reporter gene by overexpression of p65 with the ΔKH truncated Sam68, another mutant with diminished interaction with p65 (Fig. 3d–e), was also markedly attenuated (Supplementary Fig. S12). Our results hence suggest that the S113/S117 phosphorylation is key for the Sam68-p65 association and its conferred CD25 gene transcription.
To examine whether endogenous Sam68 was phosphorylated by IKKα, we generated an antibody that recognizes the S113/S117 phosphorylated form of Sam68. Indeed, we confirmed that endogenous Sam68 was S113/S117 phosphorylated in a time-dependent manner upon TCR activation in Jurkat cells (Fig. 6h). Thus, our results illustrate the serine phosphorylation of Sam68 by IKKα in the nucleus is critical for the NF-κB-mediated selective transcription of the CD25 gene, thus adding a new layer of specificity to the TCR-induced NF-κB activation.
Discussion
Sam68 is involved in various cellular processes including signal transduction, transcription, RNA metabolism, cell cycle regulation and apoptosis 19, 20, however, its physiological role, especially in lymphocyte activation has been enigmatic. Emerging evidences implicate that Sam68 plays a critical role in transcriptional regulation. Specifically, Sam68 binds to hnRNP K and subsequently inhibits the latter’s function in transactivation of c-myc target genes 32. Moreover, Sam68 was proposed to function as a transcriptional coregulator to enhance the transcriptional activity of the androgen receptor and mixed lineage leukemia (MLL) complex 33, 34. Here we show that Sam68 is recruited to the CD25 promoter and facilitates p65 binding to CD25 κB DNA in normal and transformed human T cells, suggesting a novel role of Sam68 in NF-κB gene regulation. More importantly, we now discovered a major physiological role for Sam68 in human lymphocyte activation. Of note, our preliminary study indicates that Sam68 appears dispensable for receptor engagement induced CD25 expression in mouse T cells. The different requirement for Sam68 in the CD25 promoter recognition could be due to the distinct usage of the NF-κB Rel components to initiate CD25 gene transactivation in human versus mouse T cells. The p65 and p50 subunits are the major NF-κB Rel components in the CD25 κB DNA binding complex in the normal and transformed human T cells (Fig. 1c, Fig. 2e, Fig. 3b), and knockdown of Sam68 markedly impairs the CD25 upregulation, cell activation and proliferation in human T cells (Fig. 4c–e). In contrast, c-Rel was proposed to be the key NF-κB subunit supporting CD25 gene expression in mouse T cells 47, 48. Hence our results reveal an important role of Sam68 in regulating human T cell signaling and CD25 expression. The Sam68 function in mice and the distinct roles of Sam68 in human and mouse T cell signaling are certainly worth further investigation.
The IKK complex contains three major components: catalytic subunits IKKα and IKKβ and regulatory subunit IKKγ 4, 49. IKKβ is the major kinase that phosphorylates IκBα and appears to be almost an entirely cytoplasmic protein 4, 50; whereas recent studies demonstrate that IKKα can enter the nucleus with a functional NLS 51. The nuclear IKKα has been thought to largely remove negative regulators of NF-κB-dependent gene transcription by phosphorylating the transcriptional repressor complex 52, chromatin-bound p65 53, or CREB-binding protein 46. Strikingly, IKKα was shown to be recruited, together with p65, onto NF-κB target gene promoters where IKKα-mediated phosphorylation of histone H3 thus modulates chromatin accessibility 45, 54. More recently, a promoter-specific function of IKKα in the nucleus was highlighted by the finding that nuclear IKKα was required for p65 DNA binding in a gene-specific manner albeit with no involvement of the histone H3 modification 55. Here we demonstrated Sam68, a preferentially nuclear protein, is a novel substrate of IKKα. Therefore, IKKα appears to play a more sophisticated role in specifying NF-κB transcription by modulating multiple proteins in the nucleus.
CD25 plays a significant role in both hematopoietic malignancies and solid tumors 2. CD25 expression and aberrant NF-κB signaling in the tumors themselves can lead to increased proliferation, anti-apoptotic protein expression and drug resistance. Monoclonal antibodies against CD25 are a significant treatment for patients with CD25-expressed cancers 56; however, inadequate delivery of the antibody directly to the tumor site may still be problematic, especially in patients with solid tumors expressing CD25. Sam68, a non-Rel component of NF-κB that confers CD25 gene transcription, could be a novel target for pharmacological interventions. Small molecule inhibitors targeting the p65-Sam68 association may be used to extinguish CD25 expression, in particular in tumors that depend on CD25 for survival.
Methods
Cells and Reagents
Jurkat E6.1, CEM, MT-2, HEK293T (purchased from ATCC) and HUT102 (kindly provided by T. Waldmann at NCI) cells were cultured in RPMI 1640 medium containing 10% fetal calf serum, 2 µM glutamine, and 100 U/ml each of penicillin and streptomycin. Human peripheral blood lymphocytes were isolated from healthy donor blood as previously described 7. Antibodies used were: p65, p50, Sam68, IκBα and (Santa Cruz); β-actin, FLAG, and HA (Sigma); CD25, Caspase3, IKKα, IKKβ, and PARP (BD); phospho-Serine (Millipore); MYC and PKCθ (Cell Signaling) and GFP (Roche). RPS3 rabbit antibody was as described 7. The rabbit polyclonal antibody specific for S113 and S117 phosphorylated Sam68 was generated and affinity purified using the peptide NH2-CAEKD(Sp)LDP(Sp)FTH-COOH by Primm (Cambridge, MA). Recombinant p65 and p50 proteins were purchased from Active Motif Inc.
Plasmid Constructs
The pEGFP-p65 as well as various p65 truncation constructs, and pGEX-Sam68, pMYC-Sam68, pEGFP-Sam68 as well as various Sam68 truncation constructs were described previously 7, 57. The SSAA mutant of Sam68 was generated by site-directed mutagenesis using the Quick Change Kit (Stratagene) with appropriate primers for S113A/S117A, and verified by DNA sequencing.
RNA Interference and Transfection
The siRNA (sense-strand sequence) Sam68-duplex1, 5’-CCUGCACCAGAAACAUACGAAGAUU -3’; Sam68-duplex2, 5’- GAGAGCAUCCAUAUGGACGUUAUUA -3’; Sam68-duplex3, 5’- GAGACUGGUGCAAAGAUCUCUGUAU -3’ (Life Technologies). CD25 pool siRNA was purchased from Santa Cruz. The siRNA sequences for human RPS3 and p65 have been described 7. Transient transfection of siRNA and/or DNA constructs into Jurkat cells, HEK293T cells, resting and activated human peripheral blood lymphocytes were performed as described previously 7.
Subcellular Fractionation and DNA Affinity Purification
Subcellular fractionation was performed by differential centrifugation as described 7. In brief, cells were resuspended in ice-cold Buffer A (10 mM HEPES pH7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.4% NP-40, 0.5 mM PMSF, 1 × complete protease inhibitor cocktail [Roche]). Pellets were incubated in Buffer C (20 mM HEPES pH7.9, 420 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.5 mM PMSF, 0.2 mM EDTA, 0.5 mM DTT, 1 × complete protease inhibitor cocktail). The nuclear extract from HUT102 cells was adjusted to 20 mM HEPES buffer (pH7.9) containing150 mM NaCl, 10% glycerol, 0.5 mM DTT, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM MgCl2 and fractionated on Superose 6 column (GE Healthcare) by gel filtration chromatography. Fractions were separated by SDS-PAGE followed by western blotting or assayed for specific CD25 κB DNA-binding activity using EMSAs. Active fractions (24 to 28) were pooled and then further purified by DNA affinity. Following a preincubation with 30 µg/ml poly(dI-dC) competitor DNA, protein fractions were further purified with biotin-labeled vehicle oligonucleotides or double-stranded DNA containing 5 copies of CD25 κB sites and Streptavidin Sepharose (GE Healthcare) at 4°C with gentle agitation for 2h. The affinity-purified polypeptides were electrophoresed on SDS-PAGE followed by Western Blotting.
Luciferase Reporter Gene Assays
Luciferase reporter gene assays were performed as previously described 7. Briefly, cells were cotransfected at a ratio of 10:1 with various promoter-driven firefly luciferase constructs to the renilla luciferase pTKRL plasmid, together with indicated cDNA under some conditions. Cells were cultured for 1–2 days and then stimulated in triplicate before harvest. Lysates were analyzed using the Dual-Luciferase Kit (Promega).
Chromatin Immunoprecipitation (ChIP)
ChIP assays were performed as described 7. The following primers were used to amplify the promoter region adjacent to the corresponding κB site: human CD25 promoter (−437 to −234): 5' - GAATATTGGAGGCTGCCTGA -3' and 5' - TCAGCTACGCCCATAAAAGG -3' 58, human NFKBIA promoter (−316 to −15): 5'-GACGACCCCAATTCAAATCG-3' and 5' -TCAGGCTCGGGGAATTTCC-3'; human IL8 promoter (−121 to +61): 5'-GGGCCATCAGTTGCAAATC-3' and 5'-TTCCTTCCGGTGGTTTCTTC-3'; and human ACTB promoter (−980 to −915): 5' -TGCACTGTGCGGCGAAGC-3' and 5' -TCGAGCCATAAAAGGCAA-3' 7.
Electrophoretic Mobility Shift Assays (EMSAs)
EMSAs were carried out as described 7, 59. Double-stranded oligonucleotide probes (sense strand shown) used were NFKBIA-κB, 5’-CTGGTCGGAAGGACTTTCCAGCCAC-3’; CD25-κB, 5’-CGGCAGGGGAATCTCCCTCTCC-3’. Samples were resolved on 6% DNA retardation gel (Life Technologies) in 0.25 × TBE buffer, and autoradiography was carried out on dried gels.
Immunofluorescence Microscopy
Confocal microscopy was performed as previously describe 7. Briefly, cells were fixed with 4 % paraformaldehyde in PBS and then Cellspin mounted onto slides. After a 5-min permeabilization with 0.05 % Triton X-100 in PBS, the fixed cells were stained with appropriate primary antibodies for 45 min, and FITC- or AlexaFluor 594-conjugated secondary antibodies (Life Technologies) for 45 min together with 1 µg/ml of Hoechst 33342 (Sigma) for 5 min at 25 °C. The slides were then rinsed with PBS three times and cover mounted for fluorescence microscopy.
Immunoprecipitation and Western Blot
The cells were harvested and lysed on ice by 0.4 ml of TNTG lysis buffer (30 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1% Triton X-100, and 10% glycerol, 1 × complete protease inhibitor cocktail) for 30 min. The lysates were centrifuged at 10,000 × g at 4°C for 10 min. The protein-normalized lysates were subjected to immunoprecipitation by adding 10 µg/ml of the appropriate antibody, 30 µl of protein G-agarose (Roche), and rotating for more than 2 hr in the cold room. The precipitates were washed at least five times with cold TNTG lysis buffer followed by a separation by SDS-PAGE under reduced and denaturing conditions. The resolved protein bands were transferred onto nitrocellulose membranes, probed as described previously 7, 58 and developed by the Super Signaling system (Pierce, Rockford, IL) according to the manufacturer's instructions.
Real-Time PCR
The RNA isolation and cDNA preparation were as described 7. Real-time PCR reactions were performed in triplicate using the SYBR Green PCR Master Mix (Applied Biosystems) in a 7900HT sequence detection system (Applied Biosystems) with the following primers: GAPDH-f, 5'- CACATCAAGAAGGTGGTG -3'; and GAPDH-r, 5'-TGTCATACCAGGAAATGA -3'; CD25-f, 5'- CCAGAGATCCCACACGCCACATTCAAAG -3'; and CD25-r, 5'- GCATTGACATTGGTTGTCCCAGGACGAG -3'. The relative transcription level was calculated using the ΔΔCt method.
In Vitro Kinase Assay
Kinase-active recombinant IKKα protein was purchased from Millipore (Billerica, MA). Bacterially purified glutathione S-transferase (GST) and GST-Sam68 were used as substrates. In vitro kinase assay was performed as described 11. Briefly, enzyme (100 ng) and substrate (2 µg) were incubated in reaction buffer (25 mM Tris–HCl [pH 8.0], 50 mM KCl, 10 mM MgCl2, 1 mM DTT, 1 mM Na3VO4, 1 mM ATP) with 0.5 µCi 32P-γ-ATP (GE Healthcare) added at 37°C for 30 min. The reactions were resolved by SDS–PAGE and visualized by autoradiography.
Supplementary Material
Acknowledgements
We are grateful to Michael J. Lenardo (National Institute of Allergy and Infectious Diseases) for support in initiating this work; Thomas Waldmann (National Cancer Institute) for providing the HUT102 cells; Lily Koo (National Institute of Allergy and Infectious Diseases) for help with fluorescence microscopy; Pierre Coulombe (Johns Hopkins University) for use of equipment. F.W. was supported by a Research Scholar Grant, RSG-13-052-01-MPC from the American Cancer Society. E.M.W. and A.H. are Hopkins Sommer Scholars. This work was supported in part by National Institutes of Health Grant R00CA137171 (to F.W.) and T32CA009110 (to E.M.W.).
Footnotes
Author contributions
K.F., X.S., W.Z., E.M.W., A.H., and F.W. performed the experiments and analyzed the data. D.Q.T. and S.R. helped with critical reagents. F.W. oversaw the project, designed the experiments, and wrote the manuscript. K.F., X.S., and W.Z. contributed equally to this study. All authors discussed the results and commented on the manuscript.
Competing financial interests
The authors declare that they have no conflict of interest.
References
- 1.Morris JC, Waldmann TA. Advances in interleukin 2 receptor targeted treatment. Ann. Rheum. Dis. 2000;59(Suppl 1):i109–i114. doi: 10.1136/ard.59.suppl_1.i109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kuhn DJ, Dou QP. The role of interleukin-2 receptor alpha in cancer. Front. Biosci. 2005;10:1462–1474. doi: 10.2741/1631. [DOI] [PubMed] [Google Scholar]
- 3.Wan F, Lenardo MJ. The nuclear signaling of NF-kappaB: current knowledge, new insights, and future perspectives. Cell Res. 2010;20:24–33. doi: 10.1038/cr.2009.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hayden MS, Ghosh S. Shared principles in NF-kappaB signaling. Cell. 2008;132:344–362. doi: 10.1016/j.cell.2008.01.020. [DOI] [PubMed] [Google Scholar]
- 5.Vallabhapurapu S, Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol. 2009;27:693–733. doi: 10.1146/annurev.immunol.021908.132641. [DOI] [PubMed] [Google Scholar]
- 6.Smale ST. Hierarchies of NF-kappaB target-gene regulation. Nat. Immunol. 2011;12:689–694. doi: 10.1038/ni.2070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wan F, et al. Ribosomal protein S3: a KH domain subunit in NF-kappaB complexes that mediates selective gene regulation. Cell. 2007;131:927–939. doi: 10.1016/j.cell.2007.10.009. [DOI] [PubMed] [Google Scholar]
- 8.Wan F, Lenardo MJ. Specification of DNA binding activity of NF-kB proteins. Cold Spring Harb. Perspect. Biol. 2009;1:a000067. doi: 10.1101/cshperspect.a000067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Phelps CB, Sengchanthalangsy LL, Malek S, Ghosh G. Mechanism of kappa B DNA binding by Rel/NF-kappa B dimers. J. Biol. Chem. 2000;275:24392–24399. doi: 10.1074/jbc.M003784200. [DOI] [PubMed] [Google Scholar]
- 10.Urban MB, Schreck R, Baeuerle PA. NF-kappa B contacts DNA by a heterodimer of the p50 and p65 subunit. Embo J. 1991;10:1817–1825. doi: 10.1002/j.1460-2075.1991.tb07707.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wan F, et al. IKKbeta phosphorylation regulates RPS3 nuclear translocation and NF-kappaB function during infection with Escherichia coli strain O157:H7. Nat. Immunol. 2011;12:335–343. doi: 10.1038/ni.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cadera EJ, et al. NF-kappaB activity marks cells engaged in receptor editing. J. Exp. Med. 2009;206:1803–1816. doi: 10.1084/jem.20082815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mokhtari D, Barbu A, Mehmeti I, Vercamer C, Welsh N. Overexpression of the nuclear factor-kappaB subunit c-Rel protects against human islet cell death in vitro. Am. J. Physiol. Endocrinol. Metab. 2009;297:E1067–E1077. doi: 10.1152/ajpendo.00212.2009. [DOI] [PubMed] [Google Scholar]
- 14.Sen N, et al. Hydrogen sulfide-linked sulfhydration of NF-kappaB mediates its antiapoptotic actions. Mol. Cell. 2012;45:13–24. doi: 10.1016/j.molcel.2011.10.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Perkins ND. Cysteine 38 holds the key to NF-kappaB activation. Mol. Cell. 2012;45:1–3. doi: 10.1016/j.molcel.2011.12.023. [DOI] [PubMed] [Google Scholar]
- 16.Gao X, et al. Bacterial effector binding to ribosomal protein s3 subverts NF-kappaB function. PLoS Pathog. 2009;5:e1000708. doi: 10.1371/journal.ppat.1000708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pham TH, et al. Functional differences and interactions between the Escherichia coli type III secretion system effectors NleH1 and NleH2. Infect. Immun. 2012;80:2133–2140. doi: 10.1128/IAI.06358-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wier EM, Neighoff J, Sun X, Fu K, Wan F. Identification of an N-terminal truncation of the NF-kappaB p65 Subunit that specifically modulates ribosomal protein S3-dependent NF-kappaB gene expression. J. Biol. Chem. 2012;287:43019–43029. doi: 10.1074/jbc.M112.388694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lukong KE, Richard S. Sam68, the KH domain-containing superSTAR. Biochim. Biophys. Acta. 2003;1653:73–86. doi: 10.1016/j.bbcan.2003.09.001. [DOI] [PubMed] [Google Scholar]
- 20.Rajan P, et al. Regulation of gene expression by the RNA-binding protein Sam68 in cancer. Biochem. Soc. Trans. 2008;36:505–507. doi: 10.1042/BST0360505. [DOI] [PubMed] [Google Scholar]
- 21.Huot ME, et al. The Sam68 STAR RNA-binding protein regulates mTOR alternative splicing during adipogenesis. Mol. Cell. 2012;46:187–199. doi: 10.1016/j.molcel.2012.02.007. [DOI] [PubMed] [Google Scholar]
- 22.Iijima T, et al. SAM68 regulates neuronal activity-dependent alternative splicing of neurexin-1. Cell. 2011;147:1601–1614. doi: 10.1016/j.cell.2011.11.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bielli P, Busa R, Paronetto MP, Sette C. The RNA-binding protein Sam68 is a multifunctional player in human cancer. Endocr. Relat. Cancer. 2011;18:R91–R102. doi: 10.1530/ERC-11-0041. [DOI] [PubMed] [Google Scholar]
- 24.Henao-Mejia J, et al. Suppression of HIV-1 Nef translation by Sam68 mutant-induced stress granules and nef mRNA sequestration. Mol. Cell. 2009;33:87–96. doi: 10.1016/j.molcel.2008.11.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Richard S. Reaching for the stars: Linking RNA binding proteins to diseases. Adv. Exp. Med. Biol. 2010;693:142–157. [PubMed] [Google Scholar]
- 26.Sette C. Post-translational regulation of star proteins and effects on their biological functions. Adv. Exp. Med. Biol. 2010;693:54–66. doi: 10.1007/978-1-4419-7005-3_4. [DOI] [PubMed] [Google Scholar]
- 27.Matter N, Herrlich P, Konig H. Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature. 2002;420:691–695. doi: 10.1038/nature01153. [DOI] [PubMed] [Google Scholar]
- 28.Paronetto MP, et al. Sam68 regulates translation of target mRNAs in male germ cells, necessary for mouse spermatogenesis. J. Cell Biol. 2009;185:235–249. doi: 10.1083/jcb.200811138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.He JJ, Henao-Mejia J, Liu Y. Sam68 functions in nuclear export and translation of HIV-1 RNA. RNA Biol. 2009;6:384–386. doi: 10.4161/rna.6.4.8920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Najib S, Martin-Romero C, Gonzalez-Yanes C, Sanchez-Margalet V. Role of Sam68 as an adaptor protein in signal transduction. Cell Mol. Life Sci. 2005;62:36–43. doi: 10.1007/s00018-004-4309-3. [DOI] [PubMed] [Google Scholar]
- 31.Ramakrishnan P, Baltimore D. Sam68 is required for both NF-kappaB activation and apoptosis signaling by the TNF receptor. Mol. Cell. 2011;43:167–179. doi: 10.1016/j.molcel.2011.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yang JP, Reddy TR, Truong KT, Suhasini M, Wong-Staal F. Functional interaction of Sam68 and heterogeneous nuclear ribonucleoprotein K. Oncogene. 2002;21:7187–7194. doi: 10.1038/sj.onc.1205759. [DOI] [PubMed] [Google Scholar]
- 33.Rajan P, et al. The RNA-binding and adaptor protein Sam68 modulates signal-dependent splicing and transcriptional activity of the androgen receptor. J. Pathol. 2008;215:67–77. doi: 10.1002/path.2324. [DOI] [PubMed] [Google Scholar]
- 34.Cheung N, Chan LC, Thompson A, Cleary ML, So CW. Protein arginine-methyltransferase-dependent oncogenesis. Nat. Cell Biol. 2007;9:1208–1215. doi: 10.1038/ncb1642. [DOI] [PubMed] [Google Scholar]
- 35.Tan TH, et al. Kappa B site-dependent activation of the interleukin-2 receptor alpha-chain gene promoter by human c-Rel. Mol. Cell. Biol. 1992;12:4067–4075. doi: 10.1128/mcb.12.9.4067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kunsch C, Lang RK, Rosen CA, Shannon MF. Synergistic transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-IL-6. J. Immunol. 1994;153:153–164. [PubMed] [Google Scholar]
- 37.Haskill S, et al. Characterization of an immediate-early gene induced in adherent monocytes that encodes I kappa B-like activity. Cell. 1991;65:1281–1289. doi: 10.1016/0092-8674(91)90022-q. [DOI] [PubMed] [Google Scholar]
- 38.Bunn PA, Jr., Foss FM. T-cell lymphoma cell lines (HUT102 and HUT78) established at the National Cancer Institute: history and importance to understanding the biology, clinical features, and therapy of cutaneous T-cell lymphomas (CTCL) and adult T-cell leukemia-lymphomas (ATLL) J. Cell. Biochem. 1996;24:12–23. doi: 10.1002/jcb.240630503. [DOI] [PubMed] [Google Scholar]
- 39.Glisovic T, Bachorik JL, Yong J, Dreyfuss G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 2008;582:1977–1986. doi: 10.1016/j.febslet.2008.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Moumen A, Masterson P, O’Connor MJ, Jackson SP. hnRNP K: an HDM2 target and transcriptional coactivator of p53 in response to DNA damage. Cell. 2005;123:1065–1078. doi: 10.1016/j.cell.2005.09.032. [DOI] [PubMed] [Google Scholar]
- 41.Taylor SJ, Shalloway D. An RNA-binding protein associated with Src through its SH2 and SH3 domains in mitosis. Nature. 1994;368:867–871. doi: 10.1038/368867a0. [DOI] [PubMed] [Google Scholar]
- 42.Fumagalli S, Totty NF, Hsuan JJ, Courtneidge SA. A target for Src in mitosis. Nature. 1994;368:871–874. doi: 10.1038/368871a0. [DOI] [PubMed] [Google Scholar]
- 43.Cheadle C, et al. Control of gene expression during T cell activation: alternate regulation of mRNA transcription and mRNA stability. BMC Genomics. 2005;6:75. doi: 10.1186/1471-2164-6-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Lam LT, et al. Compensatory IKKalpha activation of classical NF-kappaB signaling during IKKbeta inhibition identified by an RNA interference sensitization screen. Proc. Natl. Acad. Sci. USA. 2008;105:20798–20803. doi: 10.1073/pnas.0806491106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Yamamoto Y, Verma UN, Prajapati S, Kwak YT, Gaynor RB. Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature. 2003;423:655–659. doi: 10.1038/nature01576. [DOI] [PubMed] [Google Scholar]
- 46.Huang WC, Ju TK, Hung MC, Chen CC. Phosphorylation of CBP by IKKalpha promotes cell growth by switching the binding preference of CBP from p53 to NF-kappaB. Mol. Cell. 2007;26:75–87. doi: 10.1016/j.molcel.2007.02.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Gerondakis S, et al. Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor. Proc. Natl. Acad. Sci. USA. 1996;93:3405–3409. doi: 10.1073/pnas.93.8.3405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Liou HC, et al. c-Rel is crucial for lymphocyte proliferation but dispensable for T cell effector function. Int. Immunol. 1999;11:361–371. doi: 10.1093/intimm/11.3.361. [DOI] [PubMed] [Google Scholar]
- 49.Scheidereit C. IkappaB kinase complexes: gateways to NF-kappaB activation and transcription. Oncogene. 2006;25:6685–6705. doi: 10.1038/sj.onc.1209934. [DOI] [PubMed] [Google Scholar]
- 50.Gloire G, Dejardin E, Piette J. Extending the nuclear roles of IkappaB kinase subunits. Biochem. Pharmacol. 2006;72:1081–1089. doi: 10.1016/j.bcp.2006.06.017. [DOI] [PubMed] [Google Scholar]
- 51.Sil AK, Maeda S, Sano Y, Roop DR, Karin M. IkappaB kinase-alpha acts in the epidermis to control skeletal and craniofacial morphogenesis. Nature. 2004;428:660–664. doi: 10.1038/nature02421. [DOI] [PubMed] [Google Scholar]
- 52.Hoberg JE, Yeung F, Mayo MW. SMRT derepression by the IkappaB kinase alpha: a prerequisite to NF-kappaB transcription and survival. Mol. Cell. 2004;16:245–255. doi: 10.1016/j.molcel.2004.10.010. [DOI] [PubMed] [Google Scholar]
- 53.Lawrence T, Bebien M, Liu GY, Nizet V, Karin M. IKKalpha limits macrophage NF-kappaB activation and contributes to the resolution of inflammation. Nature. 2005;434:1138–1143. doi: 10.1038/nature03491. [DOI] [PubMed] [Google Scholar]
- 54.Anest V, et al. A nucleosomal function for IkappaB kinase-alpha in NF-kappaB-dependent gene expression. Nature. 2003;423:659–663. doi: 10.1038/nature01648. [DOI] [PubMed] [Google Scholar]
- 55.Gloire G, et al. Promoter-dependent effect of IKKalpha on NF-kappaB/p65 DNA binding. J. Biol. Chem. 2007;282:21308–21318. doi: 10.1074/jbc.M610728200. [DOI] [PubMed] [Google Scholar]
- 56.Waldmann TA. Daclizumab (anti-Tac, Zenapax) in the treatment of leukemia/lymphoma. Oncogene. 2007;26:3699–3703. doi: 10.1038/sj.onc.1210368. [DOI] [PubMed] [Google Scholar]
- 57.Chen T, Boisvert FM, Bazett-Jones DP, Richard S. A role for the GSG domain in localizing Sam68 to novel nuclear structures in cancer cell lines. Mol. Biol. Cell. 1999;10:3015–3033. doi: 10.1091/mbc.10.9.3015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Ainbinder E, et al. Mechanism of rapid transcriptional induction of tumor necrosis factor alpha-responsive genes by NF-kappaB. Mol. Cell. Biol. 2002;22:6354–6362. doi: 10.1128/MCB.22.18.6354-6362.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Lenardo MJ, Fan CM, Maniatis T, Baltimore D. The involvement of NF-kappa B in beta-interferon gene regulation reveals its role as widely inducible mediator of signal transduction. Cell. 1989;57:287–294. doi: 10.1016/0092-8674(89)90966-5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.