Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2004 Mar;78(5):2609–2614. doi: 10.1128/JVI.78.5.2609-2614.2004

Requirement of a 12-Base-Pair TATT-Containing Sequence and Viral Lytic DNA Replication in Activation of the Kaposi's Sarcoma-Associated Herpesvirus K8.1 Late Promoter

Shuang Tang 1, Koji Yamanegi 1, Zhi-Ming Zheng 1,*
PMCID: PMC369211  PMID: 14963167

Abstract

Kaposi's sarcoma-associated herpesvirus (KSHV) K8.1 late promoter consists of a minimal 24-bp sequence, with a TATA-like, 12-bp promoter core, AATATTAAAGGG, and is active on a reporter only in butyrate-induced KSHV-infected cells. The activity of the K8.1 promoter can be enhanced (>15-fold) by the KSHV left-end lytic origin of DNA replication (oriLyt-L) sequence while providing inefficient replication of plasmid DNA and is inhibited by viral DNA replication inhibitors, suggesting that activation of the K8.1 promoter on the reporter is involved in KSHV lytic DNA replication largely by trans.


Kaposi's sarcoma-associated herpesvirus (KSHV) closely resembles human Epstein-Barr virus (EBV) (4). Like other gammaherpesviruses, KSHV infection displays two viral life cycles. Latent KSHV infection in KS tissues and B-cell lines features the highly restricted expression of only five genes (7, 33). The lytic KSHV life cycle is characterized by production of progeny virus from infected cells and can be induced by tetradecanoyl phorbol acetate and n-butyrate in PEL-derived B cells with latent KSHV infection (21, 22, 24).

KSHV K8.1 is a viral late gene that encodes a viral envelope glycoprotein at a late stage of virus infection. The sensitivity of K8.1 expression to a viral DNA polymerase inhibitor, phosphonoacetic acid (PAA) (17, 29), suggests that K8.1 is a true late gene (γ2) whose expression, like that of other herpesvirus γ2 genes (11, 19, 28, 30, 31), depends on viral DNA replication.

Transcription of the K8.1 late gene in butyrate-induced KSHV-infected JSC-1 cells starts at nucleotide (nt) 75901, 14 nt upstream of the first AUG codon at nt 75915 in the virus genome (29). As a result, a putative K8.1 promoter was hypothesized to exist upstream of the start site for transcription initiation.

To study the putative K8.1 promoter, we had to overcome some technical limitations. The putative predicted K8.1 promoter overlaps two KSHV genes: ORF50 and K8 (32). ORF50 encodes a transactivator, RTA (replication and transcription activator), responsible for initiating all KSHV early gene expression. K8 is a gene encoding a leucine zipper protein involved in viral DNA replication (16). Mutation in this region in the context of the virus genome will affect expression of the ORF50 and K8 genes and viral DNA replication. Thus, it is not feasible to study the K8.1 late promoter in its native context. As an alternative, we established a transient-transfection assay to study the putative K8.1 promoter, using various sizes of PCR-amplified fragments immediately upstream of nt 75915, but not overlapping the K8 promoter region (17). All fragments were cloned into the KpnI and XhoI sites upstream of the firefly luciferase open reading frame (ORF) in a pGL3 luciferase reporter vector lacking eukaryotic origins of replication (Promega, Madison, Wis.). The activity of each promoter-firefly luciferase reporter construct was examined from cell lysate supernatant by a dual luciferase assay (Promega) 48 h after transfection of 3 μg of the construct, together with 2 μg of Renilla luciferase reporter (RL-TS) (13) and 14 μg of sheared salmon sperm DNA into B lymphocytes (5 × 106 cells) by electroporation at 250 V and 950 μF with an Electro Cell Manipulator (BTX ECM630; BTX, San Diego, Calif.).

KSHV K8.1 promoter activity is induced in KSHV-infected cells only by trans.

