Skip to main content
PMC home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2013 Jul;57(7):3072–3077. doi: 10.1128/AAC.00203-13

Molecular Characterization of Acquired Enrofloxacin Resistance in Mycoplasma synoviae Field Isolates

I Lysnyansky a,✉, I Gerchman a, I Mikula a, F Gobbo b, S Catania b, S Levisohn a
PMCID: PMC3697329  PMID: 23612192

Abstract

The in vitro activity of enrofloxacin against 73 Mycoplasma synoviae field strains isolated in Israel and Europe was determined by broth microdilution. Decreased susceptibility to enrofloxacin was identified in 59% of strains, with the MICs ranging from 1 to >16 μg/ml. The estimated MIC50 and MIC90 values for enrofloxacin were 2 and 8 μg/ml, respectively. Moreover, this study showed that 92% of recent Israeli field isolates (2009 to 2011) of M. synoviae have MICs of ≥2 μg/ml to enrofloxacin. Comparison of the quinolone resistance-determining regions (QRDRs) in M. synoviae isolates revealed a clear correlation between the presence of one of the amino acid substitutions Asp79-Asn, Thr80-Ala/Ile, Ser81-Pro, and Asp84-Asn/Tyr/His of the ParC QRDR and decreased susceptibility to enrofloxacin (MIC, ≥1 μg/ml). Amino acid substitutions at positions GyrA 87, GyrB 401/402, and ParE 420/454 were also identified, but there was no clear-cut correlation with susceptibility to enrofloxacin. Comparison of vlhA molecular profiles revealed the presence of 9 different genotypes in the Israeli M. synoviae field isolates and 10 genotypes in the European isolates; only one vlhA genotype (type 4) was identified in both cohorts. Based on results of vlhA molecular typing, several mechanisms for emergence and dissemination of Israeli enrofloxacin-resistant M. synoviae isolates are suggested.

INTRODUCTION

Mycoplasma synoviae is an economically important pathogen of poultry, causing respiratory disease and infectious synovitis in chickens and turkeys (1). The severity of clinical manifestations of M. synoviae infection ranges from inapparent to severe and is markedly exacerbated by the presence of other bacterial or viral pathogens. In addition, eggshell apex abnormality (EAA) has been recently described as a novel presentation of M. synoviae infection (2, 3).

Antibiotic treatment at the beginning of a disease outbreak is sometimes employed to reduce economic losses caused by clinical outbreaks of M. synoviae. Enrofloxacin (En), a broad-spectrum antibiotic related to the class of fluoroquinolones, has been widely used in many countries for treatment of a variety of poultry diseases, mainly those associated with Escherichia coli and Pasteurella multocida but also avian mycoplasmosis (4). However, in some countries the use of En in poultry is not permitted, mainly due to human health concerns; in the United States, En has been banned for use in poultry since 2005.

Fluoroquinolones act by inhibition of DNA replication through the formation of a ternary complex with DNA and the active site of DNA replication enzymes (5). Fluoroquinolone resistance occurs primarily through mutations in the quinolone resistance-determining regions (QRDRs) of the parC and/or gyrA gene (encoding the A subunits of DNA gyrase and topoisomerase IV) or the gyrB and/or parE gene (encoding the B subunits of DNA gyrase and topoisomerase IV). Topoisomerase IV (parC gene) has been suggested to be the primary target of En in M. synoviae, based on in vivo selection of strains with decreased susceptibility after experimental infection (6).

The present study reports on in vitro susceptibility to En in 73 M. synoviae field isolates isolated in Israel and in Europe. Molecular characterization of QRDRs of gyrA, gyrB, parC, and parE in those isolates was performed in order to elucidate the mechanism of acquired resistance to En. In addition, molecular typing by vlhA (7) was performed to genotype the M. synoviae field isolate strains with different susceptibilities to En.

MATERIALS AND METHODS

M. synoviae strains and growth conditions.

A total of 73 M. synoviae strains were analyzed. Of these, 44 strains were isolated in Israel during the period 1995 to 2011 from 16 meat-type turkey flocks (MT), 18 turkey breeder flocks (TB), 6 broiler breeder flocks (BB), 2 broiler flocks (B), and 2 layer flocks (L). The additional 29 strains were isolated in Austria (2009 to 2011) from 5 MT and 7 BB flocks, in Italy (2009 to 2012) from 4 BB, 4 L, 1 MT, 1 TB, and 1 B flocks, in Spain (2012) from 2 L, 1 BB, and 1B flocks, and in Belgium (2011) from 2 L flocks (Table 1). These include 7 Israeli isolates for which susceptibility to fluoroquinolones was described previously (8). In addition, reference strains M. synoviae WVU1853 and FMT, isolated from chickens in the United States, were also included.

Table 1.

