Nontypeable Haemophilus influenzae Carbonic Anhydrase Is Important for Environmental and Intracellular Survival

Abstract

Nontypeable Haemophilus influenzae (NTHi) is one of the leading causes of noninvasive mucosal infections, such as otitis media, sinusitis, and conjunctivitis. During its life cycle, NTHi is exposed to different CO₂ levels, which vary from ∼0.04% in ambient air during transmission to a new host to over 5% in the respiratory tract and tissues of the human host during colonization and disease. We used the next-generation sequencing Tn-seq technology to identify genes essential for NTHi adaptation to changes in environmental CO₂ levels. It appeared that H. influenzae carbonic anhydrase (HICA), which catalyzes the reversible hydration of CO₂ to bicarbonate, is a molecular factor that is conditionally essential for NTHi survival in ambient air. Growth of NTHi Δcan strains was restored under 5% CO₂-enriched conditions, by supplementation of the growth medium with sodium bicarbonate, or by genetic complementation with the can gene. Finally, we showed that HICA not only is essential for environmental survival but also appeared to be important for intracellular survival in host cells. Hence, HICA is important for NTHi niche adaptation.

INTRODUCTION

Haemophilus influenzae is a human-restricted respiratory tract pathogen that can either be encapsulated (typeable) or unencapsulated (nontypeable) (1). Encapsulated strains are generally more potent and cause invasive systemic infections, e.g., bacteremia and meningitis, whereas nontypeable H. influenzae (NTHi) strains often cause noninvasive mucosal infections, e.g., otitis media, sinusitis, and conjunctivitis. In addition, NTHi is associated with asymptomatic colonization of the nasopharynx. Carriage rates vary from up to 80% in young children to 20% in adults (2, 3).

NTHi is able to adapt to CO₂ levels that vary from ∼0.04% in ambient air to ∼5% in the human host. These changes in environmental CO₂ levels are known to have a profound effect on H. influenzae growth, virulence, and survival. Growth of H. influenzae under CO₂-enriched conditions was previously shown to increase the resistance to antibiotics such as penicillin and erythromycin, possibly by a “pH effect” (4, 5). Also, invasion of epithelial cells by H. influenzae type b appeared to be dependent on supplemental CO₂ (6). Despite previous work, there is only poor knowledge on the molecular mechanisms that contribute to an adequate response of NTHi to variation in environmental CO₂ levels.

The aim of this study was to identify the genes essential for NTHi growth and survival under relatively CO₂-poor conditions. For this, we used Tn-seq, a genome-wide screening method previously used for Streptococcus pneumoniae, Pseudomonas aeruginosa, Salmonella enterica serotype Typhimurium, and H. influenzae (7–11). We identified the H. influenzae carbonic anhydrase (HICA) gene to be absolutely essential for survival and growth of NTHi under ambient CO₂ conditions in vitro. Furthermore, we showed that HICA has an important role in intracellular survival in host immune cells.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

NTHi strains used in this study are listed in Table 1. NTHi was routinely grown in brain heart infusion (BHI) broth (Becton, Dickinson) supplemented with 10 μg/ml hemin (Sigma) and 2 μg/ml β-NAD (Merck) (sBHI). Growth on plates was performed on sBHI agar at 37°C and 5% CO₂. To compare growth under CO₂-poor and CO₂-rich conditions, 15% glycerol stocks of standing mid-log-phase cultures in 5% CO₂-enriched medium were diluted 50- or 100-fold in medium exposed overnight to ambient air (∼0.04% CO₂) or to ambient air enriched with 5% CO₂, respectively. Growth under CO₂-depleted conditions (0% CO₂) was achieved by placing the sBHI agar plates in a confined compartment with a petri dish filled with 10 ml of 10 M potassium hydroxide. Viable bacterial counts were determined by plating serial dilutions in phosphate-buffered saline (PBS) on sBHI agar plates. Optical density was measured at 620 nm (OD₆₂₀). For NTHi mutant libraries and gene deletion mutants, 150 μg/ml spectinomycin (Calbiochem) was used.

