Msx2 plays a critical role in lens epithelium cell cycle control

Abstract

AIM

To investigate the effects of Msx2 on lens epithelium cell cycle, and evaluate the changes of the proliferation, apoptosis of lens epithelium cells.

METHODS

Mice lens epithelium cells were cultured and transfected with pEGFP-Msx2 and control. Msx2-deficient mice (Msx2^−/−) lens tissue were isolated. Lens tissue and transfected cells were prepared for mRNA extraction using Trizol reagent. CyclinD1 and Prox1 expression were evaluated by real-time RT-PCR. BrdU incorporation and apoptosis rate were investigated by immunofluorescence and flow cytometry analysis.

RESULTS

After transfected with pEGFP-Msx2, lens epithelium cells failed to incorporate BrdU and anti-phospho-histone-3 immunofluorescence failed to detect cell nuclei which GFP were positive. Msx2 over expression resulted in increasing apoptosis rate in lens epithelium cells. CyclinD1 and Prox1 expression increased significantly in Msx2 knockout mice by real-time RT-PCR quantization and CyclinD1 expression decreased significantly in Msx2 overexpressed cell.

CONCLUSION

Msx2 has the effect of inhibiting proliferation and differentiation, triggering apoptosis on mice lens epithelium cells.

INTRODUCTION

Lens provides an essential function of transmitting and focusing light onto the retina. The lens contains a monolayer of epithelial cells at the anterior surface and a mass of elongated fiber cells that extend from the anterior to the posterior sutures^[1]. Epithelial cells proliferate, migrate to the equator, and differentiate to produce new fiber cells, leading to radially symmetric lens growth^[2],^[3].

Many factors influence the lens development, including Msx homeobox gene^[4]-^[10]. Msx genes are important regulators of eye developmental processes. Developmental anomalies associated with gain- and loss-of-function mutations in Msx1 and Msx2 clearly demonstrate the importance of these homeodomain transcriptional factors in controlling the development of the skull, hair follicles, teeth, heart and the brain^[11]-^[17]. Consistent with their role in controlling eye development is our previous finding that loss of Msx2 function down-regulated the FoxE3 expression and resulted in anterior segment dysgenesis resembling peters anomaly^[10]. These phenotypes could be consistent with Msx2's role in regulating cell proliferation and differentiation processes. Temporal control of cell fate decisions is critically important, which ensure that differentiation events are executed in the correct sequence. In this study, we attempted to clarify the role of Msx2 in lens epithelium cell proliferation and differentiation.

Materials and methods

Cell culture and DNA transfection

Alpha-TN4 mice lens epithelium cells were seeded into 6-well plates and maintained in Dulbecco's modified Eagle's medium (Hyclone, Logan, UT, USA) in the presence of 10% fetal bovine serum and 20µmol/L BrdU. When the cells attained 60%-80% confluence, transfections were performed using Lipofectamine (Invitrogen, Carlsbad, CA) according to existing transfection protocol^[18]. pEGFP-Msx2 and pEGFP-C1 plasmid (a gift from professor Yi-Hsin Liu, Southern California University, USA) were used and each transfection was carried out in triplicate.

Experimental mice breeding and genotyping

All animal experiments followed the guidelines of the Association for Research in Vision and Ophthalmology Statement for the ‘Use of Animals in Ophthalmic and Vision Research’. Experimental mice are the off springs of homozygous Msx2-deficient mice strains(Msx2^−/−)^[19]. Mice genomic DNA from the embryonic tail tissue was extracted using the hot sodium hydroxide and Tris (HotSHOT) method.

Immunofluorescence

Twenty-four hours after transfection, Alpha-TN4 cells were fixed in 4% PFA for 10 minutes and washed with PBS. Anti-BrdU and anti-phospho-histone3 antibody (Sigma-Aldrich, St. Louis, MO, USA) were added into the well and incubated for 2 hours at room temperature. To probe for the primary antibodies, a goat anti-rabbit or a rabbit anti-mouse secondary antibody conjugated to rhodamine red (Invitrogen, Carlsbad, CA, USA) was added and incubated for 30 minutes. Fluorescence images were acquired using an Olympus inverted fluorescent microscope equipped with a SPOT CCD camera.

Quantitative teal-time reverse transcription PCR

Twenty-four hours after transfection, total RNA was isolated from transfected Alpha-TN4 cells. And the pregnant females were sacrificed at E19 days and lens tissue of the embryo were isolated in ice-cold PBS. Lens tissue and transfected cells were prepared for mRNA extraction using Trizol reagent (Invitrogen) according to the manufacturer's recommendation. cDNA were synthesized using the SuperScript III First-Strand Synthesis kit (Invitrogen).

Quantitative real-time PCR was carried out using SYBR Green fluorescence dye (TaKaRa China) on a Realtime-PCR system (Applied BioSystems, CA). PCR primers used in this study were listed in Table 1. All samples were run in triplicate, and the relative levels of each of mRNA were normalized to those of beta-actin.

Table 1. PCR primer sequences used in material and method.

Primer	Sequence (5′-3′)
CyclinD1	GAGGAGCAGAAGTGCGAAGA
	GAGGGTGGGTTGGAAATGA
Prox1	TTGATGTGGATCGCTTATGT
	CTTCTGCTTGCGTTTGTTT
Beta-actin	CATCCGTAAAGACCTCTATGCCAAC
	ATGGAGCCACCGATCCACA

Flow cytometry analysis

The effects of Msx2 on the apoptosis of Alpha-TN4 cells were determined by flow cytometry using the Annexin V: propidium iodide (PI) Apoptosis Detection Kit (KAIJI Biotech, Nanjing, China) according to the recommended protocol. Ten thousand cells were counted, per sample. The data were analyzed with cell quest software.

Statistical Analysis

For the statistical analysis of two groups, the unpaired t-test was used. Statistical tests were performed using commercial software (SPSS, version 13.0). Error bars are ±SEM.

Results

Msx2 inhibited lens epithelium cell proliferation

In over expressed Msx2 alpha-TN4 cell line, transfected cells were then labeled with BrdU to ascertain the status of cell proliferation. As shown in Figure 1, Msx2-GFP positive cells failed to incorporate BrdU. We found anti-phospho-histone-3 immunofluorescence failed to detect GFP-positive cell nuclei which confirm that cells over-expressed Msx2-GFP were selectively prevented from entering mitosis (Figure 2).

Figure 1. Msx2-GFP positive cells failed to incorporate BrdU.

A: Msx2-GFP transfected cells (arrow head); B: BrdU positive cells (arrow); C: Merged image showed that GFP positive cells failed to incorporate BrdU.

Figure 2. Anti-phospho-histone-3 immunofluorescence failed to detect cell nuclei that were GFP positive.

A: Msx2-GFP transfected cells (arrow); B: Anti-phospho-histone-3 positive cells (arrow head); C: Merged image showed that anti-phospho-histone-3 immunofluorescence failed to detect cell nuclei that were GFP positive.

Msx2 induced lens epithelium cell apoptosis

To further characterize the putative properties of Msx2, we examined the effect of Msx2 on alpha-TN4 cells by using flow cytometry analysis. As shown in Figure 3, percentage of apoptotic cells was significantly increased in alpha-TN4 cells transfected with Msx2, as compared to those with control (P<0.05).

Figure 3. Over expressed Msx2 induced lens epithelium cell apoptosis.

A: pEGFP-C1 transfected cells, apoptosis cell rate was 11.19%; B: pEGFP-Msx2 transfected cells, apoptosis cell rate was 26.52%; C: Bar diagram of apoptosis cell rate of both group (P<0.05).

Msx2 inhibited CyclinD1 and Prox1 expression in Msx2 knockout mice lens tissue

Of the cell cycle regulatory genes examined, we found Prox1 and CyclinD1 expression increased significantly in Msx2 knockout mice lens comparing with their wildtype littermates (9.81 fold and 6.46 fold) (Figure 4A, B). And, we found that the most prominent effect of Msx2 over-expression was a robust decrease in CyclinD1 expression (5.13 fold) whereas over-expression of the control plasmid had no significant effect by real time RT-PCR (Figure 4C).

Figure 4. Prox1 and CyclinD1 expression in Msx2 knockout mice lens and lens epithelium cells.

A: Prox1 expression level in Msx2 knockout mice lens (24.82±1.53) and their wildtype littermates (2.53±1.02) (P<0.05); B: CyclinD1 expression in Msx2 knockout mice lens (20.54±1.14) and their wildtype littermates (3.18±0.73) (P<0.05); C: CyclinD1 expression in Msx2 overexpressed lens epithelium cells (1.43±0.38) and control (5.38±0.64) (P<0.05).

Discussion

Homeobox genes are a large family of developmental regulatory genes that have diverse activities during embryogenesis. The biological functions of many homeobox genes have been elucidated through loss- and gain-of-function analyses, which have demonstrated their essential roles in controlling cellular proliferation and differentiation during development. Previously, over-expression of the Msx2 gene in transgenic animals resulted in microphthalmia. These phenotypes could be consistent with Msx2's role in regulating cell proliferation and differentiation processes. We have demonstrated that Msx2 was a significant contributor to eye development. Loss-of-function of Msx2 led to a range of eye defects with a minuscule lens vesicle and persistent lens stalk as being the most severe phenotypes^[10]. So we overexpressed Msx2 in lens epithelium cell in order to observe the effect on cell cycle.

Our results showed that over-expressed Msx2 inhibited lens epithelium cell incorporate BrdU, and anti- phospho-histone-3 immunofluorescence was negative which meant that cells proliferation process were disturbed. And overexpressed Msx2 induced apoptosis by flow cytometry analysis, which signified Msx2's important role in controlling the cell cycle of the lens epithelium cell. Therefore, Msx2 inhibited lens epithelium cell proliferation and induced apoptosis in the cell cycle. Previous study proved that over expression of Msx2 transiently suppressed the expression of CyclinD1 and blocked cell proliferation in the retina and delayed the expression of RGC-specific differentiation markers (Math5 and Brn3b), which showed that Msx2 could affect the timing of RGCs fate commitment and differentiation by delaying the timing of cell cycle exit of retinal progenitors. So we detected the CyclinD1 expression and found that over expression Msx2 in lens epithelium cell also suppressed the expression of CyclinD1 and affected the lens epithelium cell cycle. For in vivo quantization test in Msx2 null mutant mice, we proved that CyclinD1 expression increased in the lens of Msx2^−/− mice.

Prox1, which affected the terminal differentiation and elongation of lens fiber cell through regulating the cell cycle controlled gene like Cdkn1c^[20] was a very important gene. Ectopic expression of Prox1 in the mouse retina forced retinal progenitor cells to exit the cell cycle^[21]. Furthermore, results from several other studies provided supporting evidence for Prox1's role in promoting neuronal differentiation and cell cycle withdraw. This pro-differentiation function of Prox1 appears to be evolutionarily conserved among fish, chick and mouse^[22], ^[23]. Thus, it is reasonable to hypothesize that high level of Prox1 expression found in the Msx2^−/− lens may lead to premature cell cycle withdrawal and thus promote cell differentiation. Previous study proved that Prox1 expression was upregulated in the Msx2^−/− lens vesicles due to the reduced FoxE3 expression^[10], but there are no quantitative results by now. Prox1 expression was hard to detect in alpha-TN4 lens epithelium cell line even after transfected Msx2 gene, so we used Msx2 null mutant mice and quantitatively proved that Prox1 expression increased in developing lens.

In summary, our study provided the direct molecular evidence for Msx2 regulating lens epithelium cell proliferation, apoptosis and differentiation, affecting the cell cycle. The observed changes in the expression of CyclinD1 and Prox1 further support the importance of Msx2 in controlling transcription of target genes critical for lens development. Further investigation into these complex interactions among Msx2 and various transcriptional regulators and signaling molecules in directing growth and morphogenetic events in the developing eye should help clarify the function of Msx2.