In vitro sensitivity to enrofloxacin, molecular characterization of QRDR domains, and vlhA typing of M. synoviae clinical isolates

Straina Origin Typeb Yr MIC (μg/ml) Mutationc in QRDR of:
 vlhA type
ParC
 ParE
 GyrA
 GyrB
79 80 81 84 420 454 87 401 402
WVU1853 USA C 1955 0.5 Asp Thr Ser Asp Asp Glu Asn Ser Ser 19
FMT USA C <1980 0.5 Asp Thr Ser Asp Asp Asp Asn Ser Ser 20
AMS-5 Austria MT 2009 0.03 Asp Thr Ser Asp Asp Asp Asn Ser Ser 1
AMS-8 Austria BB 2010 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 2
AMS-9 Austria BB 2010 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 3
AMS-10 Austria MT 2010 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 2
AMS-11 Austria MT 2011 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 2
AMS-12 Austria MT 2011 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 2
AMS-3 Austria BB 2009 0.06 Asp Thr Ser Asp NT NT Asn Ser Ser 2
AMS-4 Austria BB 2009 0.06 Asp Thr Ser Asp Asp Glu Asn Ser Ser 2
NJ-1998d Israel MT 1998 0.125 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
MES-2 Israel MT 1999 0.125 Asp Thr Ser Asp NT NT Asn Ser Ser 4
TF-4C Israel TB 2000 0.125 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
NJR-1D Israel TB 2008 0.125 Asp Thr Ser Asp Asp Glu Asn Tyr Ser 5
CK-7 Israel BB 2009 0.125 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
AMS-6 Austria MT 2009 0.125 Asp Thr Ser Asp NT NT Asn Ser Ser 2
TK-2d Israel MT 1997 0.25 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
EB-11B Israel TB 2000 0.25 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
IB-1D Israel TB 2001 0.25 Asp Thr Ser Asp Asp Asp Asn Tyr Ser 6
FB-8 Israel TB 2001 0.25 Asp Thr Ser Asp Asp Asp Asn Ser Ser 7
SMA-22 Israel TB 2002 0.25 Asp Thr Ser Asp Asp Glu Ser Ser Ser 7
KYZ-2 Israel TB 2003 0.25 Asp Thr Ser Asp Asp Glu Asn Ser Ser 5
RAM-6G Israel TB 2005 0.25 Asp Thr Ser Asp Asp Glu Asn Ser Ser 5
ODS-2A Israel MT 2007 0.25 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
AMS-2 Austria BB 2009 0.25 Asp Thr Ser Asp Asn Glu Asn Ser Ser 3
MSH-19 Israel L 1995 0.25 Asp Thr Ser Asp Asp Asp Asn Tyr Ser 8
IZSVE/4564 Italy B 2010 0.25 Asp Thr Ser Asp Asp Asp Asn Tyr Ser 9
SB-5Ad Israel TB 2000 0.5 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
RAC-19 Israel TB 2000 0.5 Asp Thr Ser Asp Asp Asp Asn Tyr Ser 4
JS-2 Israel TB 2001 0.5 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
ASM-2d Israel MT 2002 0.5 Asp Thr Ser Asp Asp Asp Asn Ser Ser 4
OR-2d Israel MT 2002 0.5 Asp Thr Ser Asp Asn Asp Asn Ser Ser 4
IZSVE/4383/11 Italy BB 2011 1 Asp Thr Ser Asp Asn Asp Asn Ser Asn 10
FTF-8C Israel TB 2000 1 Asn Thr Ser Asp Asp Asp Asn Ser Ser 4
NBR-12D Israel TB 2006 1 Asn Thr Ser Asp Asp Asp Asn Ser Ser 11
HVL-1d Israel MT 1996 1 Asp Ala Ser Asp Asp Asp Asn Ser Ser 4
ASB-19B Israel TB 2001 1 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
ASH-2H Israel MT 2006 1 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
NGA-3D Israel B 2004 2 Asp Thr Pro Asp NT NT Asn Ser Ser 4
FYZ-7D Israel TB 2004 2 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
ODP-12 Israel MT 2007 2 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
OZ-6 Israel MT 2009 2 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
KLD-1 Israel BB 2009 2 Asp Thr Pro Asp Asp Asp Asn Ser Ser 4
MTT Israel BB 2011 2 Asp Thr Ser Asn Asp Asp Asn Ser Ser 12
AMS-7 Austria BB 2010 4 Asp Ile Ser Asp Asp Asp Asn Ser Ser 10
HB-3 Israel MT 2000 4 Asp Ile Ser Asp Asp Glu Asn Tyr Ser 4
BTU-4 Israel L 2011 4 Asp Ile Ser Asp Asp Asp Asn Ser Ser 12
NT-3E Israel MT 2002 4 Asp Ile Ser Asp Asp Asp Asn Ser Ser 4
KTY-8D Israel BB 2009 4 Asp Thr Ser Tyr Asp Asp Asn Ser Ser 4
HL-1 Israel MT 2007 4 Asp Thr Ser His Asp Asp Asn Tyr Ser 13
RMJ-1 Israel MT 2007 4 Asp Thr Ser His Asp Asp Asn Tyr Ser 13
IZSVE/4761/20 Italy L 2011 4 Asp Ile Ser Asp Asp Asp Asn Ser Asn 9
IZSVE/428/1 Italy BB 2011 4 Asp Ile Ser Asp Asp Glu Lys Tyr Ser 14
NJK-09E Israel MT 2009 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 12
ST-3H Israel MT 2010 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 12
MSK-1 Israel MT 2010 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 12
MZ-3 Israel BB 2011 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 15
ALN-5F Israel MT 2011 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 12
AMS-1 Austria BB 2009 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 9
IZSVE/4558 Italy MT 2010 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 9
IZSVE/1216/5 Spain L 2012 8 Asp Ile Ser Asp Asp Asp Asn Ser Ser 16
IZSVE/700 Belgium L 2011 8 Asp Ile Ser Asp Asp Asp Asn Ser Asn 10
IZSVE/701 Belgium L 2011 8 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 10
IZSVE/1184/2 Spain L 2012 8 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 16
IZSVE/4504 Italy BB 2009 8 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 17
IZSVE/3447/16 Italy L 2011 8 Asp Ile Ser Asp Asp Glu Asn Tyr Ser 10
RAMP-16Gd Israel TB 2003 8 Asp Thr Ser Tyr Asp Asp Asn Ser Ser 4
BLTF Israel TB 2002 8 Asp Thr Ser Tyr Asp Asp Asn Ser Ser 4
IZSVE/86/2 Italy BB 2012 16 Asp Ile Ser Asp Asp Asp Asn Ser Ser 10
IZSVE/71/7 Italy L 2012 16 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 9
IZSVE/1774/18 Spain BB 2012 16 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 4
IZSVE/1181/2 Spain B 2012 16 Asp Ile Ser Asp Asp Asp Asn Tyr Ser 16
IZSVE/6642 Italy TB 2011 16 Asp Ile Ser Asp Asp Glu Asn Ser Ser 18
IZSVE/2713/13 Italy L 2011 16 Asp Ile Ser Asp Asn Asp Asn Tyr Ser 10
SBS Israel BB 2011 16 Asp Ile Ser Asp Asp Asp Ser Ser Ser 15
Open in a new tab
a