Table 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer	Description or sequence	Reference or source
Strains
Rd	Non-encapsulated type D strain	12
3655	NTHi acute otitis media isolate	13
86-028NP	NTHi clinical nasopharyngeal isolate from chronic otitis media patient	14
R2866	NTHi clinical isolate from septic patient	15
Rd Δcan	Rd with the HI1301 gene replaced by an Specr cassette	This study
86-028NP Δcan	86-028NP with the NTHI1614 gene replaced by an Specr cassette	This study
3655 Δcan	3655 with the HI1301 homologue replaced by an Specr cassette	This study
R2866 Δcan	R2866 with the R2866_0883 gene replaced by an Specr cassette	This study
Rd Δcan complemented	Rd with the HI1301 gene replaced by an Specr cassette and the HI1301 gene inserted into HI1018 pseudogene	This study
Plasmids
pGSF8	Donor for marinerT7-MmeI, Specr	This study
pR412T7	Donor for marinerT7	16
Primers
JL_HI1301_L1	CGAACGTTTCTTAGCGGAAG	This study
JL_HI1301_L2	CCACTAGTTCTAGAGCGGCAGGTAATGTGGCGTTTGAT	This study
JL_HI1301_R1	CGAAGGTAAAGGGCATTTG	This study
JL_HI1301_R2	GCGTCAATTCGAGGGGTATCGTGGATCAAGGCGTAATGGC	This study
JL_HI1301_C	CTGCCATAGCAGCATGAATC	This study
JL_NTHi1614_L1	AAAGTGGCGATTGGTGAAAC	This study
JL_NTHi1614_R1	TTAGAGCGTGTCCATCAACC	This study
JL_NTHi1614_C	GACGGCATATTGCACAACAG	This study
PBpR412_L	GCCGCTCTAGAACTAGTGG	17
PBpR412_R	GATACCCCTCGAATTGACGC	17
PBGSF20	ACAGGTTGGATGATAAGTCCCCGGTCT	This study
PBGSF23	CAAGCAGAAGACGGCATACGAAGACCGGGGACTTATCATCCAACCTGT	This study
PBGSF31	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT	This study
PBMrTn9	CAATGGTTCAGATACGACGAC	This study
Rd_HI1301_QPCR_L1	GAAAAACGTGCCGATATGCT	This study
Rd_HI1301_QPCR_R1	CCCAGCCGTGTAATGAGAGT	This study
Q_PCR_Rd_HI1302_F	TTAAACGGCGAAACCTATGC	This study
Q_PCR_Rd_HI1302_R	ATCCGCTAAGGTTGCAAATG	This study
Q_PCR_86-028NP_NTHI1613_F	GAAGGTGAAGGGCATTTGAA	This study
Q_PCR_86-028NP_NTHI1613_R	TTCTTCGCTTTAGCCTGCTC	This study
Q_PCR_86-028NP_NTHI1612_F	ATCTACGCGTTGAAGCCTTG	This study
Q_PCR_86-028NP_NTHI1612_R	GCCCTTCATTTCTTGTACGG	This study
Q_PCR_86-028NP_NTHI1616_F	ACGTATCGGCCAAGTGAAAG	This study
Q_PCR_86-028NP_NTHI1616_R	TAATGCCACAATCGCATCAA	This study
JL_gyrA_QPCR_F	GCGTGTTGTGGGTGATGTAA	18
JL_gyrA_QPCR_R	GTTGTGCCATACGAACGATG	18
HI1018_L1	ATGACCTTCCGCAAAATCTG	This study
HI1018_L2	GAATGTGGAACACTGCCGTAGCTCGGGCTGTAACTTCTAA	This study
HI1018_R1	TACGCATTGTCGGGCTAGAT	This study
HI1018_R2	CCTTTCGGGCGTTATTTTTTGGAGTCAGGCGAAGAGAAT	This study
HI1018_C	ATTTAGCCCTTGAAGCCGAT	This study
HI1301_F	TACGGCAGTGTTCCACATTC	This study
HI1301_R	AAAAATAACGCCCGAAAGG	This study

Stock solutions used for complementation studies were 100 mM uracil in 1 M NaOH, 100 mM adenine in 0.5 M HCl, 100 mM aspartic acid in 0.5 M HCl, 100 mM arginine in H₂O, 100 mM oxaloacetic acid in H₂O, 1 M sodium bicarbonate in H₂O, 200 mM palmitic acid in ethanol, and 200 mM oleic acid in ethanol. For inhibition of carbonic anhydrase activity, 100 mM acetazolamide (AZA) in dimethyl sulfoxide (DMSO) and 100 mM ethoxyzolamide (EZA) in DMSO were used.

Generation of an NTHi 86-028NP transposon mutant library.

Genomic DNA was isolated from mid-log-phase cultures with a QIAgen Genomic-tip 20/G (Qiagen).

To make the genomic array footprinting (GAF) pR412T7 plasmid (16) suitable for Tn-seq, the pR412T7 marinerT7 transposon was PCR amplified with Pwo DNA polymerase (Roche) with a single phosphorylated primer, PBGSF20 (Table 1); PCR cycling conditions were as follows: 93°C for 4 min, followed by 30 cycles of 93°C for 30s, 50°C for 30s, and 68°C for 2 min, with a final step at 68°C for 5 min. The marinerT7-MmeI PCR product was cloned into the pCR2.1 vector of the TA cloning kit (Invitrogen) to obtain pGSF8 and transformed into Escherichia coli by the CaCl₂ competence method (19).

The NTHi marinerT7-MmeI transposon mutant library was generated essentially as described previously (20). Briefly, 1 μg of NTHi 86-028NP genomic DNA was incubated in the presence of purified HimarC9 transposase and 0.5 μg of plasmid pGSF8 as a donor of the marinerT7-MmeI transposon conferring spectinomycin resistance. After repair of the resulting transposition products with Escherichia coli DNA ligase and T4 DNA polymerase, 500 ng of mutagenized DNA was used for NTHi transformation by the method of Herriott et al. (21). For mutant libraries, the required number of colonies was scraped from the plates, pooled, grown to mid-log phase in sBHI medium supplemented with spectinomycin, and stored in 15% glycerol at −80°C.

Identifying NTHi genes essential for survival in ambient air.

The NTHi 86-028NP marinerT7-MmeI transposon mutant library was challenged for a total of ∼20 generations in either CO₂-poor or CO₂-rich sBHI medium. To achieve this, mid-log cultures of the mutant library were diluted 100-fold, grown to mid-log phase, and stored in 15% glycerol at −80°C. This procedure was repeated a total of three times. After the third round of growth, chromosomal DNA was isolated for Tn-seq analysis. Generation times were confirmed by viable bacterial counts.

Readout of the mutant library was performed with Tn-seq as described previously (10) with minor modifications. Briefly, a 200-μl solution with 2 μg of mutant library genomic DNA in NEBuffer 4 (New England BioLabs) with 50 μM S-adenosylmethionine was digested with 10 U of MmeI (New England BioLabs) for 4 h at 37°C and dephosphorylated with 1 U of calf intestine alkaline phosphatase (Invitrogen) for 30 min at 50°C. Next, the reaction product was extracted with 200 μl of phenol-chloroform–isoamyl alcohol (25:24:1), subsequently extracted with 200 μl of chloroform-isoamyl alcohol (24:1), and ethanol precipitated, and the dried DNA pellet was dissolved in 20 μl of H₂O. Tn-seq adapters with a 6-bp barcode were prepared by combining 5 nmol of two matching oligonucleotides in 1× Tris-EDTA (TE) buffer and 50 mM NaCl in a total volume of 50 μl and subjecting the mixture to a 10-min denaturation step at 95°C and an annealing step in which the reaction mixture was slowly cooled to room temperature. A 20-μl solution with a 200-pmol adapter was phosphorylated with T4 polynucleotide kinase (3′ phosphatase minus) (New England BioLabs) in T4 DNA ligase buffer (New England BioLabs) for 5 min at 37°C and heat inactivated for 10 min at 70°C. Ligation of 100 ng of dephosphorylated MmeI restriction fragments with 2 pmol of phosphorylated adapter was performed in the presence of T4 DNA ligase buffer with 2 U of T4 DNA ligase (New England BioLabs) in a total volume of 20 μl for 1 h at 16°C. Immediately after the ligation, Tn-seq DNA probes were generated by PCR with 2.5 μl of the ligation reaction mixture as the template, 20 pmol of PBGSF23 and PBGSF31 primers, high-fidelity (HF) buffer, 0.2 mM deoxynucleoside triphosphate (dNTP) mix, and 1 U of Phusion DNA polymerase in a total volume of 50 μl. PCR cycling conditions were as follows: 72°C for 1 min and 98°C for 30s, followed by 25 cycles of 98°C for 30s, 57°C for 30s, and 72°C for 10 s, with a final step at 72°C for 5 min. The resulting PCR product of ∼130 bp was purified from the PCR with a Minelute Reaction Cleanup Kit (Qiagen). After samples with up to four different 6-bp barcodes were pooled, typically 9 fmol of Tn-seq DNA probe was loaded on a Genome Analyzer II (Illumina) for sequence analysis according to the manufacturer's protocols, using a Genomic DNA Sequencing Primer (Illumina) and 36 sequencing cycles.

Data analysis.

For Tn-seq data analysis, FASTQ files with 35-bp sequences were imported in the web-based interface Essentials (22). Of note, the first nucleotide of the Genome Analyzer II (Illumina) 36-bp sequence reads often had a poor quality and was omitted. As a result, only the last 5 bp of the 6-bp barcode sequence were available for data analysis. To identify these barcodes, a mismatch of 2 bp was allowed. After removal of the barcode and transposon sequences, the length of the remaining transposon-flanking genomic sequence was set at ≤17 bp. Alignment of this sequence with the forward strand of the H. influenzae 86-028NP reference genome should give a match of at least 16 bp. Count data (i.e., pseudoreads) were generated per unique sequence read and per gene, and locally weighted scatter plot smoothing (LOWESS) was used to correct for the bias in Tn-seq data caused by the increase in available DNA close to the origin of replication (ORI). Normalization factors were calculated using the trimmed mean of M values (TMM). Pseudoreads in the control and target samples were tested for significant differences (P ≤ 0.001) by the quantile-adjusted conditional maximum likelihood (qCML) method assuming moderated tag-wise dispersion of replicates. The prior.n value to determine the amount of smoothing of tag-wise dispersions was set at 10. A Benjamin-Hochberg (B-H) adjusted P value (adjusted P of ≤0.05) was used. Gene essentiality was determined by comparing the expected number of reads per gene (based on the number of insertion sites per gene, the mutant library size, and the sequencing depth) and the measured number of reads per gene. Significantly underrepresented genes were considered essential and omitted from the data analysis. Analysis data can be found at http://bamics2.cmbi.ru.nl/websoftware/essentials/links.html.

Generation of NTHi directed gene deletion mutants.

Bacterial genomic DNA was isolated by a cetyltrimethylammonium bromide (CTAB) extraction method (23). Directed NTHi gene deletion mutants were generated by allelic exchange of the target gene with an antibiotic resistance marker, as described previously for S. pneumoniae (17). Briefly, overlap extension PCR was performed, which inserted the spectinomycin resistance cassette of the pGSF8 plasmid between the two ∼1,000-bp flanking sequences surrounding the target gene. NTHi mutants were obtained by transformation with the resulting PCR fragment, selected by plating on 150 μg/ml of spectinomycin, and validated by PCR. Gene deletions were crossed back to the wild-type strain by using chromosomal DNA of the mutant strains as the donor during transformation. All primers (Biolegio, Nijmegen, Netherlands) used in this study are listed in Table 1.

Complementation of the NTHi directed gene mutant.

Overlap extension PCR was performed, which inserted the HI1301 gene from the Rd strain between two ∼1,000-bp flanking sequences surrounding the HI1801 pseudogene. NTHi complemented mutants were obtained by transformation with the resulting PCR fragment, selected by plating on 150 μg/ml of spectinomycin at environmental CO₂, and validated by PCR. All primers (Biolegio, Nijmegen, Netherlands) used in this study are listed in Table 1.

qRT-PCR.

RNA was extracted from mid-log-phase grown NTHi by using an RNeasy Mini Kit (QIAgen) and was DNase treated (Ambion). One microgram of cDNA was synthesized using a SuperScript III Reverse Transcriptase kit (Invitrogen). Quantitative reverse transcription-PCR (qRT-PCR) was performed in a 20-μl reaction volume with SYBR green PCR Master Mix (Applied Biosystems) on a 7500 Fast Real-Time PCR system (Applied Biosystems). The gyrA gene was used as the internal standard gene.

NTHi intracellular survival in THP-1 cells.

Undifferentiated THP-1 cells were cultured in HEPES-buffered RPMI medium supplemented with 8% (vol/vol) fetal calf serum (FCS). One million THP-1 cells in 800 μl of CO₂-enriched RPMI medium were mixed with 100 μl of bacteria (∼1.10⁹ cells/ml) and 100 μl of heat-inactivated pooled human AB serum (Sigma) and incubated for 2 h at 37°C and 5% CO₂ with or without the presence of 10 or 20 mM ammonium chloride. THP-1 cells were washed once, and CFU counts were determined (adhered bacteria). Subsequently, cells were incubated for 1 h in the presence of 10 μg/ml polymyxin B (Invitrogen) with or without 10 or 20 mM ammonium chloride and washed once, and CFU counts were determined (intracellular bacteria). Finally, the THP-1 cells were incubated for 16 h in the presence 1 μg/ml polymyxin B with or without 10 or 20 mM ammonium chloride and washed once, and CFU counts were determined (bacterial survival at 16 h).

NTHi growth at lowered pH.

Mid-log-phase cultures in 5% CO₂-enriched medium were diluted 100-fold in medium enriched overnight with 5% CO₂. Medium was supplemented with 0, 10, 20, or 50 mM sodium acetate buffer resulting in a pH of 7.0, 6.5, 5.6 and 5.2, respectively. Viable bacterial counts were determined at the start and after 16 h by plating serial dilutions in PBS on sBHI agar plates. Optical density was measured after 16 h of culture at 620 nm.

Statistical analysis.

For statistical analysis of the growth curves, two-way analysis of variance (ANOVA) and a Bonferroni post hoc test were used. For statistical analysis of the intracellular survival in THP-1 cells, a paired t test or one-way ANOVA with Tukey's post hoc test was used. All statistical analysis was performed in GraphPad Prism, version 5.03, for Windows (GraphPad Software, San Diego, CA), where a P value of <0.05 was considered significant.

RESULTS

Identification of NTHi 86-028NP genes essential for growth and survival in ambient air.

Tn-seq (10) was employed to identify NTHi genes essential for growth and survival in ambient air. An NTHi 86-028NP transposon library comprising ∼18,000 independent marinerT7-MmeI transposon mutants was constructed under 5% CO₂-enriched culture conditions. The mutant library was challenged by growth in CO₂-poor (0.04%) ambient air, while using growth in 5% CO₂-enriched ambient air as a control. Tn-seq analysis of the chromosomal DNA isolated from the control libraries revealed 11,655 unique transposon mutants with at least 16 reads, which covered almost 1,450 out of 1,944 genes in the genome. Rarefaction analysis suggested that the mutant library was approaching saturation for all nonessential genes.

Transposon mutants in three genes, NTHI1614 (putative carbonic anhydrase), NTHI0712 (elongation factor Tu), and NTHI2030 (hypothetical protein), showed a decreased pseudoread count under the CO₂-poor challenge conditions compared to the CO₂-rich control condition (Table 2). However, only the transposon mutations in the NTHI1614 gene represented a significant difference with a Benjamini-Hochberg adjusted P value; therefore, further research was focused on the role of the NTHi carbonic anhydrase for survival in ambient air (Table 2).

Table 2.

NTHi genes that contribute to growth in ambient air^a

No. of pseudoreads		− CO2 vs + CO2 condition			86-028NP annotation
− CO2	+ CO2	Fold change	P value	Adjusted P value	Gene symbol	Locus tag	Description
282	1,020	−3.61	1.62E−06	0.001		NTHI1614	Putative carbonic anhydrase
4	16	−3.30	6.73E−04	0.242	tuf	NTHI0712	Elongation factor Tu
77	203	−2.60	2.04E−04	0.300		NTHI2030	Hypothetical protein

^aThe respective gene deletion mutants were attenuated at least 2-fold (P < 0.01) for growth under low (ambient)-CO₂ conditions.

HICA is essential for NTHi growth and survival in ambient air.

H. influenzae carbonic anhydrase (HICA) is present in all sequenced encapsulated and nontypeable H. influenzae strains, and its amino acid sequence is absolutely conserved (Fig. 1; see also Fig. S1 in the supplemental material). HICA is also very homologous to carbonic anhydrases in Haemophilus haemolyticus, Haemophilus parainfluenzae, and Aggregatibacter actinomycetemcomitans and to a lesser extent to those of E. coli, Ralstonia eutropha, Saccharomyces cerevisiae, Cryptococcus neoformans, Corynebacterium glutamicum, and S. pneumoniae (Fig. 1).

Fig 1.

Phylogenetic tree of H. influenzae, H. haemolyticus, H. parainfluenzae, A. actinomycetemcomitans, E. coli, R. eutropha, S. cerevisiae, C. neoformans, C. glutamicum, and S. pneumoniae carbonic anhydrase proteins, constructed using MegAlign (Lasergene/DNAStar), version 7.1.0.

To determine the importance of HICA for NTHi growth under CO₂-poor and CO₂-rich conditions, an NTHi 86-028NP Δcan strain was generated by allelic replacement of the entire target gene with a spectinomycin resistance cassette. Quantitative mRNA expression analysis showed successful deletion of the NTHI1614 gene in the 86-028NP Δcan strain, whereas expression of the flanking NTHI1612, NTHI1613, NTHI1615, and NTHI1616 genes was not affected (see Fig. S2A in the supplemental material). Growth rates of the NTHi 86-028NP wild-type and Δcan strain were comparable under CO₂-rich conditions, but growth of the Δcan strain was severely attenuated under CO₂-poor conditions (Fig. 2A). Importantly, disruption of the can gene in the H. influenzae Rd, R2866, and 3655 strains also caused impaired growth under CO₂-poor conditions (Fig. 2B to D), which points toward a conserved essential function for HICA in NTHi growth in ambient air. Ectopic expression of the HI1301 gene into the HI1018 pseudogene completely reverted mRNA expression of the HI1301 gene (see Fig. S2B in the supplemental material) and the growth defect of the Δcan strain under CO₂-poor conditions (Fig. 2E).

Fig 2.

Static growth of 86-028NP (n = 3) (A), Rd (n = 4) (B), R2866 (n = 4) (C), and 3655 (n = 4) (D) and their corresponding Δcan mutants in CO₂-poor (0.04% CO₂) and CO₂-rich (5% CO₂) sBHI medium. (E) Growth of the Rd, Rd Δcan, and Rd Δcan complemented mutant (n = 4). **, P < 0.01; ***, P < 0.001.

Carbonic anhydrases are enzymes that catalyze the reversible hydration of CO₂ to bicarbonate (CO₂ + H₂O ↔ HCO₃⁻ + H⁺) and are therefore often linked to HCO₃⁻-dependent biosynthesis pathways for nucleic acids, several amino acids, and fatty acids (24, 25). To link the growth defect of the NTHi Δcan strain with one or more of these biosynthetic pathways, we complemented NTHi Δcan cultures with various metabolic intermediates. In contrast to our previous findings for S. pneumoniae carbonic anhydrase mutants (25), addition of different sources of saturated and unsaturated fatty acids (i.e., Tween 20, Tween 40, or Tween 80, oleic acid, or palmitic acid) did not complement the growth deficiency of the Rd Δcan strain under CO₂-poor conditions (Fig. 3A and B). Also, addition of the nucleic acid uracil or adenine (Fig. 3C), the amino acids aspartic acid and arginine (Fig. 3D), or oxaloacetic acid (Fig. 3D), which increases the citric acid cycle rate thereby increasing the production of CO₂ and HCO₃⁻, did not complement the growth defect of the Rd Δcan strain in ambient air. Of note, supplementation of the medium did not affect growth of the Rd wild-type in ambient air (data not shown). Only complementation with sodium bicarbonate restored growth of the Rd Δcan strain, which at least showed that growth of the Δcan strain was HCO₃⁻ dependent (Fig. 3E).

Fig 3.

Growth of the Rd wild-type and of the Δcan mutant in sBHI medium with ambient air supplemented with the following: 0.1% Tween 20, 0.1% Tween 40, or 0.1% Tween 80 (n = 3) (A);0.1% Tween 80, 1 mM palmitoleic acid in 0.1% Tween 80 (palmitoleic acid) or 1 mM oleic acid in 0.1% Tween 80 (oleic acid) (n = 3) (B); 100 mM uracil or 100 mM adenine (n = 2) (C); 100 mM arginine (n = 5), 100 mM aspartic acid (n = 5), or 100 mM oxaloacetic acid (n = 4) (D), or 10 mM sodium bicarbonate (n = 3) (E).

In order to accurately determine the amount of CO₂ needed for the NTHi Δcan strains to grow, we incubated sBHI plates containing the NTHi wild-type and Δcan strains with CO₂-depleted air (0%), ambient air (0.04%), and ambient air enriched with 0.2%, 1.0%, 2.0%, 3.0%, and 5.0% CO₂. Growth of the wild-type bacteria was impaired under CO₂-depleted conditions, showing that CO₂ is intrinsically essential for NTHi growth. However, growth of the wild-type NTHi strains was already restored in the presence of 0.04% CO₂ (Fig. 4A). In contrast, growth of the Δcan strains was only restored in the presence of 2 to 3% CO₂, which shows that HICA is of pivotal importance for NTHi growth when CO₂ levels are suboptimal (Fig. 4A). No growth was observed when plates were first grown at 0.04% and subsequently at 5% CO₂, which shows that high levels of CO₂ are needed for survival of the Δcan strains (data not shown). A high level of CO₂ was also needed for survival of a 86-028NP Δcan strain in liquid culture. Inoculation of CO₂-poor sBHI medium resulted in immediate growth impairment (1-h time point), and viable bacterial counts decreased significantly after 2 h and decreased further with time (Fig. 4B). Taking these results together, NTHi HICA is essential for growth and survival in ambient air.

Fig 4.

(A) Growth of the NTHi Rd, 3655, and 86-028NP wild-type (WT) strains and their corresponding Δcan strains on sBHI plates with 0%, 0.04% (ambient), 0.2%, 1.0% 2.0%, 3.0%, and 5.0% CO₂. (B) Viable bacterial counts for NTHi 86-028NP wild-type and Δcan strains in ambient air (n = 4). *, P < 0.05; ***, P < 0.001.

HICA is important for NTHi intracellular survival in THP-1 cells.

Bacterial virulence and CO₂ are linked in various bacterial species although the mechanisms are often unclear. Previously, we showed decreased intracellular survival of S. pneumoniae in the mouse monocyte cell line J774 (25). Therefore, we assessed the ability of the NTHi 86-028NP wild-type and Δcan strains to adhere, invade, and survive in the human monocyte cell line THP-1. Adhesion (Fig. 5A) and invasion (Fig. 5B) of THP-1 cells was not significantly different between the wild-type and Δcan strains. Interestingly, the amount of intracellular Δcan bacteria after 16 h was lower (Fig. 5C), which resulted in a significant decrease in survival compared to the NTHi 86-028NP wild-type strain (Fig. 5D).

Fig 5.

Counts of adhered bacteria (A), intracellular bacteria (B), and intracellular bacteria after 16 h (C) and relative intracellular survival (D) of the NTHi 86-028NP and Δcan strains in THP-1 cells (n = 6) are shown. Counts of intracellular bacteria after 16 h (E) and relative intracellular survival (F) are shown for the NTHi 86-028NP and Δcan strains in THP-1 cells with and without 10 or 20 mM lysosome-phagosome fusion inhibitor NH₄Cl (n = 4). Growth and survival of NTHi 86-028NP and Δcan strains in CO₂-enriched sBHI medium at pH 7.0 (control), 6.5, 5.6, and 5.2 was determined. Optical density at 620 nm after 16 h (G) and CFU counts after 16 h (n = 6) are shown. (I) The relative survival of NTHi 86-028NP and Δcan strains after 16 h at pH 6.5 versus pH 7.0 was determined (n = 3). *, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, nonsignificant.

Killing of phagocytosed bacteria is in part dependent on acidification of the lysosomes by lysosome-phagosome fusion. In order to determine whether the 86-028NP Δcan strain is more susceptible to this process, we performed intracellular survival experiments in the presence of NH₄Cl, a known inhibitor for lysosome-phagosome fusion (26). The presence of NH₄Cl increased intracellular CFU counts for both NTHi 86-028NP wild-type and Δcan strains (Fig. 5E) and abrogated decreased intracellular survival of the Δcan strain (Fig. 5F).

To determine whether acidification plays a role in decreased survival of the NTHi 86-028NP Δcan strain, we incubated both the NTHi 86-028NP wild-type and Δcan strains in 5% CO₂-enriched sBHI medium supplemented with 0, 10, 20, or 50 mM sodium acetate to lower the pH to 7.0, 6.5, 5.6, or 5.2, respectively. Both NTHi 86-028NP wild-type and Δcan strains were killed in sBHI medium with a pH of 5.6 and 5.2, as shown by a low OD₆₂₀ and decreased CFU counts compared to growth in normal sBHI medium at pH 7.0 (Fig. 5G and H). Growth of the NTHi 86-028NP wild-type and Δcan strains was also not changed at pH 6.5 compared to growth at pH 7.0 based upon OD₆₂₀ data (Fig. 5G). However, CFU counts showed decreased survival for the NTHi 86-028NP Δcan strain compared to growth in normal medium at pH 7.0, whereas this was not the case for the NTHi 86-028NP wild-type strain (Fig. 5I). Hence, these results suggest a link between carbonic anhydrase expression and intracellular survival. Of note, all our invasion experiments were conducted in the presence of 5% CO₂.

HICA in NTHi is not a target for sulfonamide carbonic anhydrase inhibitors.

As HICA appears to have an essential role in NTHi viability in ambient air, it could be an interesting novel antimicrobial target. Most carbonic anhydrases can be targeted by the sulfonamides acetazolamide (AZA) and ethoxyzolamide (EZA) (27), and we attempted to render the NTHi wild-type strain CO₂ dependent by supplementing cultures with these carbonic anhydrase inhibitors. Plate or broth cultures with 100 μM, 300 μM, or 1 mM AZA did not affect growth of NTHi in a CO₂-dependent manner, suggesting that this inhibitor was not able to inhibit HICA enzymatic activity in intact bacteria (Fig. 6A and B). Addition of 1 mM EZA inhibitor did result in decreased growth of the wild-type bacteria (Fig. 6C and D). However, this effect was not CO₂ dependent, and therefore it is likely that the antimicrobial activity of EZA toward NTHi is unrelated to HICA.

Fig 6.

Growth of 86-028NP, Rd, and 3655 wild-type (WT) strains and their corresponding Δcan mutants on sBHI plates with acetazolamide (AZA) at 5% CO₂ (A) or ambient CO₂ (B) and with ethoxyzolamide (EZA) at 5% CO₂ (C) or ambient CO₂ (D). The graphs in each panel depict the growth curves of the Rd strain in BHI medium with or without the carbonic anhydrase inhibitors (n = 2).

DISCUSSION

Carbonic anhydrases (carbonate hydrolyase, EC 4.2.1.1) are metalloenzymes that catalyze the interconversion of CO₂ and bicarbonate: CO₂ + H₂O ↔ HCO₃⁻ + H⁺. To date, there are five known forms of the enzyme: the α form, found in animals and a few eubacteria (28); the β form, found in bacteria, yeast, and plant chloroplasts (29); a γ form, found in an archaebacterium (30); and the δ (31) and ζ forms (32), which have been identified in a marine diatom. Only recently, carbonic anhydrases have been emerging as a putative novel class of antimicrobial drug targets (33). The data described in this report shows that NTHi HICA has an essential role in bacterial growth and survival in ambient air. Furthermore, HICA appears to be important for NTHi intracellular survival inside host immune cells.

The biochemical properties of HICA have extensively been studied (34–37). HICA is a zinc-dependent enzyme that is activated by a high pH (pH of >8) and whose activity can be controlled by bicarbonate levels. Despite this knowledge, the biological role of HICA has not been studied so far. Our experiments clearly reveal an essential role for HICA in NTHi growth and survival under CO₂-poor conditions, which is in line with the function of carbonic anhydrase in environmental survival of various other microorganisms (24, 25, 38–43). Carbonic anhydrases equilibrate intracellular levels of CO₂ and HCO₃⁻, and in a CO₂-poor environment this activity prevents the passive diffusion of endogenous CO₂ from cells to meet metabolic needs. Bicarbonate or CO₂ is consumed in the biosynthesis of fatty acids, arginine, aspartic acid, or the nucleic acids uracil and adenine. Consequently, the growth defect of S. pneumoniae and C. neoformans carbonic anhydrase mutants under CO₂-poor conditions could be restored by fatty acid supplementation (25, 43), whereas complementation of a yeast carbonic anhydrase mutation required a combination of the various metabolic end products (24). Unfortunately, supplementation of the growth medium with these metabolic end products did not complement the growth defect of the NTHi Δcan strain. These findings suggest that the growth defect of the NTHi carbonic anhydrase mutant is not simply due to the shortage of a single metabolite that could be supplemented in the growth medium. Although various papers describe an essential role for carbonic anhydrases for growth of the bacterial species Corynebacterium glutamicum (42), E. coli (38–40), and Ralstonia eutropha (41) in ambient air, the molecular mechanisms are often not elucidated, very likely due to the essential role for CO₂ or HCO₃⁻ in multiple metabolic processes.

Furthermore, we addressed whether deletion of the carbonic anhydrase gene from NTHi would affect adhesion and intracellular survival because decreased survival was also found for S. pneumoniae (25). We observed a 30 to 60% reduction in intracellular survival for the NTHi 86-028NP Δcan mutant in the monocytic cell line THP-1. Although NTHi is not a typical intracellular pathogen, various studies report that NTHi is able to invade adenoid tissue (44), mouse J774 macrophages (45), and the human monocyte cell lines U937 and THP-1 (46). We show that lysosome-phagosome fusion, which results in acidification of the phagosome, plays a role in increased killing of the NTHi 86-028NP Δcan mutant in THP-1 cells. Therefore, it is tempting to speculate that the NTHi 86-028NP Δcan mutant is slightly more sensitive to pH changes, which was also observed for growth in acidified sBHI growth medium. It is also possible that the intracellular CO₂/HCO₃⁻ levels in the THP-1 cells are suboptimal due to intracellular pH changes, which disables growth of the carbonic anhydrase mutant. Taken together, these results suggest a link between carbonic anhydrase expression and sensitivity to pH changes.

As bacterial carbonic anhydrases predominantly are members of the β class, which are not present in vertebrates, these enzymes are considered possible drug targets (33). The AZA and EZA sulfonamides are carbonic anhydrase inhibitors that showed effective inhibition of various purified carbonic anhydrases (25, 34, 47). In vivo, however, results for targeting carbonic anhydrases were mixed (48–50). Possibly, carbonic anhydrase inhibitors have difficulties in penetrating the bacterial cell envelope, which calls for the development of improved cell-permeable carbonic anhydrase inhibitors.

It was surprising that only transposon mutants in the NTHI1614 gene showed a significant decrease in the number of normalized read counts in our Tn-seq screen (Table 2). The 86-028NP mutant library used in this Tn-seq screen approached saturation and was comparable to other mutant libraries used on other Tn-seq studies (data not shown); therefore, it is not likely that we have missed a large number of genes. The fact that NTHI1614 was the sole gene found to be essential for growth in ambient air could be explained because HICA catalyzes the reversible hydration of CO₂ into H₂CO₃ in the cytosol, which increases the bioavailability of HCO₃⁻ and CO₂ in the cell when cultures are grown in ambient air. Other proteins that require either HCO₃⁻ or CO₂ will thereby not be identified due to the bioavailability of these molecules.

Close examination of the NTHI1614 mutants in the mutant library showed only a single transposon mutant in the 3′ end of the gene. This can be explained by the fact that transposon mutant in the 5′ end of the gene already causes a growth defect in CO₂-enriched sBHI medium, as we observed with the NTHI1614 directed deletion mutant (Fig. 2A). This small growth defect could have resulted in loss of NTHI1614 5′-end transposon mutants from the library under the control condition. It is likely that the 3′-end transposon insertion did not completely abrogate HICA activity, which enabled its identification in CO₂-enriched sBHI medium but not in ambient air. Another possibility is that the CO₂ concentration did not constantly reach levels above 2% during construction of the mutant library or under the control condition during the challenge. This potentially results in loss of the NTHI1614 transposon mutants under the control condition, but possibly also transposon mutants in other genes essential for survival in environmental air may have been missed.

In addition to HICA, we identified a decrease in transposon mutants for elongation factor Tu (NTHI0712) and a hypothetical protein (NTHI2030) when cells were grown under low-CO₂ conditions (Table 2). The roles for elongation factor Tu and NTHI2030 in survival in a low-CO₂ environment were not further investigated since these genes did not pass significance according to the Benjamini-Hochberg adjusted P value (Table 2).

In summary, the NTHi carbonic anhydrase is essential for growth in ambient air and most likely also for bacterial virulence, as determined by intracellular survival in THP-1 cells. These results indicate that inhibition of bacterial carbonic anhydrases could limit NTHi survival as well as virulence potential at low CO₂ levels.