FrnE, a Cadmium-Inducible Protein in Deinococcus radiodurans, Is Characterized as a Disulfide Isomerase Chaperone In Vitro and for Its Role in Oxidative Stress Tolerance In Vivo

Abstract

Deinococcus radiodurans R1 exposed to a lethal dose of cadmium shows differential expression of a large number of genes, including frnE (drfrnE) and some of those involved in DNA repair and oxidative stress tolerance. The drfrnE::nptII mutant of D. radiodurans showed growth similar to that of the wild type, but its tolerance to 10 mM cadmium and 10 mM diamide decreased by ∼15- and ∼3-fold, respectively. These cells also showed nearly 6 times less resistance to gamma radiation at 12 kGy and ∼2-fold-higher sensitivity to 40 mM hydrogen peroxide than the wild type. In trans expression of drFrnE increased cytotoxicity of dithiothreitol (DTT) in the dsbA mutant of Escherichia coli. Recombinant drFrnE showed disulfide isomerase activity and could maintain insulin in its reduced form in the presence of DTT. While an equimolar ratio of wild-type protein could protect malate dehydrogenase completely from thermal denaturation at 42°C, the C22S mutant of drFrnE provided reduced protection to malate dehydrogenase from thermal inactivation. These results suggested that drFrnE is a protein disulfide isomerase in vitro and has a role in oxidative stress tolerance of D. radiodurans possibly by protecting the damaged cellular proteins from inactivation.

INTRODUCTION

Proteins belonging to the thioredoxin family are involved in disulfide bond formation (Dsb) in many organisms. In eukaryotes, the protein disulfide isomerases (PDI) are located in the endoplasmic reticulum and catalyze the isomerization and disulfide bond formation during the protein folding process (1–4). In prokaryotes, the Dsb proteins are located in the periplasm, and six members of this class have been identified, which are named DsbA to DsbE and DsbG redox proteins (5–7). Roles of Dsb redox proteins have been demonstrated in the virulence of many pathogenic bacteria (8–11). These proteins have a redox-active dithiol Cys-X-X-Cys motif in the active site (12). DsbA and DsbB are involved in disulfide bond formation, while DsbC and DsbD are involved in the disulfide bond isomerization function. The disulfide bond plays an important role in proper folding, stability, and secretion of such proteins (13, 14), and therefore mutations in dsb genes lead to incorrect folding of cellular proteins involved in various processes, including oxidative stress tolerance (15–17). Complements of Dsb proteins in Gram-positive bacteria are different from those of Escherichia coli. It has been found that eukaryotic proteins with nonconsecutive disulfide bonds, when expressed in E. coli, require DsbC for their proper folding (18). During severe oxidative stress, these systems get inactivated or overburdened, and thus the cytosolic cysteine residues become susceptible to oxidation. Most organisms encode machineries that protect proteins from oxidative damage, and thioredoxin superfamily proteins play important roles in this process. Therefore, the characterization of the Dsb system and its role in oxidative stress tolerance in bacteria belonging to the Deinococcaceae family would be worth undertaking.

Deinococcus radiodurans R1, a member of the Deinococcaceae family, is characterized for its extraordinary resistance to DNA damaging agents, including gamma radiation, UV rays, desiccation, and genotoxic chemicals like H₂O₂ and mitomycin C (MMC) (19). It can tolerate extensive DNA damage and oxidative stress without a measurable loss of cell viability (20). The antioxidant enzymes like catalase and superoxide dismutase (21), thioredoxins (22), pyrroloquinoline quinone (23–25), deinoxanthin (26), and Mn complexes of small molecules (19) are attributed to extraordinary oxidative stress tolerance in D. radiodurans. Its genome also encodes putative Dsb homologs (8), which have not been characterized in greater detail. Recently, it has been observed that D. radiodurans exposed to lethal doses of cadmium (Cd) upregulates the transcription of DR_0659 by nearly 7-fold (27). DR_0659 encodes a putative FrnE-type protein in this bacterium. Upregulation of FrnE has also been reported in a Gram-negative bacterium, Ralstonia eutropha H16 cells exposed to Cd and during its cultivation on organic sulfur compounds (28). Here, we characterize the DR_0659 protein (here referred to as drFrnE) as a disulfide isomerase and demonstrated its roles in bacterial resistance to Cd and other oxidative stress-producing agents in vivo and in protection of malate dehydrogenase from thermal inactivation in vitro.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Bacterial strains used in this study are described in Table 1. E. coli cells were grown in LB medium supplemented with ampicillin (100 μg/ml) as required. Dsb mutants of E. coli and its derivatives containing pMER78 were obtained from M. Berkmen (29). D. radiodurans R1 ATCC 13939 was obtained from John R. Battista and maintained in TGY medium (0.5% Bacto tryptone, 0.1% glucose, 0.3% Bacto yeast extract) as described earlier (30). Deinococcus mutants were grown in the presence of kanamycin (8 μg/ml) as required. All molecular biology-grade chemicals were purchased from Sigma Chemicals Co., New England BioLabs, Fermentas Inc., and TaKaRa Bio Inc. Other recombinant techniques used were as described by Sambrook and Russell (31).

Table 1.

List of bacterial strains used in this study

Strain	Description	Source or reference
Deinococcus radiodurans R1	Wild type (ATCC 13939)	20
D. radiodurans FrnE	ATCC 13939 DR_0659::nptII (frnE::nptII)	This study
Escherichia coli DH5α	λ− φ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK− mK−) supE44 thi-1 gyrA relA1	Lab collection
E. coli BL21(DE3) pLysS	F− ompT hsdSB(rB− mB−) gal dcm (DE3), a λ prophage carrying the T7 RNA polymerase gene, pLysS	Lab collection
E. coli DHB4	araD139 (ara-leu)7697 (codB-lac)X74, galE15 galK16 rpsL150 relA1 thi phoA (PvuII) phoR malF3 Flac(lacI) pro Strr	29
E. coli MB68	DHB4 ΔdsbA strain	29
E. coli MB69	DHB4 ΔdsbC strain	29
E. coli MB834	DHB4 ΔdsbCD strain	29
E. coli NK1	E. coli MB68 harboring pMER78	This study
E. coli NK2	E. coli MB68, ΔdsbA mutant harboring pMERfrnE	This study
E. coli NK3	E. coli MB69 harboring pMER78	This study
E. coli NK4	E. coli MB69 harboring pMERfrnE	This study
E. coli NK5	E. coli MB834 harboring pMER78	This study
E. coli NK6	E. coli MB834 harboring pMERfrnE	This study

Isolation of the drfrnE::nptII mutant of D. radiodurans and site-directed mutagenesis.

The drfrnE::nptII disruption mutant was generated using protocols as described earlier (27). In brief, the 1.211 kb upstream and 1.205 kb downstream of DR_0659 were PCR amplified from the D. radiodurans genome using sequence-specific forward primer FUpΔfrnE (5′CGTCCACCTGACGTTTCCTAA3′) and reverse primer RUpΔfrnE (5′TAGGCATGACAAACCTTGCACCCCGGGCTAACAACTGAGGGGAGAGAA3′) for the upstream fragment and FDnΔfrnE (5′TTCTCTCCCCTCAGTTGTTAGCCCGGGGTGCAAGGTTTGTCATGCCTA3′) and RDnΔfrnE (5′CTGGTAGTCCTTGATGTAACG3′) for the downstream fragment. The SmaI sites were introduced into the primer, which eventually got incorporated into DNA fragments during PCR amplification. Both the PCR fragments were annealed through overlapping regions and PCR amplified as a single fragment using FUpΔfrnE and RDnΔfrnE primers. PCR product was purified (Qiagen, Valencia, CA) and cloned into a pGEM-T easy vector (Promega, Madison, WI). The resulting plasmid was digested with SmaI and ligated with an nptII cassette (975 bp) obtained from the pKatAPH3 plasmid (32). The whole ligated product (3,391 bp) was PCR amplified using FUpΔfrnE and RDnΔfrnE primers and transformed into D. radiodurans. The kanamycin-resistant transformants were grown for several generations in TGY supplemented with kanamycin (8 μg/ml). Complete replacement of wild-type DR_0659 with disrupted drfrnE::nptII was confirmed by PCR amplification using specific primers, ConF (5′TAGCTTTCGCCAGAGCAG3′) and ConR (5′CTCGAAGC CTCTGCTTTG3′), located outside the coding sequences of DR_0659 on the chromosome and the internal primers of the nptII coding sequences. Cells lacking the wild-type allele of DR_0659 were named the drfrnE::nptII disruption mutant and used in subsequent studies. Site-directed mutagenesis of drFrnE was carried out commercially (Bioneer Inc.), and the cysteine at position 22 of the active-site motif CXXC was mutagenized with serine to SXXC, which yielded the C22S mutant.

Cloning and expression of drFrnE in Dsb mutants of E. coli.

The coding sequence of drfrnE was PCR amplified using the gene-specific forward primer (FpETfrnE; 5′ACGCATATGACAAACCTTGCACCCG3′) and the reverse primer (RpETfrnE; 5′ATTCTCGAGGTTGTTAGGGCGCTGGGGCA3′). The PCR product was cloned at NdeI-XhoI sites in pET21b⁺, yielding pETFrnE. Similarly, coding sequences of drfrnE were PCR amplified using forward (FpMERfrnE; 5′ACTCCATGGATGACAAACCTTGCACCCG3′) and reverse (RpMERfrnE; 5′ATTTCTAGAGTTGTTAGGGCGCTGGGGCA3′) primers. The PCR product was cloned at NcoI-XbaI sites in pMER78 (29), having the DsbA signal sequence and the FLAG tag at the C terminus, to yield pM78FrnE and transformed in DH5α. Subsequently, pM78FrnE was transformed into different Dsb mutant strains of E. coli and confirmed by restriction digestion of plasmids isolated from transformants. Sequencing of drfrnE directly from recombinant plasmids checked the correctness of gene cloning in these plasmids. IPTG (isopropyl-β-d-thiogalactopyranoside)-inducible expression of drFrnE was confirmed by immunoblotting using antibodies against FLAG in all recombinant clones harboring pM78FrnE.

Microbiological studies.

D. radiodurans R1 and its drfrnE::nptII mutant were grown overnight in TGY medium supplemented with kanamycin as required. Overnight-grown cultures were subcultured to a 1:100 dilution in fresh TGY, and the optical density at 600 nm (OD₆₀₀) was monitored continuously online on a plate reader-based spectrophotometer (Biotek XS2; model MQX200R2). For cell survival studies, these cells were grown to an OD₆₀₀ of 0.6 at 30°C and treated with different doses of Cd (0 to 20 mM) and diamide (0 to 20 mM) for 6 h with aeration. Protocols used for gamma radiation (0 to 12 kGy) and 30 min of exposure to hydrogen peroxide (0 to 40 mM) were as described earlier (25). Treated cells were plated in triplicate, and CFU were scored after 48 h of incubation at 30°C. For complementation studies, the dsb mutants expressing drFrnE on pM78FrnE were checked for rescue of dsb mutant defects in motility and dithiothreitol (DTT) sensitivity and compared with untransformed dsb mutant and wild-type cells as controls.

Purification of recombinant protein.

Transgenic E. coli BL21(DE3) pLysS cells expressing recombinant drFrnE and FrnEC22S on pETFrnE and pETfrnEC22S under the IPTG-inducible promoter were used for protein purification by nickel-affinity chromatography using the manufacturer's protocols (Qiagen Inc.). In brief, the clear supernatant was mixed with 500 μl 50% Ni-nitrilotriacetic acid (NTA), and hexahistidine-tagged recombinant protein bound to the Ni-NTA matrix was eluted with elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 250 mM imidazole, pH 8.0). The fractions were analyzed on SDS-PAGE, pure fractions were dialyzed, and protein concentration was determined using Bradford's dye-binding method.

Enzyme activity assays.

The PDI activity of drFrnE was assayed by monitoring the refolding of scrambled RNase A as described in reference 33. In brief, 40 μM scrambled RNase A (Sigma Chemical Co.) was incubated with 10 μM drFrnE protein in 100 mM Na⁺ phosphate buffer (pH 7.0) and 1 mM EDTA, and the reaction was initiated with 10 μM DTT at 25°C in the presence of 4.5 mM cyclic 2′3′-CMP (cCMP). The conversion of cCMP into 3′-CMP was measured at 296 nm. Native RNase A was used as a positive control. The ability of drFrnE to catalyze insulin reduction in the presence of DTT was determined as previously described (34). In brief, 130 μM insulin was mixed with 10 μM purified protein in a reaction mixture containing 100 mM sodium phosphate (pH 7.0) and 2 mM EDTA, and reactions were started by adding 0.33 mM DTT. The rate of insulin precipitation was monitored as the increase in turbidity at 650 nm for 40 min against the protein blank. Chaperone (holdase) activity of wild-type drFrnE and the drFrnEC22S mutant was measured using malate dehydrogenase (MDH; porcine heart mitochondrial malate dehydrogenase) as the substrate, as described earlier (35). Briefly, the MDH substrate was incubated in 50 mM HEPES (pH 8.0) at 42°C, with increasing concentrations of drFrnE or drFrnEC22S as required. Thermal aggregation of MDH was determined by monitoring the turbidity increase at A₄₀₅ in a temperature-controlled spectrophotometer (Evolution 300; Thermo).

Functional complementation assay.

The dsb mutants of E. coli expressing drFrnE from D. radiodurans were checked for complementation of their motility and loss of DTT resistance. Motility assays were performed to check drFrnE complementation to dsbA, dsbC, and dsbCD mutations as described earlier (6). In brief, E. coli cells expressing drFrnE were grown to an OD₆₀₀ of 0.3 and induced with 500 μM IPTG for 4 h. The 2 μl of induced culture was spotted on LB soft agar plates (0.4% agar) and incubated overnight at 37°C. The morphology and motility of the colonies were observed and documented. For the DTT sensitivity assay, the different dilutions of IPTG-induced culture were plated on freshly (less than 30 min prior to experiment) prepared LB agar plates containing different concentrations of DTT. Plates were incubated overnight at 37°C, and the number of CFU was monitored.

RESULTS AND DISCUSSION

The frnE mutant did not show growth defect but was sensitive to Cd and oxidative stress.

D. radiodurans cells exposed to Cd showed induced transcription of the DR_0659 gene (27). BLASTP analysis of DR_0659 showed 51 to 98% amino acid identities with Dsb proteins and thioredoxins from deinococci and 42 to 51% identities with similar proteins from other bacteria. This protein has a CXXC active-site motif between amino acids 22 and 25, similar to that reported in thioredoxin superfamily proteins. drFrnE is annotated as a putative outer membrane-bound periplasmic protein having the DsbA domain and thus predicted to be a disulfide oxidoreductase. Dsbs in E. coli have been characterized with PDI activity and shown to play important roles in diamide stress resistance. drFrnE was therefore characterized for these activities in vitro and roles in bacterial response to Cd and thiol stresses in vivo.

A genomic copy of the drfrnE gene was disrupted with the neomycin phosphoryltransferase II (nptII) cassette expressed in D. radiodurans, and complete replacement was confirmed by PCR amplification (see Fig. S1 in the supplemental material). The drfrnE::nptII cells (here referred to as the frnE mutant) conferring kanamycin resistance was checked for growth under both normal and stress conditions. The frnE mutant grew almost like wild-type D. radiodurans under normal growth conditions (Fig. 1). However, these cells were sensitive to Cd and other oxidative stress-producing agents, like diamide, gamma rays, and hydrogen peroxide, albeit to different levels. Sensitivity to Cd was highest, ∼15-fold (Fig. 2A), while for diamide it was found to be ∼3-fold (Fig. 2B). Inactivation of FrnE resulted in a nearly 6-fold loss of wild-type resistance to gamma rays (Fig. 2C) and an ∼2-fold loss to hydrogen peroxide at 40 mM (Fig. 2D). Cadmium toxicity has been explained by its binding to the sulfhydryl group on protein, which causes inhibition of protein functions. Cadmium and other metals also induce oxidative stress, and the reactive oxygen species (ROS) generated can cause damage to the lipid, protein, and nucleic acids (36, 37). Similarly, diamide also exerts oxidative stress. It has been shown that both hydrogen peroxide and thiol oxidants induce thioredoxin expression in Saccharomyces cerevisiae (38). Global effects of diamide and hydrogen peroxide show the positive regulation of Yap1p (a transcription factor)-mediated gene expression in yeast. But a C-terminal deletion mutant of this protein showed a differential effect against diamide and hydrogen peroxide (39). These results suggested that drFrnE has a role in both Cd and oxidative stress tolerance of D. radiodurans.

Fig 1.

Effect of frnE inactivation on growth characteristics of Deinococcus radiodurans. Both wild-type (■) and frnE::nptII mutant (●) cells were grown overnight in TGY medium. Overnight-grown cultures were diluted 100 times with fresh medium, and the optical density at 600 nm was measured.

Fig 2.

Effect of frnE inactivation on stress tolerance characteristics of Deinococcus radiodurans. Both wild-type and frnE::nptII mutant cells were grown to an optical density at 600 nm of 0.6 at 30°C before different concentrations of cadmium (A) and diamide (B) were added, and cells were plated 6 h after treatments. Similarly, the exponentially growing cells were treated with different doses of gamma radiation (C) and hydrogen peroxide (D). Different dilutions of cells were plated, and the CFU were counted after 48 h of incubation at 30°C. Error bars shown at each data point indicate the standard deviations among the replicates.

drFrnE is characterized as a protein disulfide isomerase.

Multiple-sequence alignment of the drFrnE amino acids with its homologs in the protein database predicted its functional similarity with protein disulfide isomerase. The recombinant protein purified to homogeneity (Fig. 3) was checked for PDI activity using both insulin turbidity and scrambled RNase activity assays. The drFrnE could oxidize scrambled RNase into the active form, which resulted in an increase in absorption at 296 nm (Fig. 4A). Increase in OD₂₉₆ was not observed when scrambled RNase was incubated without drFrnE. Similarly, the insulin incubated with drFrnE showed turbidity increase in the presence of DTT, which was again not observed without the addition of drFrnE (Fig. 4B). Assays of both increase in insulin turbidity (40) and oxidative folding of scrambled RNase A (41) have been used for characterizing PDI. The presence of these activities in recombinant drFrnE therefore characterized this protein as a disulfide isomerase.

Fig 3.

Cloning and purification of deinococcal FrnE from transgenic Escherichia coli. The PCR-amplified frnE gene of D. radiodurans was cloned at NcoI and XbaI sites in pET21a⁺ to yield pETfrnE. (A) Recombinant plasmid (UC) was digested with both enzymes (Cut), and release of 750 bp was ascertained. (B) Transgenic E. coli harboring pET21a⁺ (lanes 1 and 2) and pETfrnE (lanes 4 and 5) was grown, total proteins from both uninduced (lanes 1 and 5) and IPTG-induced (lanes 2 and 4) cells were analyzed by SDS-PAGE, and the size of recombinant protein was determined using size marker SM0671 (MBI Fermentas) (M). Recombinant drFrnE was purified from transgenic E. coli to near homogeneity using nickel-affinity chromatography; histidine tag was cleaved with factor Xa and separated by a metal affinity column. (C) The entire protein was eluted in a flowthrough of 2 fractions, P1 and P2. Fraction P2 was used in subsequent experiments.

Fig 4.

In vitro activity characterization of recombinant drFrnE. (A) In brief, 40 μM scrambled RNase A was incubated with 10 μM purified recombinant drFrnE (+FrnE) for disulfide isomerase activity assay as described in Materials and Methods, and the change in optical density at 296 nm was measured against a protein blank without drFrnE (−FrnE). Similarly, 130 μM insulin was incubated with 10 μM drFrnE (+FrnE) and without drFrnE (−FrnE) in the presence of DTT as described in Materials and Methods. (B) Rate of insulin precipitation, an indication of its reduction, was monitored as an increase in turbidity at 650 nm against protein blank. Error bars shown for each data point are indicative of standard deviations among the replicates.

drFrnE complemented motility loss in the dsbC mutant and enhanced thiol cytotoxicity in E. coli.

There are two distinct pathways involved in disulfide bond stabilization in bacterial proteins. In E. coli, DsbA and DsbB enzymes are associated with de novo disulfide bond formation (42), and DsbC and DsbD enzymes help in isomerization of disulfide bonds (43–45). Since drFrnE showed disulfide isomerize activity in vitro and a role in diamide resistance in D. radiodurans, the possibility of this protein complementing the dsb mutant phenotype was hypothesized. drFrnE was expressed into dsbA, dsbC, and dsbCD mutants of E. coli on plasmid, and the cell motility and thiol response were evaluated. drFrnE could complement the cell motility loss of dsbC and dsbCD mutants but not of the dsbA mutant (Fig. 5). Although drFrnE expression enhanced thiol cytotoxicity in the dsbA mutant, it did not produce a noticeable effect in dsbC and dsbCD mutant backgrounds. The effects of 1 mM and 5 mM DTT in wild-type and dsbC and dsbCD mutant cells expressing drFrnE were nearly identical. E. coli dsbA mutants were reported to have a pleiotropic phenotype (nonmotility, DTT sensitivity, etc.) (6), which could account for the distinct effect of drFrnE in the dsbA mutant. DTT effect was not observed in mutant cells either harboring vector and/or not induced for drFrnE expression (Fig. 6), suggesting that this protein alleviates the cytotoxic effect of DTT on E. coli cell survival. Although the mechanisms underlying DTT toxicity by drFrnE are not clear, DTT taking part in the Fenton reaction and enhancing the production of reactive oxygen species has been known in mammalian systems (46). These results suggested that drFrnE overexpression enhances E. coli sensitivity to DTT irrespective of mutations in dsb genes, but this protein could complement dsbC and dsbCD loss of cell motility.

Fig 5.

Functional complementation of dsb mutation by drFrnE in Escherichia coli. Both wild-type (WT) and dsb mutant strains of E. coli were transformed with vector and drFrnE-expressing plasmid, and motility of transgenic E. coli cells was monitored on 0.4% LB agar. The dsbCD, dsbA, and dsbC mutants harboring vector (VC) and pMERrfrnE (FrnE) were spotted, and motility was examined after overnight incubation at 37°C and compared with similar phenotypes in the wild type.

Fig 6.

Effect of FrnE expression on the dsb mutant's response to the DTT effect. The dsbA and dsbC mutant (A, B) and dsbCD mutant and wild-type (WT) (C, D) cells of E. coli were transformed with expression vector (VC) and FrnE-expressing plasmid (FrnE). Different dilutions, 10⁻³ (−3), 10⁻⁴ (−4), 10⁻⁵ (−5), 10⁻⁶ (−6), and 10⁻⁷ (−7), were spotted on LB plates containing 5 mM DTT in the absence (A, C) and in the presence (B, D) of IPTG. Growth of these derivatives was monitored in cells expressing recombinant FrnE.

Purified drFrnE protected proteins from inactivation.

The drFrnE exhibits PDI function and reactivates scrambled RNase A, which could be explained through its correcting the wrong disulfide interaction to correct disulfide bond formation. Therefore, the possibility of drFrnE having chaperone-like activity was tested using malate dehydrogenase in vitro and by coexpression of this protein with DNA polymerase in vivo. Both protection of malate dehydrogenase (MDH) from heat denaturation and recovery of MDH activity were monitored with increasing concentrations of drFrnE at a fixed concentration of MDH. Results showed that wild-type drFrnE protected MDH from heat denaturation at 42°C in a concentration-dependent manner. The MDH incubated at 42°C without drFrnE became denatured completely and became inactive in less than 5 min of incubation. On the other hand, MDH incubated with an equimolar amount of wild-type drFrnE was protected completely from thermal denaturation at 42°C for up to 20 min of incubation (Fig. 7A). A similar trend was obtained when MDH activity was measured with MDH preincubated at 42°C in the absence and in the presence of an increasing molar ratio of wild-type drFrnE (data not shown). The drFrnE has a CXXC active-site motif between amino acids 22 and 25, which are conserved across the thioredoxin superfamily enzymes. In order to check the role of these active-site amino acids in chaperone function of drFrnE, the cysteine 22 was replaced with serine. The recombinant C22S mutant of drFrnE was purified to homogeneity and checked for holdase activity. Unlike wild-type drFrnE, the C22S mutant incubated with MDH in equimolar amounts could only partially protect it from thermal denaturation at 42°C. Earlier, it was shown that coexpression of molecular chaperones or foldase increases the solubility and activity of recombinant proteins in E. coli (47). Therefore, drFrnE was also coexpressed separately with PprA (48) and polymerase X (PolX) (49) of D. radiodurans, and the distributions of these proteins between soluble and inclusion fractions were monitored. It was assumed that if drFrnE helps recombinant proteins in correct folding, the amount of these proteins in soluble fraction should increase in E. coli cells coexpressing this protein. Here, we did not find any effect of drFrnE coexpression on their solubilization from inclusion bodies. However, the specific activity of PolX coexpressed with drFrnE increased by ∼3-fold compared to PolX expressed alone, while there was no effect on DNA binding activity of PprA (data not given). This indicated that the possible mechanisms underlying in vitro protection of MDH from inactivation and the enhancement of PolX activity in vivo seem to be different. It may be speculated that the protection from thermal denaturation could be through holdase activity of drFrnE, while PolX activation may be by reducing the free-SH group near the active site. Nevertheless, these results suggested that drFrnE could protect MDH from thermal denaturation and seems to have chaperone functions at least in vitro.

Fig 7.

Chaperone activity assay of recombinant drFrnE. The malate dehydrogenase (con) was incubated in HEPES buffer with increasing molar ratios of 1:0.125, 1:0.25, 1:0.5, and 1:1 of wild-type recombinant drFrnE (A) and C22S mutant derivatives of drFrnE (B) at 42°C. Thermal denaturation of malate dehydrogenase substrate was measured as an increase in optical density at 405 nm at different times of incubation.

This study reports the characterization of drFrnE, a protein that was induced in response to Cd stress in D. radiodurans, as a chaperone with PDI activity in vitro, with a role in Cd as well as oxidative stress tolerance in vivo. The Dsb mutant of E. coli expressing this protein showed increased sensitivity to DTT, and the D. radiodurans mutant lacking FrnE became sensitive to Cd and diamide, which collectively argued for this protein having a role in oxidative stress tolerance. Recently, it has been suggested that the protection of proteins from oxidative damage plays a major role in extraordinary radioresistance of D. radiodurans (19). Since we showed that drFrnE could correct the damaged proteins by stabilizing the disulfide interaction in vitro, the possibility of this protein contributing to the protection of other cellular proteins from oxidative damage could be speculated. Earlier, it has been shown that antioxidant enzymes (30) and antioxidant metabolites, such as redox cofactor pyrroloquinoline quinone made in E. coli (23) and in D. radiodurans (44), deinoxanthin (26), and the Mn cluster of small compounds in D. radiodurans (50), could protect these cells from oxidative stress. How this protein is protected from oxidative damage is not known. Since drFrnE has redox-active dithiol in the active site, i.e., CXXC, which is similar to thioredoxins, the possibility of this protein working with the cellular redox system for maintaining the reducing environment at its active site and thus protecting itself from oxidative damage may be discussed. Redox regulation by thioredoxin superfamily proteins and their protection from oxidative damage have been demonstrated (51). These results collectively showed that drFrnE from D. radiodurans has PDI activity, which could help in correcting the denatured/scrambled RNase A by reorienting the disulfide bonds and protected the proteins from thermal denaturation. The possibility of these properties of drFrnE contributing to Cd and oxidative stress tolerance in D. radiodurans by correcting the oxidized disulfide bonds in scrambled proteins could be suggested.