The same superscript letter (A to H) indicates that the M. synoviae strains were isolated from the same farm or from closely located farms.

b

MT, meat-type turkey; TB, turkey breeder; BB, broiler breeder; B, broiler; L, layer; C, chicken.

c

Amino acid substitutions within the QRDRs in comparison to the reference strains are marked in bold. NT, not tested.

d

En MIC published by Gerchman et al. (8).

Overall, 54, 14, 4, and 1 M. synoviae isolates were obtained from the trachea, joints, air sacs, and heart, respectively (data not shown). M. synoviae colonies were identified by direct immunofluorescence (IMF) with species-specific conjugated antiserum (9). Mixed cultures were cloned to IMF homogeneity by microscopic selection of target colonies. Finally, isolates were divided into 1-ml aliquots and stored at −80°C pending analysis.

In vitro susceptibility testing.

The in vitro susceptibility of M. synoviae isolates to En (Fluka, Germany) was determined by the broth dilution method, following the guidelines recommended by Hannan (10), as described previously (8). Two-fold dilutions of antibiotic from 0.03 to 8 μg/ml and from 0.25 to 64 μg/ml (in the case of strains with MICs of >8 μg/ml) were tested. M. synoviae isolates were considered susceptible to En when the MIC was ≤0.5 μg/ml; isolates with MICs of 1 μg/ml were classified as intermediate to En and those with MICs of ≥2 μg/ml as resistant (11).

For convenience, in this study the term “strains with decreased susceptibility” was used in reference to M. synoviae isolates with MICs of ≥1 μg/ml.

PCR amplification of QRDRs and nucleotide sequence analysis.

Genomic DNA was extracted from 400 μl of logarithmic-phase broth culture using the Maxwell DNA isolation kit for cells/tissue and the Maxwell 16 apparatus (Promega) according to the manufacturer's instructions. QRDRs of gyrA, gyrB, parC, and parE were amplified with gene-specific primers (Table 2) designed on the basis of the genomic sequence of M. synoviae strain 53 (accession no. AE017245) (12).

Table 2.

Oligonucleotide primers used in this study

Primer designation Gene target Sequence (5′→3′) Position
MS-gyrA-F gyrA GAAGATCAGCCTGAATTAGTT 58–78
MS-gyrA-R gyrA GCCATTCTAGCTTCGGTATAA 531–551
MS-gyrB-F gyrB CAAGGTGAGAAATTCTCAAGA 964–984
MS-gyrB-R gyrB TGTGCTTCGTTATAAGCG 1677–1694
MS-parC-F parC CCAACCGTGCAATTCCTGAT 95–114
MS-parC-R parC TTATGCGGCGGCATTTCG 546–563
MS-parE-F parE GGCATATCGTCGAGGAAATAGC 1034–1055
MS-parE-R parE AGTGGTTTCCCAAAGTTG 1741–1758
Open in a new tab

PCRs were carried out in 50 μl, and mixtures contained 10 μl of 10× PCR buffer, 1.25 U MyTaq DNA polymerase (Bioline, United Kingdom), 20 pmol of each primer (Sigma Chemical Co., St. Louis, MO), and about 100 ng of mycoplasmal DNA. PCR amplifications were as follows: 3 min at 95°C; 30 cycles of 95°C for 30 s, 56°C (for gyrA, gyrB, and parE) or 60°C (for parC) for 30 s, and 72°C for 45 s; and 72°C for 5 min. The amplicons of 494 bp, 731 bp, 469 bp, and 725 bp, corresponding to the QRDRs of gyrA, gyrB, parC, and parE, respectively, were purified from the gel by using the MEGAquick-spin PCR and agarose gel DNA extraction system (iNtRON Biotechnology, South Korea).

Sequencing was performed at the DNA Sequencing Unit, Weizmann Institute (Rehovot, Israel). Sequence editing and consensus and alignment construction were performed using DNASTAR software, version 5.06/5.51, 2003 (Lasergene, Inc. Madison, WI). The numbering of amino acid substitutions in QRDRs is according to the sequences of the respective proteins in Escherichia coli.

Molecular typing of M. synoviae isolates by vlhA.

The genetic variability of M. synoviae strains was assessed by sequencing of the 5′ conserved upstream region of the vlhA gene (7). PCR products were amplified using the vlh-A-F and vlh-A-R2 primers as described previously (7, 13). The sequences were assembled using the SeqMan program (Lasergene, DNASTAR). All sequences were aligned using Clustal W (14) and trimmed to the same size for diversity analysis. The final vlhA genotype was assigned based on 100% similarity of nucleotide sequences.

Nucleotide sequence accession numbers.

The nucleotide sequences of representative vlhA genotypes have been deposited in the GenBank database under accession numbers KC832806 to KC832825.

RESULTS

Susceptibility of M. synoviae field strains to En.

In Table 1, the susceptibility data are presented on an individual strain basis, indicating year of isolation, country, and poultry sector of origin. In general, 30/73 M. synoviae strains checked in this study were found to be susceptible to En, with MICs ranging from 0.03 to 0.5 μg/ml. MICs for strains with decreased susceptibility to En ranged from 1 to >16 μg/ml (Table 1). The estimated MIC50 and MIC90 values for En were 2 and 8 μg/ml, respectively.

Overall, more than half of the M. synoviae field isolates tested showed decreased susceptibility to En (25/44 Israeli strains and 18/29 European strains). Notably, among M. synoviae strains isolated in recent years (2009 to 2012), 11/12 Israeli and 9/11 of Italian isolates were resistant to En, in comparison to only 2/12 recently isolated Austrian isolates (Table 1).

Molecular characterization of QRDRs in M. synoviae field strains with different susceptibilities to En.

Comparison of the ParC QRDRs revealed the presence of different amino acid substitutions at position 79, 80, 81, or 84 (E. coli numbering). For example, 26 strains with MICs of 1 to 16 μg/ml possessed the amino acid substitution Thr80 to Ile. In addition, one strain with an MIC of 1 μg/ml possessed the amino acid substitution Thr80 to Ala, and two strains with an MIC of 1 μg/ml had the amino acid substitution Asp79 to Asn; 7 strains with MICs of 1 to 2 μg/ml contained the amino acid substitution Ser81 to Pro, and 6 strains with MICs of 2 to 8 μg/ml demonstrated the presence of the amino acid Tyr (3 strains), His (2 strains), or Asn (1 strain) instead of Asp at position 84 of the ParC QRDR (Table 1). Notably, in contrast to the changes identified at position Thr80, all the changes at positions Asp79, Ser81, and Asp84 were in Israeli M. synoviae isolates (Table 1). Nine out of 12 Austrian M. synoviae strains with MICs of 0.06 to 0.25 μg/ml contained the amino acid substitutions Ala90 to Thr in the ParC QRDR and Leu157 to Phe (located outside the ParC QRDR) (data not shown); this change is likely related to intraspecies variations.

Comparison of ParE QRDRs revealed the presence of the amino acid substitution Asp420 to Asn in 4/69 M. synoviae strains with MICs of 0.25 to 16 μg/ml (Table 1). In addition, at position 454 of the ParE QRDR, either Asp or Glu was identified, with no apparent correlation with MIC. For example, among 15 M. synoviae field isolates containing the amino acid Glu454, 11 possessed MICs of 0.06 to 0.25 μg/ml and 4 had MICs of 4 to 16 μg/ml. In contrast, among 54 M. synoviae strains contained the amino acid Asp454, 16 strains demonstrated MICs of 0.25 to 0.5 μg/ml and 38 strains had MICs of 1 to 16 μg/ml (Table 1). Interestingly, M. synoviae reference strains WVU1883 and FMT have the amino acids Glu and Asp at position 454 of the ParE QRDR, respectively. Both of these strains have an MIC of 0.5 μg/ml to En (Table 1).

In addition, 3 resistant strains (HL-1, RMJ-1, and ALN-5) showed an amino acid substitution Val529 to Ile, and 1 resistant strain (IZSVE/6642) and 1 strain with decreased susceptibility to En (IZSVE/4383/11) possessed Thr530 to Ile (data not shown); both of these changes are outside the ParE QRDR.

Sequence analysis of the GyrA QRDRs showed the presence of the amino acid substitution Asn87 to Ser in strains SMA22 (MIC, 0.25 μg/ml) and SBS (MIC, 16 μg/ml) and the amino acid substitution Asn87 to Lys in strain IZSVE/428/1 (MIC, 4 μg/ml) (Table 1). No other M. synoviae strains checked in this study contained amino acid substitutions in the GyrA QRDR.

The amino acid substitution Ser401 to Tyr was identified in GyrB QRDRs of 12/43 En-resistant strains (MICs, 4 to 16 μg/ml) as well as in 5/30 En-susceptible strains (MICs, 0.125 to 0.5 μg/ml). In addition, 3/73 M. synoviae strains (MICs, 1 to 8 μg/ml) contained the amino acid substitution Ser402 to Asn (Table 1).

Molecular typing of M. synoviae field strains.

Based on 100% identity of the vlhA gene sequence, 9 vlhA genotypes were identified among the Israeli isolates and 10 types among the isolates from European countries (Table 1). The most frequent vlhA genotype in Israel (type 4, found in 26/44 strains) was identified in a single isolate from Spain; otherwise, there was no overlap between the two cohorts. In contrast, some vlhA types were found to be present in isolates from different European countries (types 9, 10, and 17) (Table 1). vlhA types 1, 2, and 3 were detected only in Austrian isolates, and the most common was vlhA type 1 (7/12).

Overall, different vlhA genotypes were identified in En-susceptible and En-resistant M. synoviae isolates, both in Israel and in Europe. However, notably, the predominant Israeli vlhA type (type 4) was found in both sensitive strains and in strains with decreased susceptibility to En. Also, in M. synoviae isolates in Italy, vlhA type 9 was found in a sensitive strain as well as in resistant strains (Table 1).

DISCUSSION

During the past decade, a limited number of studies relating to the in vitro susceptibility of M. synoviae field strains have been published (8, 15–18), and in one case, two M. synoviae isolates resistant to En were identified (8). In contrast, the results of this study reveal a high percentage (50%) of M. synoviae field isolates resistant to En. Moreover, about 90% of Israeli and Italian M. synoviae strains isolated in recent years (2009 to 2012) had MICs of ≥1 μg/ml and hence are not susceptible to En (Table 1). En resistance of Israeli M. synoviae isolates continues a trend previously reported for Mycoplasma gallisepticum. Indeed, it has been previously shown that 12/13 (92%) M. gallisepticum strains isolated in Israel since 2009 were resistant to En (19). Interestingly, although resistance to En is present at a high frequency in Israeli and Italian field isolates, only 16% (2/12) of Austrian strains isolated in 2009 to 2011 are resistant to En (Table 1). Such a difference might be due to differences in the use of fluoroquinolones in the different countries. Another factor may be the geographical differences in the structure of the poultry industry. In areas with a high density of poultry flocks, such as Israel and the northern part of Italy, emergence/prevalence and clonal dissemination of En-resistant M. synoviae strains are more likely to occur than in areas where poultry farms are relatively sparse.

Molecular typing by vlhA of the 44 Israeli M. synoviae strains isolated over time showed that the emergence and dissemination of the resistance phenotypes might have different sources. On one hand, the presence of the dominant vlhA genotype 4 in 12/19 susceptible strains, in 4/5 strains with intermediate susceptibility, and in 10/25 resistant isolates suggests selection of resistant strains from the previously susceptible predominant strain (Table 1). On the other hand, the appearance of new vlhA genotype 12 in 6/12 (50%) recent En-resistant isolates suggests the development and clonal dissemination of this genotype. However, the presence of resistant strains with other vlhA genotypes (11, 13, 15) points to an ongoing selection process.

In the group of European En-resistant strains, vlhA genotypes 9 and 10 (present in 4/18 [22%] and in 7/18 [39%] of strains, respectively) were prevalent (Table 1). However, no conclusion regarding a possible correlation between vlhA type and susceptibility to En is possible, since only a small number of strains per country were checked.

Molecular analysis of the genes encoding the QRDRs of ParC, ParE, GyrA, and GyrB was done to identify mutations leading to amino acid substitutions. An overview of the data presented here demonstrates full correlation between a single amino acid substitution at position 79, 80, 81, or 84 of the ParC QRDR and decreased susceptibility of M. synoviae to En (Table 1). All 37 strains with MICs of ≥2 μg/ml had a change at one of these positions. In addition, 5/6 strains with one of these amino acid substitutions had decreased susceptibility (MIC of 1 μg/ml) to En. None of the susceptible strains had a change at these positions. A previous study reported that position 81 of the ParC QRDR may be implicated in En resistance in M. synoviae (6). Positions 80 and 84 of the ParC QRDR are known hot spots for En resistance in many bacteria, including mycoplasmas, and may alone or together with a mutation within the GyrA QRDR result in decreased susceptibility to fluoroquinolones (20–24). An amino acid substitution at position 81 of the ParC QRDR was identified in Mycoplasma hominis (25). To the best of our knowledge, no amino acid substitutions have been previously identified at position 79 of the ParC-QRDR of mycoplasmas with decreased susceptibility to fluoroquinolones. However, changes at this position were identified in other bacteria, for example, in Streptococcus pyogenes, Streptococcus agalactiae, and Streptococcus pneumoniae (26–28). In addition, our data suggest that there is a correlation between MIC values and the type and position of mutations in the ParC QRDR. Indeed, all 32 M. synoviae field isolates containing substitutions Thr-80-Ile and Asp-84-His/Tyr had MICs in the range from 4 to 8 μg/ml (Table 1). In contrast, all 11 strains containing amino acid substitutions such as Asp-79-Asn, Thr-80-Ala, Ser-81-Pro, and Asp-84-Asn possessed MICs of 1 to 2 μg/ml (Table 1). More strains from different geographic regions and with a broader spectrum of MICs should be checked to support this suggestion.

Concurrent mutation within the GyrA QRDR (in addition to the changes in the ParC QRDR) may increase MIC values for fluoroquinolones, as was previously shown for S. pneumoniae (29). In our study, only two M. synoviae strains (IZSVE/428/1 and SBS, with MICs of 4 and 16 μg/ml, respectively) have amino acid substitutions in both the ParC and GyrA QRDRs (Table 1). The relevance of the mutations that occurred in the M. synoviae GyrA QRDR should be clarified in the future.

Mutations in the ParE and GyrB QRDRs were also identified (Table 1). Three M. synoviae strains checked here contained the amino acid substitution Asp420-Asn, with MICs of 0.25 to 16 μg/ml. A mutation at position 420 (Asp to Asn) of ParE has been previously identified in M. hominis strains with decreased susceptibility to fluoroquinolones (25, 30) and in vitro-selected En-resistant mutants of M. gallisepticum (31). Position 420 of ParE corresponds to residue 426Asp of the E. coli GyrB, which is a hot spot for fluoroquinolone resistance in many bacteria (32). Notably, in M. synoviae, as in M. hominis PG21 (31), the amino acid residue at position 426 of GyrB is already an asparagine, the amino acid usually replacing aspartic acid at position 426 in the GyrB QRDR of quinolone-resistant bacteria. In addition, two different amino acids (Glu and Asp), related to the same group of polar amino acids, were identified at position 454 of the ParE QRDR, without a clear correlation to decreased susceptibility to En (Table 1).

The amino acid substitution Pro (nonpolar) to Ser (polar, uncharged) at ParE position 454 has been previously described in S. pneumoniae strains with decreased susceptibility to fluoroquinolones (33, 34). The role of amino acid substitutions at positions 401 and 402 of the M. synoviae GyrB QRDR in fluoroquinolone resistance still remains to be determined.

In conclusion, our study showed the recent emergence of acquired resistance to En in M. synoviae field isolates isolated in Israel as well as in some European countries. Examination of field strains with decreased susceptibility to En revealed that acquired resistance may be attributed to mutations occurring at positions 79 to 81 or 84 of the ParC QRDR. This is the first report describing molecular mechanisms of En resistance in M. synoviae field isolates. We believe that comparison between phenotype (MIC) and genotype (QRDRs) may help to validate MIC breakpoint values for fluoroquinolones in M. synoviae.

ACKNOWLEDGMENTS

We gratefully acknowledge the receipt of M. synoviae strains from J. Spergser, Institute of Bacteriology, Mycology and Hygiene, University of Veterinary Medicine, Vienna, Austria.

This study was supported in part by research grant award 847-0364 from the Israel Egg and Poultry Board. The Italian part of this study was supported by a research grant award from the Italian Ministry of Health (RC IZSVE15/10).

Footnotes

Published ahead of print 22 April 2013

REFERENCES

  • 1. Kleven SH, Ferguson-Noel N. 2008. Mycoplasma synoviae infection, p 845–856 In Saif YM, Fadly AH, Glisson JR, McDougald JR, Nolan NK, Swayne DE. (ed), Diseases of poultry, 12th ed Iowa State University Press, Ames, IA [Google Scholar]
  • 2. Feberwee A, de Wit JJ, Landman WJ. 2009. Induction of eggshell apex abnormalities by Mycoplasma synoviae: field and experimental studies. Avian Pathol. 38:77–85 [DOI] [PubMed] [Google Scholar]
  • 3. Catania S, Bilato D, Gobbo F, Granato A, Terregino C, Iob L, Nicholas RA. 2010. Treatment of eggshell abnormalities and reduced egg production caused by Mycoplasma synoviae infection. Avian Dis. 54:961–964 [DOI] [PubMed] [Google Scholar]
  • 4. Hofacre CL. 2007. Antimicrobial drug use in poultry, p 545–553 In Giguere S, Prescott JF, Baggot JD, Walker RD, Dowling PM. (ed), Antimicrobial therapy in veterinary medicine, 4th ed Wiley Blackwell, Hoboken, NJ [Google Scholar]
  • 5. Hooper DC. 1998. Bacterial topoisomerases, anti-topoisomerases, and anti-topoisomerase resistance. Clin. Infect. Dis. 27:S54–63 [DOI] [PubMed] [Google Scholar]
  • 6. Le Carrou J, Reinhardt AK, Kempf I, Gautier-Bouchardon AV. 2006. Persistence of Mycoplasma synoviae in hens after two enrofloxacin treatments and detection of mutations in the parC gene. Vet. Res. 37:145–154 [DOI] [PubMed] [Google Scholar]
  • 7. Bencina D, Drobnic-Valic M, Horvat S, Narat M, Kleven SH, Dovc P. 2001. Molecular basis of the length variation in the N-terminal part of Mycoplasma synoviae hemagglutinin. FEMS Microbiol. Lett. 203:115–123 [DOI] [PubMed] [Google Scholar]
  • 8. Gerchman I, Lysnyansky I, Perk S, Levisohn S. 2008. In vitro susceptibilities to fluoroquinolones in current and archived Mycoplasma gallisepticum and Mycoplasma synoviae isolates from meat-type turkeys. Vet. Microbiol. 131:266–276 [DOI] [PubMed] [Google Scholar]
  • 9. Gardella RS, Del Giudice RA, Tully JG. 1983. Immunofluorescence, p 431–439 In Razin S, Tully JG. (ed), Methods in mycoplasmology: mycoplasma characterization. Academic Press, Waltham, MA [Google Scholar]
  • 10. Hannan PC. 2000. Guidelines and recommendations for antimicrobial minimum inhibitory concentration (MIC) testing against veterinary mycoplasma species. Vet. Res. 31:373–395 [DOI] [PubMed] [Google Scholar]
  • 11. Hannan PCT, Windsor GD, de Jong A, Schmeer N, Stegemann H. 1997. Comparative susceptibilities of various animal-pathogenic mycoplasmas to fluoroquinolones. Antimicrob. Agents Chemother. 41:2037–2040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Vasconcelos ATR, Ferreira HB, Bizarro CV, Bonatto SL, Carvalho MO, Pinto PM, Almeida DF, Almeida LGP, Almeida R, Alves-Filho L, Assuncao EN, Azevedo VAC, Bogo MR, Brigido MM, Brocchi M, Burity HA, Camargo AA, Camargo SS, Carepo MS, Carraro DM, de Mattos Cascardo JC, Castro LA, Cavalcanti G, Chemale G, Collevatti RG, Cunha CW, Dallagiovanna B, Dambros BP, Dellagostin OA, Falcao C, Fantinatti-Garboggini F, Felipe MSS, Fiorentin L, Franco GR, Freitas NSA, Frias D, Grangeiro TB, Grisard EC, Guimaraes CT, Hungria M, Jardim SN, Krieger MA, Laurino JP, Lima LFA, Lopes MI, Loreto ELS, Madeira HMF, Manfio GP, et al. 2005. Swine and poultry pathogens: the complete genome sequences of two strains of Mycoplasma hyopneumoniae and a strain of Mycoplasma synoviae. J. Bacteriol. 187:5568–5577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hammond PP, Ramirez AS, Morrow CJ, Bradbury JM. 2009. Development and evaluation of an improved diagnostic PCR for Mycoplasma synoviae using primers located in the haemagglutinin encoding gene vlhA and its value for strain typing. Vet. Microbiol. 136:61–68 [DOI] [PubMed] [Google Scholar]
  • 14. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95–98 [Google Scholar]
  • 15. Dufour-Gesbert F, Dheilly A, Marois C, Kempf I. 2006. Epidemiological study on Mycoplasma synoviae infection in layers. Vet. Microbiol. 114:148–154 [DOI] [PubMed] [Google Scholar]
  • 16. Landman WJM, Mevius DJ, Veldman KT, Feberwee A. 2008. In vitro antibiotic susceptibility of Dutch Mycoplasma synoviae field isolates originating from joint lesions and the respiratory tract of commercial poultry. Avian Pathol. 37:415–420 [DOI] [PubMed] [Google Scholar]
  • 17. Cerda RO, Giacoboni GI, Xavier JA, Sansalone PL, Landoni MF. 2002. In vitro antibiotic susceptibility of field isolates of Mycoplasma synoviae in Argentina. Avian Dis. 46:215–218 [DOI] [PubMed] [Google Scholar]
  • 18. Wang C, Ewing M, Aarabi SY. 2001. In vitro susceptibility of avian mycoplasmas to enrofloxacin, sarafloxacin, tylosin, and oxytetracycline. Avian Dis. 45:456–460 [PubMed] [Google Scholar]
  • 19. Gerchman I, Levisohn S, Mikula I, Manso-Silvan L, Lysnyansky I. 2011. Characterization of in vivo-acquired resistance to macrolides of Mycoplasma gallisepticum strains isolated from poultry. Vet. Res. 42:90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Le Carrou J, Laurentie M, Kobisch M, Gautier-Bouchardon AV. 2006. Persistence of Mycoplasma hyopneumoniae in experimentally infected pigs after marbofloxacin treatment and detection of mutations in the parC gene. Antimicrob. Agents Chemother. 50:1959–1966 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Lysnyansky I, Mikula I, Gerchman I, Levisohn S. 2009. Rapid detection of a point mutation in the parC gene associated with decreased susceptibility to fluoroquinolones in Mycoplasma bovis. Antimicrob. Agents Chemother. 53:4911–4914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Lysnyansky I, Gerchman I, Perk S, Levisohn S. 2008. Molecular characterization and typing of enrofloxacin-resistant clinical isolates of Mycoplasma gallisepticum. Avian Dis. 52:685–689 [DOI] [PubMed] [Google Scholar]
  • 23. Vicca J, Maes D, Stakenborg T, Butaye P, Minion F, Peeters J, de Kruif A, Decostere A, Haesebrouck F. 2007. Resistance mechanism against fluoroquinolones in Mycoplasma hyopneumoniae field isolates. Microb. Drug Resist. 13:166–170 [DOI] [PubMed] [Google Scholar]
  • 24. Hirose K, Kawasaki Y, Kotani K, Abiko K, Sato H. 2004. Characterization of a point mutation in the parC gene of Mycoplasma bovirhinis associated with fluoroquinolone resistance. J. Vet. Med. B Infect. Dis. Vet. Public Health 51:169–175 [DOI] [PubMed] [Google Scholar]
  • 25. Bebear C, Renaudin J, Charron A, Renaudin H, de Barbeyrac B, Schaeverbeke T, Bebear C. 1999. Mutations in the gyrA, parC, and parE genes associated with fluoroquinolone resistance in clinical isolates of Mycoplasma hominis. Antimicrob. Agents Chemother. 43:954–956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Yan SS, Fox ML, Holland SM, Stock F, Gill VJ, Fedorko DP. 2000. Resistance to multiple fluoroquinolones in a clinical isolate of Streptococcus pyogenes: identification of gyrA and parC and specification of point mutations associated with resistance. Antimicrob. Agents Chemother. 44:3196–3198 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kawamura Y, Fujiwara H, Mishima N, Tanaka Y, Tanimoto A, Ikawa S, Itoh Y, Ezaki T. 2003. First Streptococcus agalactiae isolates highly resistant to quinolones, with point mutations in gyrA and parC. Antimicrob. Agents Chemother. 47:3605–3609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Pan X, Ambler J, Mehtar S, Fisher L. 1996. Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 40:2321–2326 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Cornick JE, Bentley SD. 2012. Streptococcus pneumoniae: the evolution of antimicrobial resistance to beta-lactams, fluoroquinolones and macrolides. Microbes Infect. 14:573–583 [DOI] [PubMed] [Google Scholar]
  • 30. Bebear CM, Renaudin H, Charron A, Bove JM, Renaudin J. 1998. Alterations in topoisomerase IV and DNA gyrase in quinolone-resistant mutants of Mycoplasma hominis obtained in vitro. Antimicrob. Agents Chemother. 42:2304–2311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Reinhardt AK, Bebear CM, Kobisch M, Kempf I, Gautier-Bouchardon AV. 2002. Characterization of mutations in DNA gyrase and topoisomerase IV involved in quinolone resistance of Mycoplasma gallisepticum mutants obtained in vitro. Antimicrob. Agents Chemother. 46:590–593 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Heddle J, Maxwell A. 2002. Quinolone-binding pocket of DNA gyrase: role of GyrB. Antimicrob. Agents Chemother. 46:1805–1815 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Pan X-S, Fisher LM. 1998. DNA gyrase and topoisomerase IV are dual targets of clinafloxacin action in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:2810–2816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Daporta MT, Munoz Bellido JL, Guirao GY, Hernandez MS, Garcia-Rodriguez JA. 2004. In vitro activity of older and newer fluoroquinolones against efflux-mediated high-level ciprofloxacin-resistant Streptococcus pneumoniae. Int. J. Antimicrob. Agents 24:185–187 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES