Skip to main content
NCBI home page
Neoplasia (New York, N.Y.) logoLink to Neoplasia (New York, N.Y.)
. 2013 Jul;15(7):727–737. doi: 10.1593/neo.121862

A New p53 Target Gene, RKIP, Is Essential for DNA Damage-Induced Cellular Senescence and Suppression of ERK Activation1,2

Su-Jin Lee 1, Sun-Hye Lee 1, Min-Ho Yoon 1, Bum-Joon Park 1
PMCID: PMC3689236  PMID: 23814485

Abstract

p53, a strong tumor suppressor protein, is known to be involved in cellular senescence, particularly premature cellular senescence. Oncogenic stresses, such as Ras activation, can initiate p53-mediated senescence, whereas activation of the Ras-mitogen-activated protein kinase (MAPK) pathway can promote cell proliferation. These conflicting facts imply that there is a regulatory mechanism for balancing p53 and Ras-MAPK signaling. To address this, we evaluated the effects of p53 on the extracellular signal-regulated kinase (ERK) activation and found that p53 could suppress ERK activation through de novo synthesis. Through several molecular biologic analyses, we found that RKIP, an inhibitor of Raf kinase, is responsible for p53-mediated ERK suppression and senescence. Overexpression of RKIP can induce cellular senescence in several types of cell lines, including p53-deficient cells, whereas the elimination of RKIP by siRNA or forced expression of ERK blocks p53-mediated cellular senescence. These results suggested that RKIP is an essential protein for cellular senescence. Moreover, modification of the p53 serine 46 residue was critical for RKIP induction and ERK suppression as well as cellular senescence. These results indicated that RKIP is a novel p53 target gene that is responsible for p53-mediated cellular senescence and tumor suppressor protein expression.

Introduction

Senescence is one of the cell's responses to damage. It is induced by various stresses such as replicative stress, oncogene activation, telomere dysfunction, and DNA damage [1–6]. In addition, cellular senescence is considered as an initial barrier to tumor formation. Indeed, during the tumorigenesis, a large portion of adenoma is regressed by senescence [6,7].

The molecular mechanism behind cellular senescence has not been fully demonstrated until now. According to previous reports, p53 and p16/Rb pathways are known to be involved in senescence [8]. Induction of p16 and p53 has been observed in murine senescent tissues [6,7,9–11]. In addition, p53 is a well-defined tumor suppressor gene that can induce apoptosis, cell cycle arrest, as well as senescence [12]. The main role of p53 is a transcriptional factor that binds to the promoter regions of target genes (including p21, PUMA, BAX, PAI-1, etc.) to enhance their expression. In contrast, p53 expression is tightly regulated by posttranscriptional modifications, which are phosphorylation, acetylation, methylation, ubiquitylation, and sumoylation [13]. Among them, phosphorylation of p53 by several kinases (such as ATM, Chk1/2, and HIPK) on distinct sites following stresses such as DNA damage or oncogene activation is essential for regulation of p53 expression. Although significant increases of p53 have not been observed during the normal aging process, transgenic mice exhibiting either a truncated form of p53 with mutations in the MDM2-binding domain or a constitutive p53 C-terminal region that escapes MDM2 binding show an aged phenotype [14,15]. Another transgenic mouse exhibiting a BRCA1 mutation also displays this aged phenotype due to p53 activation in response to endogenous DNA damage [16]. However, simple overexpression of p53 or an elevated expression of p53 due to a deletion of MDM2 cannot induce senescence [17,18], suggesting that p53-induced senescence only occurs under abnormal condition.

Oncogene activation can induce cell cycle promotion as well as p53-dependent senescence [19–21]. Until now, how these opposite events could have occurred by oncogene activation has not been fully demonstrated. According to a recent report, a negative feedback loop induced by Ras-Raf-extracellular signal-regulated kinase (ERK) leads to Ras-mediated senescence [22]. Considering the fact that oncogenic Ras-induced senescence is fully dependent on p53 [20,23,24], negative feedback loop would be related with p53 function. Thus, we propose the following hypothesis: Cellular senescence is achieved by p53-mediated Ras-mitogen-activated protein kinase (MAPK) signaling suppression. To address this hypothesis, we examined the effect of p53 on MAPK kinase signaling and found that the Raf kinase inhibitor RKIP is a new target gene of p53. Overexpression or induction of RKIP, which can follow DNA damage or oncogene-induced p53 activation, evokes cellular senescence, whereas RKIP suppression through siRNA can inhibit cellular senescence. Moreover, induction of RKIP and subsequent cellular senescence is dependent on modification of the p53 serine 46 (S46) residue. Considering the frequent reduced levels of RKIP observed in human cancer tissues, RKIP potentially works as a tumor suppressor linked to induction of cellular senescence.

Materials and Methods

Cell Lines and Regents

A549, MKN45, MKN74, and PC3 were obtained from ATCC (Rockville, MD), and HCT116 cell lines were kindly provided by B. Vogelstein and K. Kinzler (The Swim Across America Laboratory at Johns Hopkins and the Howard Hughes Medical Institute at Johns Hopkins Kimmel Cancer Center, Baltimore, MD). Cell lines were cultured in RPMI 1640 (Thermo Scientific, Rockford, IL) with 10% FBS (Thermo Scientific) and 1% antibiotics (Thermo Scientific). Mouse embryonic fibroblast (MEF) cells were cultured in Dulbecco's modified Eagle's medium (Thermo Scientific) supplemented with 10% FBS (Thermo Scientific) and 1% antibiotics (Thermo Scientific). All cell lines were maintained in humidified incubator at 37°C with 5% CO2. Adriamycin (Adr), etoposide (Etop), hydroxyurea, and IGF-1 were obtained from Sigma (St Louis, MO). Raf kinase inhibitor 1 was obtained from Calbiochem (Merck, Darmstadt, Germany). For Western blot analysis and immunofluorescence staining, anti-phospho-p53 (S15, S46 and S392), anti-phospho-ERK, and RKIP were purchased from Cell Signaling Technology (Danvers, MA). Antibodies against DcR2, p53 (DO-1), and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Vectors and Transfection

pCMV-RKIP-HA was provided by G. Keum (David Geffen School of Medicine at University of California, Los Angeles, CA), and p53K302R and p53K382R [25] were obtained from P. P. Pandofi (Harvard University, Boston, MA). p53 S46A and S46D were provided by D. B. Donner (University of California, San Francisco, CA) [26]. Si-p53 was provided by L. D. Mayo (Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN). The pcDNA-ERK expression vector was obtained from D. S. Min (Pusan National University, Busan, Korea). For transfections, we used the jetPEI transfection agent (Polyplus Transfection, New York, NY) following the manufacturer's protocol. The vector (1.5 µg) was mixed with 1.5 µl of jetPEI reagent in 150 mM NaCl solution. After incubation for 15 minutes at room temperature, the mixture was added to the cell. After 3 hours, the serum-free medium was replaced with 10% FBS-containing medium. The si-RKIP oligomer directed against RKIP, which has previously been used for RKIP suppression [27], was provided by Cosmogenetech (Seoul, Korea). For RKIP suppression, we generated si-RKIP, CACCAGCATTTCGTGGGATGGTCTTTCAAGAGAAGACCATCCCACGAAATGCTGGTG and si-control (Si-C), GCGCGCTTTGTAGGATTCGTTTTCAAGAGAAACGAATCCTACAAAGCGCGC.

Western Blot Analysis

Cells, transfected or treated with chemicals, were lysed with RIPA (containing a protease inhibitor cocktail) and were centrifuged at 14,000 rpm for 30 minutes. Twenty micrograms of cell extracts was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA). Blots were blocked in TBS buffer containing 0.05% Tween 20 and 3% nonfat dry milk for 1 hour at room temperature. The membrane was incubated 1 hour to overnight at 4°C with an appropriated primary antibody, followed by reaction with a secondary antibody at room temperature for 1 hour. The proteins were visualized using West-zol (Intron, Seoul, Korea) as recommended by the manufacturer.

Immunofluorescence Staining

After being seeded on cover glasses, cells were transfected with indicated vectors or treated with chemicals. After fixing with methanol for 10 minutes at 4°C, cells were incubated with blocking buffer [phosphate-buffered saline (PBS) + anti-human Ab (1:500)] for 1 hour. After washing with PBS twice, cells were incubated with anti-phospho-ERK and anti-DcR2 in blocking buffer (1:200) for 2 hours and sequentially with anti-mouse Ab-fluorescein isothiocyanate or anti-rabbit Ab-fluorescein isothiocyanate in blocking buffer (1:1000) for 2 hours and mounted. Nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI). Immunofluorescence signal was detected through fluorescence microscopy (Zeiss, Oberkochen, Germany).

Staining of Senescence-Associated β-Galactosidase Activity

For senescence-associated β-galactosidase activity staining (SA-β-Gal staining), cells were incubated with indicated chemicals or transfected with indicated vectors for 24 hours. After washing with serum-free medium, cells were incubated for an additional 24 hours in serum-free medium. The cells were then washed with PBS (pH 7.2) and fixed. After washing, cells were stained in X-gal staining solution. All reagents were supplied by the SA-β-Gal Staining Kit (Cell Signaling Technology).

RNA Isolation and Reverse Transcription-Polymerase Chain Reaction

For mRNA analysis, we isolated total RNA using an RNeasy Mini Kit (Qiagen, Germantown, MD), and 1 µg of RNA was converted into cDNA using MMLV RT (Invitrogen, Carlsbad, CA) and random hexamer. After dilution, we used the cDNA for subsequent polymerase chain reactions (PCRs) using i-start Taq (Intron). The PCR conditions included a denaturing step at 95°C for 5 minutes, followed by 34 cycles of denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, and elongation at 72°C for 1 minute. Reverse transcription (RT)-PCR was performed with specific primers of target genes. The primers used in this study were given as follows: RKIP (forward), 5′-ATGCCGGTGGACCTCAGCAAGT-3′; RKIP (reverse), 5′-CTTCCCAGACAGCTGCTCGTAC-3′; dual-specific phosphatase 14 (DUSP14; forward), 5′-ATGAGCTCCAGAGGTCACAGC-3′; DUSP14 (reverse), 5′-TCCCCCAGTAAGGCATCAGGT-3′; p21 (forward), 5′-CGTGAGCGATGGAACTTCGAC-3′;p21 (reverse), 5′-GATGTAGAGCGGGCCTTTGAG-3′; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (forward), 5′-ATCTTCCAGGAGCGAGATCCC-3′; GAPDH (reverse), 5′-AGTGAGCTTCCCGTTCAGCTC-3′.

3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Assay and Cell Proliferation Analysis

To measure the cell viability, cells were transfected with indicated vectors for 72 hours. For 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, cells were incubated with 0.5 mg/ml MTT solution (Calbiochem) for 4 hours at 37°C. After removing excess solution, the precipitated materials were dissolved in 200 µl of DMSO and quantified by measuring absorbance at 540 nm. For cell proliferation analysis, after removing the medium, cells were stained with trypan blue solution (Gibco, Darmstadt, Germany) for 10 minutes at room temperature.

Chromatin Immunoprecipitation

Cells treated with Adr, Etop, or hydroxyurea for 2 hours were fixed with 1% paraformaldehyde for 0.5 hour. After washing, the cells were sonicated. After pre-clearing with normal IgG, the lysates were incubated with p53 (DO-1) antibody and protein A/G agarose bead (Invitrogen) for 1.5 hours at each step. The cells were collected by centrifugation and washed twice with PBS, after which precipitated DNA-protein complexes were incubated in DNA extract buffer containing protease A for 2 hours at 50°C. Next, we added equal volumes of phenol/chloroform/isoamyl alcohol (25/24/1) solution and isolated the DNA. After washing with alcohol, we used the isolated DNA as our PCR template. The primers used in this study were given as follows: RKIP-1 (forward), 5′-ATCTTCCTGCTTTGGCCTCCC-3′; RKIP-1 (reverse), 5′-CTGCCGAGTTCTCGGGAACAG-3′; RKIP-2 (forward), 5′-ATCTTCCTGCTTTGGCCTCCC-3′; RKIP-2 (reverse), 5′-CTCGACACACGCAGGCTGAAC-3′; DUSP14-1 (forward), 5′-ACTGCTCAGCAATTCTGAGGC-3′; DUSP14-1(reverse), 5′-GGGCATTTGAGGGCTCATTTC-3′; DUSP14-2 (forward), 5′-ACCTGTTCCAGCAAGCGTCAG-3′; DUSP14-2 (reverse), 5′-GTCTCTTACCCTGCCTCACAC-3′; DUSP5 (forward), 5′-AGTGAGCTTGGGGGCAGAAAC-3′; DUSP5 (reverse), 5′-GAGGAGCTGTTTTCTGGTCCC-3′; p21-1 (forward), 5′-CTCATGAGGACTCAGCAGAGC-3′; p21-1 (reverse), 5′-ACATCCTGCCAGGCACATCAG-3′; p21-2 (forward), 5′CTTAACCACCAGGATACAGCC-3′; p21-2 (reverse), 5′ACAGTCTGACAGTTCCTCCAG-3′.

Results

DNA Damage Induces Cellular Senescence

To determine whether the Ras-MAPK pathway plays a role in p53-dependent cellular senescence, we treated the p53-positive human A549 lung cancer cell line with a DNA-damaging agent. Because the A549 cell line harbors endogenous oncogenic K-Ras and wild-type p53, cellular senescence is triggered by Adr, which is a topoisomerase II inhibitoraswellas a DNA-intercalatingagent [28–31]. Adr treatment decreased p-ERK expression, whereas p53 expression was increased (Figure 1A). To verify that the reduced p-ERK expression observed was a common response to DNA-damaging agents, we examined the effect of another topoisomerase II inhibitor, Etop, on ERK activation. In previous studies, Adr and Etop have shown mutually incompatible effects on p-ERK expression [32]. Indeed, contrary to the effects of Adr treatment, p-ERK expression increased in response to Etop treatment (Figure 1B). According to a previous study, DNA strand breakages lead to apoptosis and cell cycle arrest, whereas senescence results from DNA damage such as DNA alkylation or intercalation [2]. To compare the senescence-promoting ability of the two chemicals, we performed SA-β-Gal staining. Adr but not Etop induced cellular senescence (Figure 1, C–E). Because p16/INK and DcR2 are commonly used senescence markers [7,33–35], we checked the expression of DcR2 and found that Adr treatment increased levels of DcR2 (Figure 1, F and G). As the A549 cell line is p16/p14 negative, these results suggested that Adr induced cellular senescence in a p16/Rb-independent manner.

Figure 1.

Figure 1

Open in a new tab

Adr induced p-ERK suppression and senescence. (A) Western blot analysis of A549 cells showed that p-ERK was reduced after treatment with Adr (2 µg/ml) for the indicated amount of time. Actin was shown as a loading control. (B) Western blot analysis of A549 cells showed that p-ERK was induced after treatment with Etop (5 µM) for the indicated amount of time. Actin was shown as a loading control. (C) SA-β-Gal staining of A549 cells showed that Adr but not Etop induced cellular senescence. A549 cells were incubated with Adr (2 µg/ml) or Etop (5 µM) for 24 hours in serum-free media. After fixing, cells were stained with SA-β-Gal staining solution. (D) Photograph of SA-β-Gal staining well. (E) Quantification of SA-β-Gal-positive cells. At least 200 cells were counted from three independent experiments, and the mean results are represented as a bar graph. (F) Western blot analysis of A549 cells showed that DcR2 was increased by Adr treatment. Cells were incubated with the indicated concentrated chemicals for 4 hours. (G) Immunostaining of A549 cells showed the effect of Adr or Etop on DcR2 and p-ERK. After treatment with Adr (2 µg/ml) or Etop (5 µM) for 4 hours, cells were fixed and stained with anti-DcR2 and anti-p-ERK. Nucleus was stained with DAPI.

Suppression of p-ERK Is a p53-Dependent Event

To verify that p-ERK reduction is achieved in a p53-dependent manner, we checked the reduction of p-ERK by Adr-treatment in HCT116 p53 isogenic cell lines [36]. In contrast to reduction of p-ERK and increase of SA-β-Gal-positive cells in response to Adrin p53-positive cell lines, p53-null cells (HCT116 p53-/-) did not show the reduction of p-ERK and senescence (Figure 2, A and B). However, reconstruction of p53 in HCT 116 p53-/- cells by transfection of wild-type p53 could restore the Adr-induced senescence (Figure 2C). These results suggest that Adr induced senescence and p-ERK suppression is achieved in a p53-dependent manner.

Figure 2.

Figure 2

Open in a new tab

RKIP is induced by Adr but not Etop. (A) Western blot analysis of HCT116 isogenic cells showed that p-ERK was decreased in p53-positive (HCT116 p53+/-) cells but not in p53-deficient (HCT116 p53-/-) cells after treatment with Adr (2 µg/ml) for the indicated amount of time. Actin was shown as a loading control. (B) SA-β-Gal staining of HCT116 isogenic cells showed that Adr induced cellular senescence in HCT116 p53+/- cells but not in HCT116 p53-/- cells. Etop did not induce cellular senescence in both cell lines. Cells were incubated with Adr (2 µg/ml) or Etop (5 µM) for 24 hours and subjected to SA-β-Gal staining. (C) SA-β-Gal staining of HCT116 p53-/- cells showed that Adr induced cellular senescence in the presence of p53. Cells were transfected with wild-type p53 for 24 hours and incubated with 1 µg/ml Adr for 24 hours. After fixing, cells were stained with SA-β-Gal staining solution. (D) RT-PCR analysis of A549 cells showed that transcripts of RKIP and DUSP14 were increased in treatment with Adr (2 µg/ml) for the indicated amount of time. p21 was used as a positive control, and GAPDH was used as the loading control. (E) Western blot analysis of A549 cells showed that RKIP was induced after treatment with Adr. Cells were incubated with Adr (2 µg/ml) or Etop (5 µM) for the indicated amount of time. Actin was shown as a loading control. (F) Western blot analysis of A549 cells showed that RKIP and DcR2 were increased after treatment with Adr for the indicated time and concentration. Actin was shown as a loading control. (G) Western blot analysis of A549 cells showed that RKIP and DcR2 were not altered after treatment with Etop for the indicated time and concentration. Actin was shown as a loading control.

RKIP Is Induced by Adr but Not Etop

Because the major function of p53 is transcriptional factor [37,38], we checked the involvement of transcriptional activity of p53 on p-ERK inhibition. Blocking the de novo synthesis of p53 by cyclohexamide treatment could block the p-ERK suppression (Figure W1A). We next measured the RNA expression of several Ras-Raf-MAPK inhibitors, including DUSP14, DUSP5, and RKIP. Indeed, DUSP14 and DUSP5 have been revealed as p53 target genes [39,40], and RKIP is known to be an inhibitor of Raf-MAPK [41]. The transcripts of DUSP14 and RKIP were increased by Adr treatment (Figure 2D). Since DUSP5 expression was not altered by Adr treatment (data not shown), we excluded it from our further analyses. In addition, RKIP responded more specifically to Adr treatment than to Etop treatment, whereas DUSP14 expression did not show obvious difference between Adr- and Etop-treated cells (data not shown). Indeed, RKIP expression at translation level was obviously induced by Adr treatment in a time- and dose-dependent manner (Figure 2, E and F). In contrast, Etop did not induce RKIP at the similar condition (Figure 2, E and G). Moreover, DcR2 was increased along with RKIP expression (Figure 2F), suggesting that RKIP was a mediator of cellular senescence. To confirm this result, we treated Adr on the human gastric cancer cell line MKN45, which harbors wild-type p53 and wild-type K-Ras. As we expected, Adr treatment induced the RKIP expression along with suppression of p-ERK (Figure W1B). These results implicate that RKIP is a major candidate for reducing p-ERK expression and inducing cellular senescence in response to Adr treatment.

RKIP Is a Direct Target Gene of p53

Previously, we showed that reduction of p-ERK showed the dependence with p53 (Figure 2A), and RKIP was induced by Adr (Figure 2D). Thus, we checked the relevance between p53 and RKIP induction. First of all, we measured the expression of RKIP in Adr-treated HCT116 p53 isogenic cell lines and found that induction of RKIP at transcription and translation levels was fully dependent on p53 status (Figures 3A and W1C). To confirm this, we transfected p53 into p53-null HCT116 cells and measured the expression of RKIP. Overexpression of wild-type p53 could induce the RKIP expression (Figures 3B and W1D). However, ectopic expression of a mutant form of p53 (R175H) did not induce RKIP (Figures 3B and W1D). Moreover, p53 knockdown diminished Adr-induced RKIP expression (Figure 3C). These results indicated that RKIP induction was fully dependent on p53. To verify that RKIP is direct target of p53, we searched the RKIP promoter region and found two putative p53 consensus binding sequence (CBS; Figure W2). To determine whether these sites were occupied by p53, we performed chromatin immunoprecipitation (ChIP) assay in RKIP promoter, comparing with the p21 and DUSP14-2 promoters as positive controls and GAPDH, DUSP5, and DUSP14-1 as negative controls. Of the two p53 CBS in the RKIP promoter region, the second CBS was amplified by ChIP PCR in Adr-treated cells (Figure 3D). On the basis of these results, we suggested that RKIP was a direct p53 target gene.

Figure 3.

Figure 3

Open in a new tab

RKIP is a direct target of p53. (A) Western blot analysis of HCT116 p53 isogenic cell lines showed that RKIP was induced in HCT116 p53+/- cells after treatment with Adr (2 µg/ml) for the indicated time. Actin was shown as a loading control. (B) Western blot analysis of HCT116 p53-/- cells showed that RKIP was induced in the presence of wild-type p53. Cells were transfected with wild-type or transcriptional activity-deficient mutant p53 and treated with Adr (2 µg/ml) for 4 hours. (C) Western blot analysis of HCT116 p53+/- cells showed that RKIP was not induced after the treatment with Adr following the elimination of p53. Cells were transfected with siRNA against p53 for 24 hours and incubated with Adr (2 µg/ml) or Etop (5 µM) for 4 hours. Endogenous p53 was successfully silenced by siRNA treatment, and actin was shown as a loading control. (D) A ChIP assay showed that p53 bound to RKIP promoter. After treatment with the indicated chemicals for 2 hours, A549 cells were sonicated and then incubated with anti-p53. Following extraction of p53-associated DNA, the promoter regions were amplified using specific primers. p21 and DUSP14 were used for positive controls, and GAPDH and DUSP5 were shown for negative controls. (E) Western blot analysis of A549 cells showed that RKIP was increased in the growth factor stimulation. Cells were treated with IGF-1 (5 µg/ml) under serum-free condition for the indicated time. Actin was shown as a loading control. (F) SA-β-Gal staining of A549 showed that IGF-1 induced cellular senescence. Cells were incubated with IGF-1 (5 µg/ml) for 24 hours under serum-free condition and subjected to SA-β-Gal staining. (G) Western blot analysis of p53 isogenic cell lines showed that IGF-1 as well as Adr induced RKIP and DcR2 in HCT116 p53+/- cells. Cells were incubated with Adr (2 µg/ml) or IGF-1 (5 µg/ml) for 4 hours. Actin was shown as a loading control. (H) Western blot analysis of p53 isogenic cell lines showed that oncogenic activation increased RKIP and DcR in HCT116 p53+/- cells. Cells were transfected with H-RasG12V and DN-Ras for 24 hours. Actin was shown as a loading control.

RKIP Is Also Induced by Oncogene Activation or Growth Factor Stimulation

To verify that RKIP induction is common to p53-dependent cellular senescence, we examined RKIP expression under growth factor- and oncogene-induced senescent cells. Insulin-like growth factor 1 (IGF-1)-induced senescence is also mediated by the p53 pathway [15,42], and oncogenic Ras-induced senescence is fully dependent on p53 status [20,21]. Indeed, RKIP expression was induced in IGF-1-stimulated senescent A549 cells (Figure 3, E and F). Moreover, the induction of RKIP and DcR2, in response to IGF-1, was only observed in HCT 116 p53+/- cells but not in HCT 116 p53-/- cells (Figure 3G). In addition, oncogenic Ras could induce RKIP expression in a p53-dependent manner (Figure 3H).

RKIP Induces Senescence through ERK Suppression

To determine whether RKIP induction is required for Adr-induced senescence, we performed the RKIP knockdown experiment using siRNA in A549 cells [27]. Elimination of RKIP could increase ERK activation and suppress the cellular senescence (Figure 4, A and B). Conversely, RKIP overexpression inhibited ERK activation and induced the cellular senescence (monitored by SA-β-Gal and DcR2 expression) in two kinds of p53-deficient cell lines (HCT116 p53-/- cells and PC3; human prostate cancer cell line; Figures 4, C–E, and W3A). In contrast, suppression of Ras-Raf-ERK pathway using Raf kinase inhibitor could induce the cellular senescence (Figure W3B). These results suggested that elevated expression of RKIP itself is enough for induction of senescence and it is mediated by suppression of the Raf-MAPK pathway. To confirm this, we transfected the ERK expression vector and checked the senescence. Ectopic expression of ERK retained ERK phosphorylation and suppressed RKIP-induced cellular senescence (Figures 4, F and G, and W3, C and D). To get more evidence about the physiological role of RKIP, we checked the effect of RKIP on cell proliferation in several kinds of cell lines using trypan blue staining and MTT assay. As we expected, overexpression of RKIP could suppress the cell proliferation (Figure W4, A and B), whereas RKIP knockdown could promote the cell proliferation (Figure W4, A and C). Considering these results, RKIP promotes cellular senescence and suppresses cell proliferation through inhibition of ERK activity.

Figure 4.

Figure 4

Open in a new tab

RKIP is essential for senescence. (A) Western blot analysis of A549 cells showed that treatment with Adr did not reduce p-ERK in the absence of RKIP. Cells were transfected with Si-C or Si-RKIP for 8 hours, and p-ERK expression was measured following treatment with Adr (2 µg/ml, 2 hours). Actin was shown as a loading control. (B) SA-β-Gal staining of A549 cells showed that Adr did not induce cellular senescence in the absence of RKIP. After transfection with si-RKIP or Si-C for 8 hours, A549 cells were incubated with Adr (2 µg/ml) for 24 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution. (C) Western blot analysis of HCT116 p53-/- cells showed that overexpression of RKIP decreased p-ERK. Cells were transfected with RKIP for 48 hours. Actin was shown as a loading control. (D) SA-β-Gal staining of HCT116 p53-/- cells showed that overexpression of RKIP induced cellular senescence. Cells were transfected with RKIP or empty vector (EV) vector for 48 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution. (E) Immunostaining of HCT116 p53-/- cells showed that RKIP overexpression increased DcR2. After transfection with RKIP for 48 hours, cells were fixed and stained with anti-DcR2. Nucleus was stained with DAPI. (F) Western blot analysis of HCT116 p53+/- and MKN45 cells showed that enhanced ERK expression prevented the reduction of p-ERK by RKIP. Cells were transfected with RKIP alone or in combination with ERK for 24 hours. Actin was shown as a loading control. (G) SA-β-Gal staining of HCT116 p53+/- and MKN45 cells showed that enhanced ERK expression overcame the RKIP-mediated cellular senescence. Cells were transfected with RKIP alone or in combination with ERK for 24 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution.

Modification of the S46 Residue of p53 Is Critical for RKIP Induction and Senescence

Treatment with Adr but not Etop induced RKIP expression and cellular senescence (Figure 2). Moreover, RKIP was a direct target of p53 (Figure 3D). Thus, our next question is how p53 regulates RKIP transcript. p53 function and stability are regulated by phosphorylation of its serine/threonine residues, in response to DNA damage or other cellular stresses, resulting in apoptosis, cell cycle arrest, and senescence [43–46]. To clarify the differential outcomes, observed in response to Adr or Etop treatment, we examined p53 modification, in particular phosphorylation. Interestingly, treatment of Adr but not Etop induced the phosphorylation of p53 at S46 residue (Figures 5A and W5A). To know that S46 modification is responsible for RKIP induction and senescence, we transfected the phospho-mimic (S46D) or nonphosphorylated (S46A) p53 mutant vector into HCT116p53-/- cells. The S46D p53 mutant, but not the S46A mutant, induced RKIP and DcR2 expression (Figures 5B and W5B). In addition, we could observe the increase of SA-β-Gal-positive cells in p53 S46D- transfected cells, regardless of Adr treatment (Figure 5C). In contrast, we did not find the relevance between p53 acetylation and RKIP induction (Figure 5D), although p53 acetylation during cellular senescence has been proposed [25], and we did not check all kinds of acetyl p53. We could also observe the induction of p-S46 p53 as well as RKIP by treatment of IGF-1 (Figure 5E). Moreover, overexpression of S46D promoted cellular senescence in an RKIP-dependent manner (Figure 5, F and G). These results suggested that phosphorylation of the S46 residue of p53 would be required for RKIP-mediated senescence.

Figure 5.

Figure 5

Open in a new tab

Phosphorylation of the p53 S46 residue is critical for RKIP induction and senescence. (A) Western blot analysis of A549 cells showed that phosphorylation of S46 residue of p53 (p-p53 S46) was induced by treatment with Adr but not with Etop. Phosphorylation of other serine residues (S20 and S392) was induced by treatment with Etop as well as Adr. Cells were incubated with Adr (2 µg/ml) or Etop (5 µM) for 4 hours. Actin was shown as a loading control. (B) Western blot analysis of HCT116 p53-/- cells showed that S46D induced RKIP and DcR2, while S46A did not. Cells were transfected with the indicated vectors for 24 hours. Actin was shown as a loading control. (C) SA-β-Gal staining of HCT116 p53-/- cells showed that S46D promoted cellular senescence with or without Adr treatment. Cells were transfected with the indicated vectors for 24 hours and treated with Adr (2 µg/ml) for another 24 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution. (D) Western blot analysis of HCT116 p53-/- cells showed that acetyl p53 was not relevant to RKIP induction. Cells were transfected with the K302R and K382R for 24 hours. Actin was shown as a loading control. (E) Western blot analysis of A549 cells showed that treatment of IGF-1 as well as Adr induced p-p53 S46 and RKIP. Cells were incubated with Adr (2 µg/ml) or IGF-1 (5 µg/ml) for the indicated time. Actin was shown as a loading control. (F) Western blot analysis of HCT116 p53-/- cells showed that the elimination of RKIP abolished the effect of S46D on p-ERK and DcR2. Cells were transfected with S46D alone or in combination with siRNA against RKIP for 24 hours. Actin was shown as a loading control. (G) Immunostaining of HCT116 p53-/- cells revealed that induction of DcR2 by S46D was not shown in the absence of RKIP. Cells were transfected with S46D alone or in combination with siRNA against RKIP for 24 hours. After transfection, cells were fixed and stained with anti-DcR2. Nucleus was stained with DAPI.

Discussion

Cellular senescence has emerged as a critical barrier against cancer progression. Indeed, oncogenes such as H-RasG12V, K-RasG12D, or B-RafV600E can induce cellular senescence in mouse models as well as human cancers [7,9,19,47–49]. Thus, promoting the cellular senescence would be useful for tumor suppression.

In this study, we found that the Raf kinase inhibitor RKIP serves as an inducer of cellular senescence through suppression of the cellular proliferation pathway. According to previous reports, RKIP is involved in progression through the G2/M checkpoint [27] and tumor metastasis [50–52]. In addition, RKIP expression is reduced in several types of human cancers [53–58]. Here, we demonstrate that RKIP is a direct target of p53 and is responsible for p53-induced cellular senescence. Although p53 is a multifunctional tumor suppressor protein that is involved in cell cycle suppression, apoptosis, inhibiting angiogenesis, suppressing metastasis, and promoting senescence [8,12], it is not clear how p53 activity is differentially regulated, in particular induction of senescence. Regarding this, we suggest that p53 is differentially modified at posttranslation level and that phosphorylation of the S46 residue is essential for inducing cellular senescence and RKIP expression (Figure 5). These results provide a basic clue for understanding how different triggers regulate p53, although we cannot yet suggest a detailed mechanism for how senescence triggers selective modification of the p53 S46 residue.

We have also shown that cells can discern the different kinds of cellular stresses. In fact, Adr treatment, but not Etop treatment, can induce senescence obviously. While we do not yet know the detailed mechanism of this action, Adr can induce RKIP expression and S46 modification of p53 (Figures 3 and 5A). These results imply that there is a kinase that can modify the p53 S46 residue in response to Adr-mediated DNA damage. Concerning this, two S46-responsive kinases, HIPK2 and DYRK, have been proposed [59–61]. However, both kinases are believed to be involved in p53-mediated apoptosis. Thus, there may be additional kinases that are more directly involved in cellular senescence.

In our study, we also show the induction of RKIP in response to IGF-1 and oncogenic Ras transfection (Figure 3, G and H). In addition, consistently with previous reports that IGF-1- or oncogenic Ras-induced cellular senescence has been proposed to be mediated by p53 [15,20], RKIP induction in response to growth factors or oncogenic Ras is mediated by p53 (Figure 3, G and H). Interestingly, despite of weak induction of p53, the phosphorylation of the S46 residue of p53 by IGF-1 treatment shows a similar level with Adr treatment condition (Figure 5E). These results indicated that RKIP induction was fully dependent on modification of the p53 S46 residue. We could also obtain the similar results from the p53 mutant experiment. Despite of similar stability of p53 S46D and S46A mutants, they show quite different effect on the induction of RKIP and senescence (Figure 5, B and C). These results explained why simple increases of p53 expression do not induce senescence, whereas modified p53 shows a strong effect on cellular senescence [14,15]. During senescence induction, either levels of S46-phosphorylated p53 or its mimetic were more critical than the total intracellular amounts of p53.

On the basis of our results (Figure 5) and other's reports, phosphorylation of p53 S46 residue is critical for cellular senescence and apoptosis [59–61]. However, S46 residue is not conserved between murine and human. In fact, we did not observe the induction of RKIP in response to Adr in mouse embryonic fibroblast (Figure W5C). These facts imply that the human system may require more complicate senescence regulation mechanism because of long life span. However, how cellular senescence of mouse cells is regulated by p53 should be investigated by further investigation.

According to a previous report, RKIP expression is reduced in human gastric cancers [56,57]. Although the RKIP locus, 12q24, is not known to be loss of heterozygosity (LOH) in human cancer, RKIP reduction has been linked with genomic deletion [62]. This result suggests that deletion of RKIP can be achieved through microdeletion. Moreover, RKIP expression exhibits an inverse relationship with cancer grades [57]. Higher expressed RKIP in non-neoplastic tissues is reduced to undetectable level in malignant gastric cancer tissues. These results suggest that RKIP is not just a metastasis suppressor but also a blocker of tumor initiation. Taken together, our results indicated that RKIP, a novel target of p53, is responsible for p53-mediated senescence.

Supplementary Material

Supplementary Figures and Tables
neo1507_0727SD1.pdf (1.9MB, pdf)

Acknowledgments

This work was supported by the Bio-Scientific Research Grant funded by the Pusan National University (PNU, Bio-Scientific Research Grant) (PNU-2008-101-20080596000).

Abbreviations

Adr

adriamycin

Etop

etoposide

IGF-1

insulin-like growth factor 1

Footnotes

1

This work was supported by the Bio-Scientific Research Grant funded by the Pusan National University (PNU, Bio-Scientific Research Grant) (PNU-2008-101-20080596000). The authors declare no conflict of interest.

2

This article refers to supplementary materials, which are designated by Figures W1 to W5 and are available online at www.neoplasia.com.

References

  • 1.Cristofalo VJ, Lorenzini A, Allen RG, Torres C, Tresini M. Replicative senescence: a critical review. Mech Ageing Dev. 2004;125:827–848. doi: 10.1016/j.mad.2004.07.010. [DOI] [PubMed] [Google Scholar]
  • 2.Lombard DB, Chua KF, Mostoslavsky R, Franco S, Gostissa M, Alt FW. DNA repair, genome stability, and aging. Cell. 2005;120:497–512. doi: 10.1016/j.cell.2005.01.028. [DOI] [PubMed] [Google Scholar]
  • 3.Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, and aging. Cell. 2005;120:483–495. doi: 10.1016/j.cell.2005.02.001. [DOI] [PubMed] [Google Scholar]
  • 4.Mooi WJ, Peeper DS. Oncogene-induced cell senescence—halting on the road to cancer. N Engl J Med. 2006;355:1037–1046. doi: 10.1056/NEJMra062285. [DOI] [PubMed] [Google Scholar]
  • 5.Irminger-Finger I. Science of cancer and aging. J Clin Oncol. 2007;25:1844–1851. doi: 10.1200/JCO.2007.10.8928. [DOI] [PubMed] [Google Scholar]
  • 6.Braig M, Lee S, Loddenkemper C, Rudolph C, Peters AH, Schlegelberger B, Stein H, Dörken B, Jenuwein T, Schmitt CA. Oncogene-induced senescence as an initial barrier in lymphoma development. Nature. 2005;436:660–665. doi: 10.1038/nature03841. [DOI] [PubMed] [Google Scholar]
  • 7.Collado M, Gil J, Efeyan A, Guerra C, Schuhmacher AJ, Barradas M, Benguría A, Zaballos A, Flores JM, Barbacid M, et al. Tumour biology: senescence in premalignant tumours. Nature. 2005;436:642. doi: 10.1038/436642a. [DOI] [PubMed] [Google Scholar]
  • 8.Campisi J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 2005;120:513–522. doi: 10.1016/j.cell.2005.02.003. [DOI] [PubMed] [Google Scholar]
  • 9.Chen Z, Trotman LC, Shaffer D, Lin HK, Dotan ZA, Niki M, Koutcher JA, Scher HI, Ludwig T, Gerald W, et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature. 2005;436:725–730. doi: 10.1038/nature03918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T, van der Horst CM, Majoor DM, Shay JW, Mooi WJ, Peeper DS. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature. 2005;436:720–724. doi: 10.1038/nature03890. [DOI] [PubMed] [Google Scholar]
  • 11.Lazzerini Denchi E, Attwooll C, Pasini D, Helin K. Deregulated E2F activity induces hyperplasia and senescence-like features in the mouse pituitary gland. Mol Cell Biol. 2005;25:2660–2672. doi: 10.1128/MCB.25.7.2660-2672.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Harris SL, Levine AJ. The p53 pathway: positive and negative feedback loops. Oncogene. 2005;24:2899–2908. doi: 10.1038/sj.onc.1208615. [DOI] [PubMed] [Google Scholar]
  • 13.Lavin MF, Gueven N. The complexity of p53 stabilization and activation. Cell Death Differ. 2006;13:941–950. doi: 10.1038/sj.cdd.4401925. [DOI] [PubMed] [Google Scholar]
  • 14.Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G, Cooper B, Brayton C, et al. p53 mutant mice that display early ageing-associated phenotypes. Nature. 2002;415:45–53. doi: 10.1038/415045a. [DOI] [PubMed] [Google Scholar]
  • 15.Maier B, Gluba W, Bernier B, Turner T, Mohammad K, Guise T, Sutherland A, Thorner M, Scrable H. Modulation of mammalian life span by the short isoform of p53. Genes Dev. 2004;18:306–319. doi: 10.1101/gad.1162404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cao L, Li W, Kim S, Brodie SG, Deng CX. Senescence, aging, and malignant transformation mediated by p53 in mice lacking the Brca1 full-length isoform. Genes Dev. 2003;17:201–213. doi: 10.1101/gad.1050003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.García-Cao I, García-Cao M, Martín-Caballero J, Criado LM, Klatt P, Flores JM, Weill JC, Blasco MA, Serrano M. “Super p53” mice exhibit enhanced DNA damage response, are tumor resistant and age normally. EMBO J. 2002;21:6225–6235. doi: 10.1093/emboj/cdf595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mendrysa SM, O'Leary KA, McElwee MK, Michalowski J, Eisenman RN, Powell DA, Perry ME. Tumor suppression and normal aging in mice with constitutively high p53 activity. Genes Dev. 2006;20:16–21. doi: 10.1101/gad.1378506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell. 1997;88:593–602. doi: 10.1016/s0092-8674(00)81902-9. [DOI] [PubMed] [Google Scholar]
  • 20.Ferbeyre G, de Stanchina E, Lin AW, Querido E, McCurrach ME, Hannon GJ, Lowe SW. Oncogenic ras and p53 cooperate to induce cellular senescence. Mol Cell Biol. 2002;22:3497–3508. doi: 10.1128/MCB.22.10.3497-3508.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sun P, Yoshizuka N, New L, Moser BA, Li Y, Liao R, Xie C, Chen J, Deng Q, Yamout M, et al. PRAK is essential for ras-induced senescence and tumor suppression. Cell. 2007;128:295–308. doi: 10.1016/j.cell.2006.11.050. [DOI] [PubMed] [Google Scholar]
  • 22.Courtois-Cox S, Genther Williams SM, Reczek EE, Johnson BW, McGillicuddy LT, Johannessen CM, Hollstein PE, MacCollin M, Cichowski K. A negative feedback signaling network underlies oncogene-induced senescence. Cancer Cell. 2006;10:459–472. doi: 10.1016/j.ccr.2006.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ventura A, Kirsch DG, McLaughlin ME, Tuveson DA, Grimm J, Lintault L, Newman J, Reczek EE, Weissleder R, Jacks T. Restoration of p53 function leads to tumour regression in vivo. Nature. 2007;445:661–665. doi: 10.1038/nature05541. [DOI] [PubMed] [Google Scholar]
  • 24.Xue W, Zender L, Miething C, Dickins RA, Hernando E, Krizhanovsky V, Cordon-Cardo C, Lowe SW. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature. 2007;445:656–660. doi: 10.1038/nature05529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pearson M, Carbone R, Sebastiani C, Cioce M, Fagioli M, Saito S, Higashimoto Y, Appella E, Minucci S, Pandolfi PP, et al. PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature. 2000;406:207–210. doi: 10.1038/35018127. [DOI] [PubMed] [Google Scholar]
  • 26.Mayo LD, Seo YR, Jackson MW, Smith ML, Rivera Guzman J, Korgaonkar CK, Donner DB. Phosphorylation of human p53 at serine 46 determines promoter selection and whether apoptosis is attenuated or amplified. J Biol Chem. 2005;280:25953–25959. doi: 10.1074/jbc.M503026200. [DOI] [PubMed] [Google Scholar]
  • 27.Eves EM, Shapiro P, Naik K, Klein UR, Trakul N, Rosner MR. Raf kinase inhibitory protein regulates aurora B kinase and the spindle checkpoint. Mol Cell. 2006;23:561–574. doi: 10.1016/j.molcel.2006.07.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Marchetti A, Cecchinelli B, D'Angelo M, D'Orazi G, Crescenzi M, Sacchi A, Soddu S. p53 can inhibit cell proliferation through caspase-mediated cleavage of ERK2/MAPK. Cell Death Differ. 2004;11:596–607. doi: 10.1038/sj.cdd.4401368. [DOI] [PubMed] [Google Scholar]
  • 29.Crescenzi E, Palumbo G, Brady HJ. Roscovitine modulates DNA repair and senescence: implications for combination chemotherapy. Clin Cancer Res. 2005;11:8158–8171. doi: 10.1158/1078-0432.CCR-05-1042. [DOI] [PubMed] [Google Scholar]
  • 30.Vigneron A, Roninson IB, Gamelin E, Coqueret O. Src inhibits adriamycin-induced senescence and G2 checkpoint arrest by blocking the induction of p21waf1. Cancer Res. 2005;65:8927–8935. doi: 10.1158/0008-5472.CAN-05-0461. [DOI] [PubMed] [Google Scholar]
  • 31.Rebbaa A, Zheng X, Chu F, Mirkin BL. The role of histone acetylation versus DNA damage in drug-induced senescence and apoptosis. Cell Death Differ. 2006;13:1960–1967. doi: 10.1038/sj.cdd.4401895. [DOI] [PubMed] [Google Scholar]
  • 32.Stefanelli C, Tantini B, Fattori M, Stanic’ I, Pignatti C, Clo C, Guarnieri C, Caldarera CM, Mackintosh CA, Pegg AE, et al. Caspase activation in etoposide-treated fibroblasts is correlated to ERK phosphorylation and both events are blocked by polyamine depletion. FEBS Lett. 2002;527:223–228. doi: 10.1016/s0014-5793(02)03242-8. [DOI] [PubMed] [Google Scholar]
  • 33.Zindy F, Quelle DE, Roussel MF, Sherr CJ. Expression of the p16INK4a tumor suppressor versus other INK4 family members during mouse development and aging. Oncogene. 1997;15:203–211. doi: 10.1038/sj.onc.1201178. [DOI] [PubMed] [Google Scholar]
  • 34.Krishnamurthy J, Torrice C, Ramsey MR, Kovalev GI, Al-Regaiey K, Su L, Sharpless NE. Ink4a/Arf expression is a biomarker of aging. J Clin Invest. 2004;114:1299–1307. doi: 10.1172/JCI22475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Collado M, Serrano M. The power and the promise of oncogene-induced senescence markers. Nat Rev Cancer. 2006;6:472–476. doi: 10.1038/nrc1884. [DOI] [PubMed] [Google Scholar]
  • 36.Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, Sedivy JM, Kinzler KW, Vogelstein B. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science. 1998;282:1497–1501. doi: 10.1126/science.282.5393.1497. [DOI] [PubMed] [Google Scholar]
  • 37.Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature. 2000;408:307–310. doi: 10.1038/35042675. [DOI] [PubMed] [Google Scholar]
  • 38.Lowe SW, Cepero E, Evan G. Intrinsic tumour suppression. Nature. 2004;432:307–315. doi: 10.1038/nature03098. [DOI] [PubMed] [Google Scholar]
  • 39.Ueda K, Arakawa H, Nakamura Y. Dual-specificity phosphatase 5 (DUSP5) as a direct transcriptional target of tumor suppressor p53. Oncogene. 2003;22:5586–5591. doi: 10.1038/sj.onc.1206845. [DOI] [PubMed] [Google Scholar]
  • 40.Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T, Shahab A, Yong HC, Fu Y, Weng Z, et al. A global map of p53 transcription-factor binding sites in the human genome. Cell. 2006;124:207–219. doi: 10.1016/j.cell.2005.10.043. [DOI] [PubMed] [Google Scholar]
  • 41.Yeung K, Seitz T, Li S, Janosch P, McFerran B, Kaiser C, Fee F, Katsanakis KD, Rose DW, Mischak H, et al. Suppression of Raf-1 kinase activity and MAP kinase signalling by RKIP. Nature. 1999;401:173–177. doi: 10.1038/43686. [DOI] [PubMed] [Google Scholar]
  • 42.Campisi J. Fragile fugue: p53 in aging, cancer and IGF signaling. Nat Med. 2004;10:231–232. doi: 10.1038/nm0304-231. [DOI] [PubMed] [Google Scholar]
  • 43.Blaydes JP, Hupp TR. DNA damage triggers DRB-resistant phosphorylation of human p53 at the CK2 site. Oncogene. 1998;17:1045–1052. doi: 10.1038/sj.onc.1202014. [DOI] [PubMed] [Google Scholar]
  • 44.Shieh SY, Taya Y, Prives C. DNA damage-inducible phosphorylation of p53 at N-terminal sites including a novel site, Ser20, requires tetramerization. EMBO J. 1999;18:1815–1823. doi: 10.1093/emboj/18.7.1815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev. 2000;14:289–300. [PMC free article] [PubMed] [Google Scholar]
  • 46.Wallace M, Coates PJ, Wright EG, Ball KL. Differential post-translational modification of the tumour suppressor proteins Rb and p53 modulate the rates of radiation-induced apoptosis in vivo. Oncogene. 2001;20:3597–3608. doi: 10.1038/sj.onc.1204496. [DOI] [PubMed] [Google Scholar]
  • 47.Dankort D, Filenova E, Collado M, Serrano M, Jones K, McMahon M. A new mouse model to explore the initiation, progression, and therapy of BRAFV600E-induced lung tumors. Genes Dev. 2007;21:379–384. doi: 10.1101/gad.1516407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Sarkisian CJ, Keister BA, Stairs DB, Boxer RB, Moody SE, Chodosh LA. Dose-dependent oncogene-induced senescence in vivo and its evasion during mammary tumorigenesis. Nat Cell Biol. 2007;9:493–505. doi: 10.1038/ncb1567. [DOI] [PubMed] [Google Scholar]
  • 49.Dhomen N, Reis-Filho JS, da Rocha Dias S, Hayward R, Savage K, Delmas V, Larue L, Pritchard C, Marais R. Oncogenic Braf induces melanocyte senescence and melanoma in mice. Cancer Cell. 2009;15:294–303. doi: 10.1016/j.ccr.2009.02.022. [DOI] [PubMed] [Google Scholar]
  • 50.Fu Z, Smith PC, Zhang L, Rubin MA, Dunn RL, Yao Z, Keller ET. Effects of raf kinase inhibitor protein expression on suppression of prostate cancer metastasis. J Natl Cancer Inst. 2003;95:878–889. doi: 10.1093/jnci/95.12.878. [DOI] [PubMed] [Google Scholar]
  • 51.Keller ET, Fu Z, Brennan M. The biology of a prostate cancer metastasis suppressor protein: Raf kinase inhibitor protein. J Cell Biochem. 2005;94:273–278. doi: 10.1002/jcb.20169. [DOI] [PubMed] [Google Scholar]
  • 52.Lee HC, Tian B, Sedivy JM, Wands JR, Kim M. Loss of Raf kinase inhibitor protein promotes cell proliferation and migration of human hepatoma cells. Gastroenterology. 2006;131:1208–1217. doi: 10.1053/j.gastro.2006.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Chatterjee D, Bai Y, Wang Z, Beach S, Mott S, Roy R, Braastad C, Sun Y, Mukhopadhyay A, Aggarwal BB, et al. RKIP sensitizes prostate and breast cancer cells to drug-induced apoptosis. J Biol Chem. 2004;279:17515–17523. doi: 10.1074/jbc.M313816200. [DOI] [PubMed] [Google Scholar]
  • 54.Hagan S, Al-Mulla F, Mallon E, Oien K, Ferrier R, Gusterson B, García JJ, Kolch W. Reduction of Raf-1 kinase inhibitor protein expression correlates with breast cancer metastasis. Clin Cancer Res. 2005;11:7392–7397. doi: 10.1158/1078-0432.CCR-05-0283. [DOI] [PubMed] [Google Scholar]
  • 55.Al-Mulla F, Hagan S, Behbehani AI, Bitar MS, George SS, Going JJ, García JJ, Scott L, Fyfe N, Murray GI, et al. Raf kinase inhibitor protein expression in a survival analysis of colorectal cancer patients. J Clin Oncol. 2006;24:5672–5679. doi: 10.1200/JCO.2006.07.5499. [DOI] [PubMed] [Google Scholar]
  • 56.Chatterjee D, Sabo E, Tavares R, Resnick MB. Inverse association between Raf kinase inhibitory protein and signal transducers and activators of transcription 3 expression in gastric adenocarcinoma patients: implications for clinical outcome. Clin Cancer Res. 2008;14:2994–3001. doi: 10.1158/1078-0432.CCR-07-4496. [DOI] [PubMed] [Google Scholar]
  • 57.Wang J, Yang YH, Wang AQ, Yao B, Xie G, Feng G, Zhang Y, Cheng ZS, Hui L, Dai TZ, et al. Immunohistochemical detection of the Raf kinase inhibitor protein in nonneoplastic gastric tissue and gastric cancer tissue. Med Oncol. 2010;27:219–223. doi: 10.1007/s12032-009-9194-z. [DOI] [PubMed] [Google Scholar]
  • 58.Hu CJ, Zhou L, Zhang J, Huang C, Zhang GM. Immunohistochemical detection of Raf kinase inhibitor protein in normal cervical tissue and cervical cancer tissue. J Int Med Res. 2011;39:229–237. doi: 10.1177/147323001103900125. [DOI] [PubMed] [Google Scholar]
  • 59.D'Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S, Gostissa M, Coen S, Marchetti A, Del Sal G, et al. Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol. 2002;4:11–19. doi: 10.1038/ncb714. [DOI] [PubMed] [Google Scholar]
  • 60.Hofmann TG, Möller A, Sirma H, Zentgraf H, Taya Y, Dröge W, Will H, Schmitz ML. Regulation of p53 activity by its interaction with homeodomain-interacting protein kinase-2. Nat Cell Biol. 2002;4:1–10. doi: 10.1038/ncb715. [DOI] [PubMed] [Google Scholar]
  • 61.Taira N, Nihira K, Yamaguchi T, Miki Y, Yoshida K. DYRK2 is targeted to the nucleus and controls p53 via Ser46 phosphorylation in the apoptotic response to DNA damage. Mol Cell. 2007;25:725–738. doi: 10.1016/j.molcel.2007.02.007. [DOI] [PubMed] [Google Scholar]
  • 62.Chang YS, Lee KY, Lee SH, Koh SH, Hong SW, Chi SG. Expression and mutation analysis of RKIP (Raf-1 kinase inhibitor protein) in human gastric cancer. J Korean Surg Soc. 2007;73:121–129. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures and Tables
neo1507_0727SD1.pdf (1.9MB, pdf)

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press

RESOURCES