Plasmid pST7 (Fig. 1C) was first examined for its promoter activity in 293 cells and showed no activity with or without chemical stimulation and ORF50 and/or K8 cotransfection (data not shown). This experiment excluded the possibility of an immediate-early or early promoter-like activity residing in this construct. Next, we examined the promoter activity of the pST7 plasmid in several B-cell lines, including Raji (EBV-infected but replication-defective) cells (6), SUDHL6 cells (a B-cell line with no virus infection) (18), JSC-1 (KSHV-infected, EBV-infected cells), and BCBL-1 (KSHV-infected, non-EBV-infected) cells. The pST7 plasmid conferred no or very little promoter activity in either butyrate-stimulated or unstimulated Raji cells and SUDHL6 cells but conferred strong promoter activity in both butyrate-stimulated JSC-1 (Fig. 1A) and BCBL-1 cells (Fig. 1B) that was comparable to that of the simian virus 40 (SV40) early promoter (pGL3-SV40 vector in Fig. 1A and B), suggesting that a specific KSHV, but not EBV, protein(s) must be involved in trans activation. This regulation has to do with viral lytic but not latent protein(s), since uninduced JSC-1 and BCBL-1 cells did not support much K8.1 promoter activity.

FIG. 1.

FIG. 1.

A putative K8.1 late promoter can be activated by butyrate only in KSHV-infected cell lines. A promoter-luciferase (luc) reporter vector, pST7, containing a 1-kb fragment immediately upstream of the K8.1 ORF, was electroporated into four different B-cell lines: Raji, SUDHL6, JSC-1 (A), and BCBL-1 (B). A series of successive deletions in the 1-kb fragment, beginning at the 5′ end and progressing to the 3′ end, were also examined, and their promoter activities in JSC-1 cells were determined (C). The plasmid name is shown to the left of the schematic representation, and the size (in base pairs) of the insert is shown in parenthesis. Downstream of each insert is a firefly luc gene. The numbers above and below the lines are nucleotide positions of the first and last nucleotides of the insert in the virus genome (GenBank accession number U75698) (25). The K8.1 transcription start site is indicated by the arrow. Cells were collected 48 h after transfection and incubation with or without butyrate (3 mM), and the supernatant of the cell lysate was examined for dual luciferase activities. Relative promoter activity was calculated by dividing the light unit readings obtained from a tested promoter-firefly luciferase reporter construct by the light unit readings obtained from the Renilla luciferase reporter. The pGL3-basic and pGL3-SV40 vectors were used as negative and positive controls, respectively. Panel A shows the results from one of three experiments, and panels B and C show the results from one of two experiments.

Mapping of the K8.1 promoter to a functional promoter core conferring full promoter activity in JSC-1 cells.

To identify the transcription factor-binding sites that might regulate the activity of the K8.1 promoter in viral lytic induction, a series of successive deletions in the 1-kb K8.1 promoter was made from its 5′ end progressively to its 3′ end (Fig. 1C). The deletion mutants did not show much difference in their promoter activity in butyrate-stimulated JSC-1 cells. A 58-bp region proximal to the 3′ end (pST18) contributed a similar amount of promoter activity, as did the 1-kb K8.1 promoter (pST7) (Fig. 1C), indicating that the 58-bp region fully functions as a K8.1 promoter. In addition, a series of plasmids having various 3′ extensions of the 1-kb K8.1 promoter to include additional sequences up to 73 bp downstream of nt 75915 showed only a minimal effect on K8.1 promoter activity (data not shown). Together, these results demonstrate that a functional K8.1 promoter is not subject to regulation by a cis-acting transcription factor-binding site either upstream or downstream of the 58-bp K8.1 promoter.

To better define which sequences within the 58-bp region specify K8.1 promoter activity, another series of deletion or point mutations were made in the 58-bp promoter. Examination of the promoter activity of each mutant in butyrate-stimulated JSC-1 cells (Fig. 2A) demonstrated that the K8.1 promoter activity resides in the 24 bp at its 5′ half (pST41) and is orientation sensitive (pST36), suggesting its independence on an initiator (Inr) at the transcription start site or downstream activation sequences (DAS) as described in other viral late promoters (8, 10, 14, 15, 23). The sequence of the 5′ half of the 58-bp promoter, CCGGCAGCAATATTAAAGGGACCC, features a central TATA-like motif, TATT, flanked by several A's. To characterize the function of this putative TATA-like motif, we chose a 3′-truncated 45-bp promoter (pST34) with promoter activity similar to that of the 58-bp promoter (pST18) in butyrate-induced JSC-1 cells for introduction of point mutations. The conversion of TT to CG in the TATT motif (pST37) effectively disrupted its activation by butyrate in JSC-1 cells.

FIG. 2.

FIG. 2.

Localization of the K8.1 late promoter by fine mutational analysis to a 24-bp region upstream of the K8.1 transcription start site and its binding to TBP. (A) A series of deletion or point mutations were introduced into plasmid pST18, which contains a 58-bp K8.1 promoter. Plasmid pST36 has a 3′-truncated, 45-bp K8.1 promoter in an antisense orientation. The resulting mutants were tested in butyrate-treated or untreated JSC-1 cells. (B) Randomized 3-bp linker-scanning mutational analysis. Sequences of the 24-bp K8.1 promoter with or without substitution by a randomized 3-bp linker are shown. Unchanged nucleotides in panels A and B are indicated (.). Panels A and B show data from one of three experiments in JSC-1 cells with or without 48-h butyrate treatment. (C) TBP binding of the 24-bp K8.1 promoter was performed with bacterium-expressed yeast TBP (2 ng) (ProteinOne, College Park, Md.). wt and mutant (MT) double-stranded DNA oligonucleotides, equivalent to the K8.1 promoter sequences in pST41 and pST46, respectively, were labeled with 32P and used for the protein-DNA complex formation that was resolved on a 4% native polyacrylamide gel (9).

Having identified that a 24-bp sequence in the 5′ half of the 58-bp K8.1 promoter is responsible for the promoter activity and that the TATT motif within the 5′ half functions as a TATA box, we wished to determine whether the sequences flanking this TATT box are important for the sufficient and active function of the TATA-like box. A randomized 3-bp linker-scanning mutation was introduced progressively from 5′ to 3′ into the 24-bp K8.1 promoter, and each mutant was analyzed in butyrate-stimulated JSC-1 cells. As shown in Fig. 2B, the sequences flanking the TATT box were demonstrated to play important roles in trans activation of the 24-bp promoter by butyrate. Interestingly, the wild-type (wt) but not mutant 24-bp promoter by itself was capable of binding the TATA-binding protein (TBP) in our gel shift assays (Fig. 2C). Thus, a K8.1 late promoter core was identified; it consists of a 12-bp sequence (AATATTAAAGGG), including the TATT box at position −34 relative to the K8.1 transcription start site and its flanking sequences immediately upstream and downstream.

The size of the crucial 12-bp K8.1 promoter core is similar to that of the herpes simplex virus type 1 gC late promoter core (12). Both are embedded in GC-rich flanking sequences and contain signals essential for fully regulated activation. However, the gC promoter core has a sequence, GGGTATAAATTCCGG, which deviates from the consensus Goldberg-Hogness sequence (GGGTATAAATA) (2) by only 1 nt, whereas the defined K8.1 12-bp promoter core, like the SV40 11-bp late promoter core (GGTACCTAACC) (2), deviate much further from the Goldberg-Hogness sequence. A TATT box, deviating by 1 nt at the fourth position from the sequence of the classical TATA box for TBP binding to recruit RNA polymerase II, appears to be common in many viral late promoters, including cytomegalovirus UL94 (31) and UL75 (20), EBV BcLF1 (26), and KSHV AP (3).

Sensitivity of trans-activated K8.1 late promoter activity to PAA and GCV in butyrate-induced JSC-1 cells.

To examine whether the K8.1 promoter identified in our transient-transfection assay could represent an authentic late promoter in responding to viral DNA replication inhibitors, two versions of the K8.1 promoter, a 1-kb promoter in pST7 and a 24-bp promoter in pST41, were further analyzed in butyrate-induced JSC-1 cells in the presence or absence of PAA or ganciclovir (GCV). The activities of both promoters were sensitive to PAA, but not GCV (Fig. 3A and B), with PAA inhibiting promoter activity by up to 60%, indicating an association with viral lytic DNA replication. Although PAA did not inhibit the transient K8.1 promoter activity completely, this was expected, since neither of the vectors containing the K8.1 promoter was able to replicate, due to lack of eukaryotic origins of DNA replication. This was further supported by data showing that the transient promoter activity in butyrate-induced JSC-1 cells was insensitive to a DNA chain elongation terminator, GCV (5). However, transcription of the late gene K8.1 in JSC-1 cells was sensitive to both PAA (96% inhibition) and GCV (87% inhibition) (Fig. 3C), suggesting that our transient promoter assay reveals only a partial recapitulation of activation of the authentic late promoter in the context of the virus genome.

FIG.3.

FIG.3.

Inhibition by PAA (0.4 mM) and GCV (50 μM) of K8.1 promoter activity and KSHV K8.1 mRNA expression in butyrate-induced JSC-1 cells. (A and B) The activities of a 1-kb (pST7) and a 24-bp K8.1 promoter (pST41) in transfected JSC-1 cells were analyzed (Fig. 1). Panels A and B show the data from one of three experiments. Abbreviations: No treat., no treatment; Bu., butyrate. (C) Total cell RNA extracted at 48 h from JSC-1 cells treated with (+) or without (−) butyrate, PAA, and GCV was analyzed for K8.1 mRNA with an RNase protection assay by using an antisense RNA probe C (29). A human cyclophilin antisense probe (Ambion, Austin, Tex.) was also used as an internal control for normalization of sampling.

A viral oriLyt functions in cis, acting to enhance activation by trans of the K8.1 late promoter.

To overcome the replication incompetence of the plasmids described above, a KSHV left-end lytic origin of DNA replication (oriLyt-L) (1) was inserted downstream of the luciferase ORF driven by the K8.1 promoter. Five original K8.1 promoter plasmids (pST41, pST7, pST26, pST36, and pST46) were chosen for insertion of the KSHV oriLyt-L sequence (Fig. 4A), and their promoter activities were examined in butyrate-induced JSC-1 cells. As shown in Fig. 4B, once the oriLyt sequence was inserted, the promoter activities of plasmids with a wt K8.1 promoter either in a long (1-kb) or short (24-bp) version (pST52, pST53, pST60, pST54, and pST55) were greatly enhanced (more than 15-fold) with butyrate, independent of oriLyt orientation. The same sets of plasmids with a wt K8.1 promoter plus the viral oriLyt were also tested in butyrate-induced BCBL-1 cells and 293 cells. The plasmids reproducibly showed the same results only in butyrate-induced BCBL-1 cells, not in 293 cells (data not shown). In contrast, the K8.1 promoter with mutations in its TATT box or in an antisense orientation did not have enhanced activity in the presence of oriLyt (pST61, pST57, pST58, and pST59 in Fig. 4B). This was expected, since the original plasmids (pST46 and pST36) lacking the viral oriLyt sequence had no promoter activity (Fig. 2A and B).

FIG. 4.

FIG. 4.

KSHV oriLyt-driven transient K8.1 promoter activity, plasmid DNA replication, and their sensitivities to PAA and GCV in butyrate-treated JSC-1 cells. (A) Construction of KSHV oriLyt-containing plasmids. KSHV oriLyt-L (1) was inserted in different orientations (counterclockwise [CCW] and clockwise [CW]) into AgeI and NsiI sites introduced as a synthetic BamHI linker downstream of the luc ORF driven by a wt, mutant (mt), or antisense (as) K8.1 promoter. The sizes of the K8.1 promoter insert in pST26 and pST55 (derived from pST26) were similar to the size of the K8.1 promoter insert in pST7 (Fig. 1), but pST26 and pST55 were extended to include an additional 73 nt downstream where two ATG codons were mutated to TTG to avoid a frameshift in the luc ORF. (B) Enhancement of K8.1 promoter activity by KSHV oriLyt in JSC-1 cells with or without butyrate induction. The data shown are from one of two experiments. (C) KSHV oriLyt-enhanced activity of the K8.1 promoter is sensitive to both PAA (0.4 mM) and GCV (50 μM). Plasmid pST53-transfected JSC-1 cells in the presence or absence of PAA, GCV, and butyrate (Bu.) at 48 h after transfection were examined for K8.1 promoter activity. The original plasmid lacking the oriLyt insert, pST41, and plasmids pGL3-basic and pGL3-SV40 promoter were used as controls. The data shown are from one of two experiments. No treat., no treatment. (D) Transient pST53 DNA replication and its sensitivity to PAA (0.4 mM) and GCV (50 μM) by Southern blot assay. Total cell DNA extracted from JSC-1 cells (107) 48 h after transfection by electroporation with 20 μg of pST53 and incubation with (+) or without (−) butyrate (Bu.), PAA, or GCV was digested with one (XhoI), two (XhoI and DpnI), or three (XhoI, DpnI, and MboI) restriction enzymes and analyzed by Southern blotting for plasmid DNA replication. Digestion with XhoI linearizes the plasmid DNA, digestion with DpnI removes residual methylated (unreplicated) input DNA, and digestion with MboI cleaves unmethylated, replicated DNA. Lanes 1 to 4 contain 5% of the total DNA used for each assay, and lanes 5 to 8 contain 95% of the total DNA.

The much higher level of K8.1 promoter activity in butyrate-induced JSC-1 cells with the viral oriLyt-containing plasmid p53 (Fig. 4A) was sensitive to PAA and GCV, with an inhibition up to 97% by PAA and 80% by GCV (Fig. 4C). Thus, the 24-bp promoter on this plasmid appeared to fully imitate the activation of an authentic K8.1 promoter in responding to viral lytic DNA replication and DNA replication inhibitors in the context of the virus genome. The finding that GCV, a DNA chain elongation terminator, inhibited the oriLyt-enhanced K8.1 promoter activity provides further evidence that KSHV lytic DNA replication, including DNA chain elongation, is itself directly engaged in activation of the late promoter on the reporter.

To determine whether the viral oriLyt-enhanced K8.1 promoter activity is attributable to plasmid replication, a transient-replication assay (1) was conducted in parallel with pST53. As shown in Fig. 4D, inserting KSHV oriLyt in pST53 conferred only a very low level of plasmid DNA replication in butyrate-induced JSC-1 cells, as evidenced by the presence of some DpnI-resistant DNA (lane 6) and its sensitivity to MboI digestion (lane 7) and to DNA replication inhibitors PAA and GCV (lanes 8 and 9). These results indicate that maintenance of plasmid DNA replication or template (copy number) amplification is unlikely to play a major role in inducing a much higher level of activation of the K8.1 promoter on the reporter, as presented in a study on the cytomegalovirus late 1.2-kb RNA promoter (30).

The specific trans-acting factors important to K8.1 promoter activation in KSHV-infected cells appear to be independent of viral ORF50, since cotransfection with ORF50 did not promote much promoter activity of both replication-competent and -incompetent plasmids (data not shown). If ORF50 has any effect, it might be indirect. We speculate that this trans-acting factor(s) may be a component(s)-perhaps a viral early gene product(s)-of the viral lytic, but not latent, DNA replication (initiation and elongation) machinery, since uninduced JSC-1 cells did not support much K8.1 promoter activity. A similar observation in the EBV late promoters BcLF1 and BFRF3 supports such a trans relationship (27). Although the underlying mechanisms that link the late promoter activation and KSHV lytic DNA replication remain unknown and the reporter assays in this study may not fully reflect regulation in the intact virus, the finding that KSHV K8.1 late promoter can be activated largely by trans in viral lytic DNA replication provides a new insight into regulation of KSHV late gene expression.

Acknowledgments

We thank Richard Ambinder of the Johns Hopkins University School of Medicine for providing JSC-1 cells, Louis Staudt of NCI for providing SUDHL6 cells, Hui Ge of ProteinOne for providing yeast TBP protein, and David AuCoin and Gregory Pari of the University of Nevada School of Medicine for providing plasmid pDA13 for this study. BCBL-1 cells were obtained from Michael McGrath and Don Ganem through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. We also thank John Brady and Robert Yarchoan for critically reading the manuscript.

REFERENCES

  • 1.AuCoin, D. P., K. S. Colletti, Y. Xu, S. A. Cei, and G. S. Pari. 2002. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) contains two functional lytic origins of DNA replication. J. Virol. 76:7890-7896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brady, J., M. Radonovich, M. Vodkin, V. Natarajan, M. Thoren, G. Das, J. Janik, and N. P. Salzman. 1982. Site-specific base substitution and deletion mutations that enhance or suppress transcription of the SV40 major late RNA. Cell 31:625-633. [DOI] [PubMed] [Google Scholar]
  • 3.Chang, J., and D. Ganem. 2000. On the control of late gene expression in Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol. 81:2039-2047. [DOI] [PubMed] [Google Scholar]
  • 4.Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869. [DOI] [PubMed] [Google Scholar]
  • 5.Crumpacker, C. 2001. Antiviral therapy, p. 393-433. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, vol. 1. Lippincott Williams & Wilkins, Philadelphia, Pa.
  • 6.Decaussin, G., V. Leclerc, and T. Ooka. 1995. The lytic cycle of Epstein-Barr virus in the nonproducer Raji line can be rescued by the expression of a 135-kilodalton protein encoded by the BALF2 open reading frame. J. Virol. 69:7309-7314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fakhari, F. D., and D. P. Dittmer. 2002. Charting latency transcripts in Kaposi's sarcoma-associated herpesvirus by whole-genome real-time quantitative PCR. J. Virol. 76:6213-6223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Farrell, M. L., and J. E. Mertz. 2002. Cell type-specific replication of simian virus 40 conferred by hormone response elements in the late promoter. J. Virol. 76:6762-6770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ge, H., and R. G. Roeder. 1994. Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell 78:513-523. [DOI] [PubMed] [Google Scholar]
  • 10.Guzowski, J. F., and E. K. Wagner. 1993. Mutational analysis of the herpes simplex virus type 1 strict late UL38 promoter/leader reveals two regions critical in transcriptional regulation. J. Virol. 67:5098-5108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Holland, L. E., K. P. Anderson, C. Shipman, Jr., and E. K. Wagner. 1980. Viral DNA synthesis is required for the efficient expression of specific herpes simplex virus type 1 mRNA species. Virology 101:10-24. [DOI] [PubMed] [Google Scholar]
  • 12.Homa, F. L., J. C. Glorioso, and M. Levine. 1988. A specific 15-bp TATA box promoter element is required for expression of a herpes simplex virus type 1 late gene. Genes Dev. 2:40-53. [DOI] [PubMed] [Google Scholar]
  • 13.Ibrahim, N. M., A. C. Marinovic, S. R. Price, L. G. Young, and O. Frohlich. 2000. Pitfall of an internal control plasmid: response of Renilla luciferase (pRL-TK) plasmid to dihydrotestosterone and dexamethasone. BioTechniques 29:782-784. [DOI] [PubMed] [Google Scholar]
  • 14.Kibler, P. K., J. Duncan, B. D. Keith, T. Hupel, and J. R. Smiley. 1991. Regulation of herpes simplex virus true late gene expression: sequences downstream from the US11 TATA box inhibit expression from an unreplicated template. J. Virol. 65:6749-6760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kim, D. B., S. Zabierowski, and N. A. DeLuca. 2002. The initiator element in a herpes simplex virus type 1 late-gene promoter enhances activation by ICP4, resulting in abundant late-gene expression. J. Virol. 76:1548-1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lin, C. L., H. Li, Y. Wang, F. X. Zhu, S. Kudchodkar, and Y. Yuan. 2003. Kaposi's sarcoma-associated herpesvirus lytic origin (ori-Lyt)-dependent DNA replication: identification of the ori-Lyt and association of K8 bZip protein with the origin. J. Virol. 77:5578-5588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lin, S. F., D. R. Robinson, G. Miller, and H. J. Kung. 1999. Kaposi's sarcoma-associated herpesvirus encodes a bZIP protein with homology to BZLF1 of Epstein-Barr virus. J. Virol. 73:1909-1917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lossos, I. S., A. A. Alizadeh, M. B. Eisen, W. C. Chan, P. O. Brown, D. Botstein, L. M. Staudt, and R. Levy. 2000. Ongoing immunoglobulin somatic mutation in germinal center B cell-like but not in activated B cell-like diffuse large cell lymphomas. Proc. Natl. Acad. Sci. USA 97:10209-10213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mavromara-Nazos, P., and B. Roizman. 1987. Activation of herpes simplex virus 1 gamma 2 genes by viral DNA replication. Virology 161:593-598. [DOI] [PubMed] [Google Scholar]
  • 20.McWatters, B. J., R. M. Stenberg, and J. A. Kerry. 2002. Characterization of the human cytomegalovirus UL75 (glycoprotein H) late gene promoter. Virology 303:309-316. [DOI] [PubMed] [Google Scholar]
  • 21.Miller, G., M. O. Rigsby, L. Heston, E. Grogan, R. Sun, C. Metroka, J. A. Levy, S. J. Gao, Y. Chang, and P. Moore. 1996. Antibodies to butyrate-inducible antigens of Kaposi's sarcoma-associated herpesvirus in patients with HIV-1 infection. N. Engl. J. Med. 334:1292-1297. [DOI] [PubMed] [Google Scholar]
  • 22.Moore, P. S., S. J. Gao, G. Dominguez, E. Cesarman, O. Lungu, D. M. Knowles, R. Garber, P. E. Pellett, D. J. McGeoch, and Y. Chang. 1996. Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J. Virol. 70:549-558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Petroski, M. D., and E. K. Wagner. 1998. Purification and characterization of a cellular protein that binds to the downstream activation sequence of the strict late UL38 promoter of herpes simplex virus type 1. J. Virol. 72:8181-8190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346. [DOI] [PubMed] [Google Scholar]
  • 25.Russo, J. J., R. A. Bohenzky, M. C. Chien, J. Chen, M. Yan, D. Maddalena, J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. USA 93:14862-14867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Serio, T. R., N. Cahill, M. E. Prout, and G. Miller. 1998. A functionally distinct TATA box required for late progression through the Epstein-Barr virus life cycle. J. Virol. 72:8338-8343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Serio, T. R., J. L. Kolman, and G. Miller. 1997. Late gene expression from the Epstein-Barr virus BcLF1 and BFRF3 promoters does not require DNA replication in cis. J. Virol. 71:8726-8734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Summers, W. C., and G. Klein. 1976. Inhibition of Epstein-Barr virus DNA synthesis and late gene expression by phosphonoacetic acid. J. Virol. 18:151-155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Tang, S., and Z. M. Zheng. 2002. Kaposi's sarcoma-associated herpesvirus K8 exon 3 contains three 5′-splice sites and harbors a K8.1 transcription start site. J. Biol. Chem. 277:14547-14556. [DOI] [PubMed] [Google Scholar]
  • 30.Wade, E. J., and D. H. Spector. 1994. The human cytomegalovirus origin of DNA replication (oriLyt) is the critical cis-acting sequence regulating replication-dependent late induction of the viral 1.2-kilobase RNA promoter. J. Virol. 68:6567-6577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wing, B. A., R. A. Johnson, and E. S. Huang. 1998. Identification of positive and negative regulatory regions involved in regulating expression of the human cytomegalovirus UL94 late promoter: role of IE2-86 and cellular p53 in mediating negative regulatory function. J. Virol. 72:1814-1825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zheng, Z. M. 2003. Split genes and their expression in Kaposi's sarcoma-associated herpesvirus. Rev. Med. Virol. 13:173-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhong, W., H. Wang, B. Herndier, and D. Ganem. 1996. Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proc. Natl. Acad. Sci. USA 93:6641-6646. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES