Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2013 Jul;79(13):3959–3966. doi: 10.1128/AEM.00637-13

Close Genetic Relationship between Legionella pneumophila Serogroup 1 Isolates from Sputum Specimens and Puddles on Roads, as Determined by Sequence-Based Typing

Jun-ichi Kanatani a, Junko Isobe a, Keiko Kimata a, Tomoko Shima a, Miwako Shimizu a, Fumiaki Kura b, Tetsutaro Sata a, Masanori Watahiki a,✉
PMCID: PMC3697553  PMID: 23603681

Abstract

We investigated the prevalence of Legionella species isolated from puddles on asphalt roads. In addition, we carried out sequence-based typing (SBT) analysis on the genetic relationship between L. pneumophila serogroup 1 (SG 1) isolates from puddles and from stock strains previously obtained from sputum specimens and public baths. Sixty-nine water samples were collected from puddles on roads at 6 fixed locations. Legionella species were detected in 33 samples (47.8%) regardless of season. Among the 325 isolates from puddles, strains of L. pneumophila SG 1, a major causative agent of Legionnaires' disease, were the most frequently isolated (n = 62, 19.1%). Sixty-two isolates of L. pneumophila SG 1 from puddles were classified into 36 sequence types (STs) by SBT. ST120 and ST48 were identified as major STs. Environmental ST120 strains from puddles were found for the first time in this study. Among the 14 STs of the clinical isolates (n = 19), 4 STs (n = 6, 31.6%), including ST120, were also detected in isolates from puddles on roads, and the sources of infection in these cases remained unclear. The lag-1 gene, a tentative marker for clinical isolates, was prevalent in puddle isolates (61.3%). Our findings suggest that puddles on asphalt roads serve as potential reservoirs for L. pneumophila in the environment.

INTRODUCTION

Legionella pneumophila is a major agent causing Legionnaires' disease, which is a severe form of legionellosis and a potentially fatal pneumonia (1). L. pneumophila is a Gram-negative bacterium that is ubiquitous in natural environments. In addition, it has been found in anthropogenic environments, such as cooling towers, baths, showers, and decorative fountains (2–5). Legionellosis may be acquired through inhalation of aerosolized water contaminated with Legionella species (6). Therefore, aquatic facilities are potential sources of sporadic cases or outbreaks of infection. Although 58 species and more than 70 serogroups (SG) of Legionella species have been identified (7), more than 90% of legionellosis cases are caused by L. pneumophila (8). Among 15 serogroups of L. pneumophila, most clinical strains (80%) in Japan belonged to SG 1 (9). Recently, in the United States, Kozak et al. revealed that 75% of the L. pneumophila SG 1 clinical isolates but only 8% of environmental isolates harbored the lag-1 gene, which is required for the expression of the virulence-associated epitope recognized by monoclonal antibody 2 of the international standard panel (10).

To identify the infection sources of legionellosis cases, sequence-based typing (SBT) was proposed by the European Working Group for Legionella Infections (EWGLI); SBT is a sequence-based scheme comprising defined regions of 7 genes (flaA, pilE, asd, mip, mompS, proA, and neuA) for L. pneumophila (11–13). SBT has been used as a molecular typing method to characterize L. pneumophila SG 1 strains (14–16).

In Japan, public baths are a major source of infection, according to the National Epidemiological Surveillance of Infectious Diseases (17). Fatal cases of legionellosis from homes and spa pools have been reported (18, 19). Recently, several reports revealed that legionellosis could be acquired from puddles of rainwater on roads (20) and from air-conditioning systems of motor vehicles (21). These environments have thus been considered potential new sources of infection. However, the genetic relationships between strains from clinical specimens and from these environmental sources have not been clearly analyzed by molecular typing techniques. Furthermore, our previous study reported that the comparative analysis of L. pneumophila SG 1 isolates from sputum specimens and public baths found a clonal group formed only by clinical isolates that were not associated with bath water (22). The short genetic distance between strains of the clonal group suggested that they were derived from a common and unrecognized type of source.

We hypothesize that clinical isolates that are not associated with bath water may be genetically close to isolates from puddles on asphalt roads. The main objective of this study was to characterize the genetic relationship between L. pneumophila SG 1 isolates from puddles and stock strains previously isolated from sputum specimens, public baths, and some other environmental sources.

MATERIALS AND METHODS

Bacterial strains.

A total of 140 L. pneumophila SG 1 isolates were analyzed, including isolates from puddles on roads (n = 62), public baths (n = 51), cooling towers (n = 5), showers (n = 3), and sputum specimens (n = 19). Among these, 62 isolates from puddles and 5 isolates from other sources (1 isolate from a cooling tower, 2 isolates from 2 showers, and 2 isolates from 2 patients) obtained in this study were collected from 2010 to 2011 and from 2010 to 2012, respectively, in Toyama Prefecture, Japan (Table 1); the remaining 73 isolates (51 isolates from 24 public baths, 4 isolates from 2 cooling towers, 1 isolate from a shower, and 17 isolates from 16 patients), obtained in a previous study, were collected from 2005 to 2012 in Toyama Prefecture, Japan (22).

Table 1.

Sequence types and lag-1 gene results of L. pneumophila serogroup 1 isolates obtained in this studya

Strain Origin Date of isolation
 Allele no.
 ST Presence of lag-1
Yr Mo flaA pilE asd mip mompS proA neuA
LG1554 PU 2010 Nov 2 3 6 10 2 1 6 22 Negative
LG1555 PU 2010 Nov 2 3 9 10 2 1 6 23 Negative
LG1732 PU 2011 May 2 3 9 10 2 1 6 23 Negative
LG1743 PU 2011 May 2 3 9 10 2 1 6 23 Positive
LG1551 PU 2010 Nov 5 2 22 27 6 10 12 48 Negative
LG1552 PU 2010 Nov 5 2 22 27 6 10 12 48 Negative
LG1553 PU 2010 Nov 5 2 22 27 6 10 12 48 Negative
LG1625 PU 2011 Jan 5 2 22 27 6 10 12 48 Negative
LG1719 PU 2011 May 5 2 22 27 6 10 12 48 Negative
LG1723 PU 2011 May 5 2 22 27 6 10 12 48 Negative
LG1742 PU 2011 May 5 2 22 27 6 10 12 48 Negative
LG1737 PU 2011 May 2 3 18 13 25 5 6 75 Positive
LG1680 PU 2011 Mar 4 10 11 15 29 1 6 89 Positive
LG1729 PU 2011 May 12 8 11 20 5 12 6 118 Positive
LG1550 PU 2010 Nov 2 3 5 11 2 1 6 120 Positive
LG1674 PU 2011 Mar 2 3 5 11 2 1 6 120 Positive
LG1736 PU 2011 May 2 3 5 11 2 1 6 120 Positive
LG1746 PU 2011 May 2 3 5 11 2 1 6 120 Positive
LG1747 PU 2011 May 2 3 5 11 2 1 6 120 Positive
LG1771 PU 2011 Jun 2 3 5 11 2 1 6 120 Positive
LG1772 PU 2011 Jun 2 3 5 11 2 1 6 120 Positive
LG1805 PU 2011 Aug 3 13 1 10 14 9 11 127 Negative
LG1604 PU 2010 Dec 2 1 6 15 2 1 6 132 Positive
LG1749 PU 2011 May 2 1 6 15 2 1 6 132 Positive
LG1673 PU 2011 Mar 2 3 9 10 2 1 10 384 Positive
LG1766 PU 2011 Jun 2 3 9 10 2 1 10 384 Positive
LG1698 PU 2011 Mar 2 3 5 10 2 1 6 507 Negative
LG1740 PU 2011 May 2 3 5 10 2 1 6 507 Positive
LG1748 PU 2011 May 2 3 5 10 2 1 6 507 Positive
LG1546 PU 2010 Nov 8 10 3 10 2 1 6 610 Positive
LG1814 PU 2011 Aug 12 9 2 5 27 20 6 615 Positive
LG1679 PU 2011 Mar 12 8 11 10 5 12 6 624 Positive
LG1622 PU 2011 Jan 21 40 43 20 15 26 2 808 Negative
LG1632 PU 2011 Jan 21 40 43 20 15 26 2 808 Negative
LG1768 PU 2011 Jun 2 3 6 15 51 1 6 876 Positive
LG1733 PU 2011 May 2 3 5 3 2 1 9 1186 Positive
LG1735 PU 2011 May 2 3 5 3 2 1 9 1186 Positive
LG1631 PU 2011 Jan 2 3 5 13 2 1 6 1187 Positive
LG1767 PU 2011 Jun 2 3 5 13 2 1 6 1187 Positive
LG1638 PU 2011 Jan 2 3 5 28 2 1 6 1188 Positive
LG1799 PU 2011 Aug 2 3 5 58 2 1 6 1189 Positive
LG1683 PU 2011 Mar 2 3 18 12 35 1 6 1190 Positive
LG1797 PU 2011 Aug 2 3 58 10 2 1 6 1191 Positive
LG1753 PU 2011 May 2 10 5 10 2 1 6 1192 Negative
LG1739 PU 2011 May 2 10 5 10 2 1 9 1193 Negative
LG1741 PU 2011 May 2 10 5 10 2 1 9 1193 Negative
LG1678 PU 2011 Mar 2 10 5 47 18 5 9 1194 Negative
LG1681 PU 2011 Mar 2 10 9 12 2 5 6 1195 Positive
LG1540 PU 2010 Nov 2 10 14 3 18 4 11 1196 Negative
LG1730 PU 2011 May 2 10 57 10 18 5 9 1197 Negative
LG1630 PU 2011 Jan 2 23 13 25 18 22 9 1198 Positive
LG1697 PU 2011 Mar 2 23 13 25 18 22 9 1198 Positive
LG1813 PU 2011 Aug 2 31 5 21 18 12 6 1199 Positive
LG1811 PU 2011 Aug 4 8 11 10 11 12 10 1200 Positive
LG1745 PU 2011 May 12 8 11 56 2 12 34 1201 Positive
LG1686 PU 2011 Mar 12 15 11 56 11 12 34 1202 Positive
LG1541 PU 2010 Nov 21 14 29 1 15 29 6 1203 Positive
LG1543 PU 2010 Nov 34 27 56 57 72 29 44 1204 Negative
LG1544 PU 2010 Nov 34 27 56 57 72 29 44 1204 Negative
LG1691 PU 2011 Mar 34 27 56 57 72 29 44 1204 Negative
LG1804 PU 2011 Aug 34 27 56 57 72 29 44 1204 Negative
LG1689 PU 2011 Mar 34 27 55 54 71 44 44 1225 Negative
LG1975 CT 2011 Jun 1 4 3 1 1 1 1 1 Negative
LG2051 SH 2012 Nov 7 6 17 3 13 11 11 59 Negative
LG2055 SH 2012 Nov 5 2 22 27 6 10 12 48 Negative
LG1535 PA 2010 Nov 2 3 5 15 2 1 6 973 Positive
LG1757 PA 2011 May 10 12 7 3 16 18 6 138 Positive
Open in a new tab
a

PU, puddle; CT, cooling tower; SH, shower; PA, patient; ST, sequence type.

Identification of Legionella species from puddles on a road.

After rainfall, water samples were collected at 6 fixed locations along 3 main national roads once per month from November 2010 to October 2011 in Toyama Prefecture (Fig. 1). The eastern and southern parts of the prefecture were not selected for sampling because they are mountainous and sparsely populated. Samples from locations A to E were collected from November 2010 to October 2011; samples from location F were collected from February to October 2011.

Fig 1.

Fig 1

Open in a new tab

Locations of the 6 fixed points for sampling from puddles on roads. Sixty-nine samples were collected from the 6 locations as follows: A (n = 12), B (n = 12), C (n = 12), D (n = 12), E (n = 12), and F (n = 9).

Water samples (150 ml) from puddles on asphalt roads were filtered with a 0.22-μm-pore-size polycarbonate membrane (catalog no. GTTP04700; Millipore, Billerica, MA, USA) and resuspended in 3 ml of distilled water. After the concentrated samples were mixed with equal volumes of 0.2 mol/liter KCl-HCl buffer (pH 2.2) for 5 min at room temperature, they were spread onto glycine-vancomycin-polymyxin B-cycloheximide agar plates (bioMérieux, Lyon, France) and modified Wadowsky Yee agar plates (Oxoid, Basingstoke, Hampshire, United Kingdom). The agar plates were incubated at 35°C for 7 days in a moist chamber. Smooth gray colonies were subcultured onto buffered charcoal-yeast extract agar plates (bioMérieux) and blood agar plates (Eiken Chemical, Tokyo, Japan). The colonies growing only on buffered charcoal-yeast extract agar plates were presumed to belong to the genus Legionella by observation of the characteristic outward structures (cut-glass-like or mosaiclike appearance) under a stereo microscope with oblique illumination (23). The detection limit of the procedure was 10 CFU/100 ml. These colonies were tested using a latex agglutination test kit (catalog no. DR0800M; Oxoid, Hampshire, United Kingdom) and slide agglutination with commercial antisera (Denka Seiken, Tokyo, Japan) to determine the Legionella species and serogroups. The remaining colonies not identified by serological methods were examined by PCR with primers for Legionella genus-specific 16S rRNA genes and L. pneumophila species-specific mip genes (24, 25). The species of some isolates were determined by sequencing of 16S rRNA genes as described previously, with a slight modification (26). Sequencing was performed with an ABI Prism 3130xl genetic analyzer (Applied Biosystems, Foster City, CA, USA) and primers 27f (AGAGTTTGATCCTGGCTCAG) and r1L (GTATTACCGCGGCTGCTGG).

SBT.

SBT was performed according to the protocol of the EWGLI (http://www.hpa-bioinformatics.org.uk/legionella/legionella_sbt/php/sbt_homepage.php), as described previously (11, 12). Novel alleles and sequence types (STs) were submitted to the EWGLI SBT database for assignment. Clonal analyses were performed by using eBURST V3 (http://eburst.mlst.net). Groups that were generated with single-, double-, and triple-locus variants were defined as clonal groups (CGs).

PCR amplification of the lag-1 gene.

Genomic DNA was extracted by emulsifying several colonies of L. pneumophila in 100 μl of 5% (wt/vol) Chelex-100 solution (Bio-Rad Laboratories, Tokyo, Japan). The suspension was boiled at 100°C for 10 min and then centrifuged at 20,000 × g for 5 min at room temperature. The supernatant was used as a DNA template. The primers lag-F and lag-R were used for amplification of the lag-1 gene (10). The PCR was performed using GoTaq green master mix (Promega, Madison, WI, USA) under the following conditions: initial denaturation at 95°C for 2 min and 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min.

Statistical analysis.

The χ2 test was performed to compare the proportions of Legionella-positive and -negative puddles, as well as lag-1-positive and -negative isolates, using Microsoft Excel (Microsoft, Tokyo, Japan). To test for significant differences in the cell concentrations of Legionella species, the Mann-Whitney U test was performed using R statistical software (version 2.15.1). A P value of <0.05 was considered statistically significant.

Nucleotide sequence accession numbers.

The sequence data from this study have been submitted to DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/) under accession numbers AB811041, AB811042, AB811044, AB811045, AB811047 to AB811052, AB811054, AB811055, AB811057 to AB811064, AB811066 to AB811075, and AB811077.

RESULTS

Isolation of Legionella species from water samples of puddles on roads.

Legionella species were detected in 33 samples (47.8%) from locations A (n = 4), B (n = 5), C (n = 7), D (n = 7), E (n = 7), and F (n = 3) (Fig. 1). Legionella species were isolated frequently, except in September and October 2011 (Table 2). Among the 33 positive samples, the concentrations of Legionella species ranged from 10 to 99 CFU/100 ml in 18 (54.5%) samples, 14 (42.4%) samples contained 100 to 999 CFU/100 ml, and 1 (3.0%) sample contained 7,520 CFU/100 ml. Even when the mean temperature was <0°C in January, Legionella species were isolated from 4 of 5 samples, and 3 samples contained 100 to 999 CFU/100 ml. Furthermore, the isolation rates of Legionella species at mean temperatures of ≥20°C (50.0%, 12/24) and <20°C (46.7%, 21/45) were almost the same (P > 0.05; the χ2 test), indicating that Legionella species were detected regardless of temperature. However, the concentrations of Legionella species ranged from 20 to 7,520 CFU/100 ml at mean temperatures of ≥20°C and from 10 to 240 CFU/100 ml at mean temperatures of <20°C. The Mann-Whitney U test revealed that the concentrations of Legionella species at mean temperatures of ≥20°C and <20°C were significantly different (P < 0.05): the geometric means ± standard deviations (log10 CFU/100 ml) in Legionella-positive puddles were 2.30 ± 0.68 and 1.63 ± 0.47, respectively.

Table 2.

Distribution of Legionella species from puddles on roads in Toyama Prefecture, Japan

Yr Mo Mean temp (°C) No. of samples (no. with L. pneumophila):
 Geometric mean ± SD (log10 CFU/100 ml) in Legionella-positive puddles
Analyzed Legionella positive With CFU/100 ml of:
10–99 100–999 >1,000
2010 Nov 11.4 5 4 (4) 4 (4) 0 0 1.3 ± 0.3
Dec 10.4 5 3 (2) 3 (2) 0 0 1.4 ± 0.3
2011 Jan −0.6 5 4 (4) 1 (1) 3 (3) 0 2.0 ± 0.1
Feb 9.0 6 5 (5) 4 (4) 1 (1) 0 1.6 ± 0.5
Mar 11.5 6 4 (1) 3 (1) 1 (0) 0 1.7 ± 0.5
Apr 15.0 6 1 (0) 0 1 (0) 0 2.4
May 21.2 6 4 (4) 1 (1) 3 (3) 0 1.9 ± 0.4
Jun 32.2 6 2 (2) 1 (1) 1 (1) 0 1.8 ± 0.2
Jul 31.0 6 3 (1) 0 2 (1) 1 (0) 3.2 ± 0.5
Aug 26.2 6 3 (3) 1 (1) 2 (2) 0 2.2 ± 0.5
Sep 18.0 6 0 0 0 0 Not measured
Oct 16.4 6 0 0 0 0 Not measured
Total 69 33 (26) 18 (15) 14 (11) 1 (0)
Open in a new tab

Among the 33 positive samples in which Legionella species were detected, L. pneumophila was detected in 26 samples (78.8%), including 4 samples at mean temperatures of <0°C in January. Thus, L. pneumophila was also frequently detected in samples from puddles regardless of temperature.

Serological distribution of Legionella species.

We isolated 325 colonies from puddles from the 6 sampling locations. According to the serogroup typing, 234 isolates were identified as L. pneumophila strains. The remaining 91 isolates were examined by PCR, resulting in 11 additional L. pneumophila strains. Overall, the most-prevalent species was L. pneumophila (n = 245, 75.4%), whereas other Legionella species accounted for the remaining 24.6% (n = 80). Among the 245 L. pneumophila isolates, SG 1 accounted for 25.3% (n = 62), followed by SG 5 (n = 56, 22.9%), SG 8 (n = 50, 20.4%), and others (SG 2, SG 6, SG 9, SG 3, SG 11, SG 14, and untypeable; n = 77, 31.4%) (Fig. 2A). Among the 80 non-L. pneumophila isolates, 31 were randomly selected, and the species of these isolates were determined by 16S rRNA gene sequencing. L. gresilensis accounted for 71.0% (n = 22), followed by L. longbeachae (n = 6, 19.4%), L. oakridgensis (n = 1, 3.2%), L. sainthelensi (n = 1, 3.2%), and L. waltersii (n = 1, 3.2%) (Fig. 2B).

Fig 2.

Fig 2

Open in a new tab

Distribution of Legionella species from puddles. (A) Frequencies of serogroups among L. pneumophila isolates. (B) Frequencies of Legionella species among non-L. pneumophila isolates identified by 16S rRNA gene sequencing.

Distribution of STs and lag-1 genes.

We analyzed 62 L. pneumophila SG 1 isolates obtained from puddles on asphalt roads in comparison with 73 L. pneumophila SG 1 stock strains from a previous study (22) and 5 isolates obtained from sources other than puddles in this study (Table 1). The 19 (total) clinical isolates from sputum specimens were collected from 4 hospitals in Toyama Prefecture. Among these, 17 isolates were obtained from 17 patients; the remaining 2 isolates were obtained from the same patient but classified into different STs.

Sixty-two L. pneumophila SG 1 isolates from puddles were classified into 36 STs (Tables 1 and 3). Twenty of the 36 STs were identified for the first time in this study. The major STs were ST120 (n = 7, 11.3%) and ST48 (n = 7, 11.3%), followed by ST1204 (n = 4, 6.5%), ST23 (n = 3, 4.8%), and ST507 (n = 3, 4.8%). Twenty-four STs were represented by only a single isolate.

Table 3.

Sequence types of L. pneumophila serogroup 1 isolates obtained from puddles on roads in Toyama Prefecture, Japan

STa No. (%) of isolates No. with indicated result for lag-1
Positive Negative
120 7 (11.3) 7 0
48 7 (11.3) 0 7
1204b 4 (6.5) 0 4
23 3 (4.8) 3 0
507 3 (4.8) 2 1
132 2 (3.2) 1 1
384 2 (3.2) 2 0
808 2 (3.2) 0 2
1186b 2 (3.2) 2 0
1187b 2 (3.2) 2 0
1193b 2 (3.2) 0 2
1198b 2 (3.2) 2 0
Othersc 24 (38.7) 16 8
Total 62 (100) 37 25
Open in a new tab
a

ST, sequence type.

b

The ST was identified for the first time in this study.

c

Fifteen of 24 STs were identified for the first time in this study, and each was presented by only a single isolate.

Puddle isolates of ST120 were detected in samples from locations B (n = 2), C (n = 1), and E (n = 4), and puddle isolates of ST48 in samples from locations A (n = 1), B (n = 1), C (n = 3), and D (n = 2) (Fig. 1). Furthermore, ST120 and ST48 strains were isolated during 4 (November 2010 and February, May, and June 2011) and 3 (November 2010 and January and May 2011) different months, respectively.

PCR amplification showed that 59.7% (37/62) of L. pneumophila SG 1 isolates from puddles harbored the lag-1 gene (Table 3). Among the isolates belonging to ST120 and ST48, which were the major STs of puddle isolates, the lag-1 gene was present in all ST120 isolates (7/7) and was missing in all ST48 isolates (0/7).

Clonal analysis.

Clonal analyses were performed using L. pneumophila isolates obtained from puddles on roads (n = 62), public baths (n = 51), cooling towers (n = 5), showers (n = 3), and patients with legionellosis (n = 19) (Table 4). The puddle isolates formed 2 major CGs, CG1 and CG4, which included 58.1% and 8.1% of puddle isolates, respectively (Table 4). On the other hand, bath isolates formed other CGs, CG2 and CG3, which included 49.0% and 25.5% of bath isolates, respectively.

Table 4.

Distributions of clonal groups from 74 sequence-based typing profiles of L. pneumophila serogroup 1 isolates in Toyama Prefecture, Japana

CG (total no. of STs; no. of isolates) No. (%) of isolates (n = 140) from:
 ST(s) detected in both clinical and environmental isolate(s)b (no. and sources of isolates with ST)
PU PB CT SH PA
CG1 (25; 46) 36 (58.1) 1 (2.0) 0 0 9 (47.4) 120 (7 from PU, 1 from PA), 384 (2 from PU, 3 from PA), 507 (3 from PU, 1 from PA), 132 (2 from PU, 1 from PA)
CG2 (15; 28) 0 25 (49.0) 0 0 3 (15.8) 644 (4 from PB, 1 from PA)
CG3 (7; 19) 0 13 (25.5) 0 1 5 (26.3) 505 (5 from PB, 4 from PA)
CG4 (6; 6) 5 (8.1) 0 0 0 1 (5.3)
CG5 (3; 5) 0 4 (7.8) 0 0 1 (5.3) 138 (1 from PB, 1 from PA)
CG6 (4; 4) 1 (1.6) 3 (5.9) 0 0 0
CG7 (2; 2) 1 (1.6) 1 (2.0) 0 0 0
CG8 (2; 2) 0 2 (3.9) 0 0 0
Singletons (10; 28)b 19 (30.6) 2 (3.9) 5 2 0
Total 62 (100) 51 (100) 5 3 19 (100)
Open in a new tab
a

CG, clonal group; PU, puddle; PB, public bath; CT, cooling tower; SH, shower; PA, patient; ST, sequence type.

b

Singletons include 10 STs that are not grouped into any CGs.

Among the 14 STs of clinical isolates (n = 19), 4 STs (ST120, ST132, ST384, and ST507; n = 6) and 3 STs (ST138, ST505, and ST644; n = 6) were also detected in isolates from puddles and public baths, respectively. The remaining 7 STs (n = 7) were detected in CGs that included environmental isolates, although the same ST was not observed in the environmental isolates. CG1, CG2, CG3, CG4, and CG5 included 7 STs (ST120, ST132, ST353, ST384, ST506, ST507, and ST973), 3 STs (ST2, ST502, and ST644), 2 STs (ST505 and ST682), ST42, and ST138, respectively.

DISCUSSION

We investigated the prevalence of Legionella species isolated from puddles on asphalt roads and the genetic relationships between isolates from sputum specimens and environmental sources. Sixty-two isolates of L. pneumophila SG 1 from puddles were classified into 36 STs by SBT, with ST120 and ST48 being the major STs; strains of these 2 STs were widely distributed in Toyama Prefecture regardless of the season. Although ST48 environmental strains were primarily isolated from soil and partially from cooling towers, as reported previously (27), ST120 environmental strains were not mentioned either in the previous report or in the EWGLI SBT database as of 27 February 2013. On the other hand, ST120 clinical strains were detected in 5.8% of isolates from patients with legionellosis in Japan, although the sources of infection remain unclear as determined by epidemiological investigation (9). It was not described whether isolation of L. pneumophila strains from environmental sources, including water from puddles on roads, was carried out or not in these cases. Our results showed that 1 clinical strain also belonged to ST120. This strain was not associated with bathwater as determined by epidemiological investigation. Furthermore, isolation of L. pneumophila strains from other environmental sources was not carried out. Thus, the source of infection in this case was not clarified. Hicks et al. reported that a 1-cm increase in rainfall was associated with a 2.6% increased risk of legionellosis (28). Furthermore, Fisman et al. identified an association between legionellosis and increased humidity (odds ratio per 1% increase in relative humidity of 1.08, and 95% confidence interval of 1.05 to 1.11) 6 to 10 days before the occurrence of legionellosis cases (29). Therefore, our findings suggest the possibility that patients with legionellosis caused by ST120 strains may have inhaled splashed aerosols from puddles contaminated with this strain. The fact that all ST120 isolates in this study harbored the lag-1 gene, a tentative marker for clinical isolates, supports this hypothesis. Alternatively, patients with legionellosis may be infected indirectly through a puddle route. In this regard, driving an automobile using windshield wiper fluid without added windshield washes that usually contain biocidal agents like propranolol has been reported as a newly identified risk factor for the disease (30), and L. pneumophila strains were actually found in windshield wiper fluid without added windshield washes (31). So, automobiles may be contaminated with L. pneumophila strains originating from puddles due to splashing. To date, Palmer et al. have not reported the STs of the isolates from windshield wiper fluid.

The lag-1 gene was prevalent in puddle isolates (59.7%). Among the L. pneumophila SG 1 isolates in Toyama Prefecture, 100% (17/17) of clinical isolates and 43.1% (22/51) of bath isolates harbored the lag-1 gene (J. Kanatani, J. Isobe, K. Kimata, T. Shima, M. Shimizu, F. Kura, T. Sata, and M. Watahiki, unpublished data). The frequencies of the isolates harboring the lag-1 gene were not significantly different between isolates from puddles and public baths (P > 0.05, χ2 test). In Japan, the number of legionellosis cases peaked in July, the second half of the rainy season (32, 33). To elucidate the possibility that splashed aerosols from puddles on a road, as well as public bath water, are a probable source of legionellosis, we need further investigation of the virulence of these strains by a combination of molecular typing profiles such as SBT, lag-1 allele typing, and monoclonal antibody subgrouping (9).

Among the 14 STs of clinical isolates (n = 19), 4 STs (ST120, ST132, ST384, and ST507; n = 6) were also detected in isolates from puddles on roads, suggesting that 33.3% (6/18) of patients (6/19 of clinical isolates) may be infected directly or indirectly through a puddle route rather than a bath route. As with the case of the ST120 clinical isolate, the infection source of the remaining 5 clinical isolates also remained unclear. For the identification of unrecognized sources of legionellosis, in our opinion, L. pneumophila strains should be isolated from clinical specimens and various environmental sources, including water from puddles on roads, and analyzed by molecular typing methods such as SBT and monoclonal antibody subgrouping (9).

In samples from puddles, L. pneumophila SG 1, SG 5, and SG 8 were frequently detected. In those from soil, among 87 L. pneumophila isolates, SG 1 accounted for 42.5% (n = 37), followed by SG 8 (18.4%, n = 16) and SG 3 (16.1%, n = 14), although SG 5 was not detected (J. Amemura-Maekawa, K. Kikukawa, J. H. Helbig, S. Kaneko, A. Suzuki-Hashimoto, K. Furuhata, B. Chang, M. Murai, M. Ichinose, M. Ohnishi, F. Kura, and the Working Group for Legionella in Japan, unpublished data). Furthermore, 31 of the 36 puddle isolates belonging to CG1 revealed the same or single-, double-, and triple-locus variants of STs derived from soil (group S1 [27]) and 3 of the 5 puddle isolates belonging to CG4 revealed triple-locus variants of STs derived from soil (group S3 [27]). These results showed that the isolates from puddles and soil were genetically and serologically close to each other. However, the only common STs detected in samples from both puddles and soil were ST22 and ST48. To elucidate the habitat segregation of L. pneumophila strains in these environments, further investigation of isolates from puddles and soil is required.

In this study, Legionella species were isolated even at low temperatures. In this regard, Söderberg et al. reported that L. pneumophila strains could survive in tap water at 4°C for about a year, while a gradual decline in the number of CFU was seen (34). Although Legionella species were not detected in puddles during the last 2 months of collection for this study (September and October 2011), 4 of 6 puddles regained positivity for L. pneumophila and/or other Legionella species 2 months later (data not shown). Thus, Legionella species, including L. pneumophila, were distributed in puddles regardless of the season. A previous study in metropolitan Tokyo reported that the isolation rates of L. pneumophila strains from puddles increased with increasing mean temperatures and that L. pneumophila SG 1 strains were the most frequently isolated (20). Because L. pneumophila was frequently detected in samples from puddles, the possibility of contracting legionellosis in daily life should be considered. It may be important to recommend that individuals who are immunocompromised or elderly wear masks to avoid acquiring the disease, especially during the warm rainy season. Among the 5 other Legionella species detected in samples from puddles in this study, to the best of our knowledge, L. longbeachae, L. oakridgensis, and L. sainthelensi have been isolated from patients with pneumonia (35–37) and L. waltersii DNA was identified in a patient with pneumonia (38). Thus, these species may also be important in the etiology of community-acquired pneumonia.

In conclusion, ST120 environmental strains were isolated from puddles on an asphalt road for the first time in this study. Furthermore, 33.3% of patients with legionellosis in Toyama Prefecture, Japan, may be infected directly or indirectly through a puddle route. Our findings by SBT analysis suggest that puddles on asphalt roads serve as potential reservoirs for L. pneumophila in the environment, which could increase potential opportunities for exposure. To identify unrecognized sources of infection in legionellosis cases, we need to isolate L. pneumophila strains from clinical specimens and various environmental sources, including water from puddles on roads, and to analyze these strains by a combination of molecular typing techniques and epidemiological investigation.

ACKNOWLEDGMENTS

We thank Norman K. Fly (Respiratory and Systemic Infection Laboratory, Health Protection Agency) for assigning the newly identified alleles and STs. We also thank the physicians and laboratory personnel in the following institutions for providing the clinical isolates: Kouseiren Takaoka Hospital, Takaoka City Hospital, Tonami General Hospital, and Toyama University Hospital.

This work was supported by a Health and Labor Sciences Research grant (number H22-kenki-014 to F.K.) from the Ministry of Health, Labour and Welfare.

Footnotes

Published ahead of print 19 April 2013

REFERENCES

  • 1. Fraser DW, Tsai TR, Orenstein W, Parkin WE, Beecham HJ, Sharrar RG, Harris J, Mallison GF, Martin SM, McDade JE, Shepard CC, Brachman PS, the Field Investigation Team 1977. Legionnaires' disease. Description of an epidemic of pneumonia. N. Engl. J. Med. 297:1189–1197 [DOI] [PubMed] [Google Scholar]
  • 2. Cordes LG, Wiesenthal AM, Gorman GW, Phair JP, Sommers HM, Brown A, Yu VL, Magnussen MH, Meyer RD, Wolf JS, Shands KN, Fraser DW. 1981. Isolation of Legionella pneumophila from hospital shower heads. Ann. Intern. Med. 94:195–197 [DOI] [PubMed] [Google Scholar]
  • 3. Hlady WG, Mullen RC, Mintz CS, Shelton BG, Hopkins RS, Daikos GL. 1993. Outbreak of Legionnaire's disease linked to a decorative fountain by molecular epidemiology. Am. J. Epidemiol. 138:555–562 [DOI] [PubMed] [Google Scholar]
  • 4. Ito I, Naito J, Kadowaki S, Mishima M, Ishida T, Hongo T, Ma L, Ishii Y, Matsumoto T, Yamaguchi K. 2002. Hot spring bath and Legionella pneumonia: an association confirmed by genomic identification. Intern. Med. 41:859–863 [DOI] [PubMed] [Google Scholar]
  • 5. Keller DW, Hajjeh R, DeMaria A, Fields BS, Pruckler JM, Benson RS, Kludt PE, Lett Mermel SMLA, Giorgio C, Breiman RF. 1996. Community outbreak of Legionnaires' disease: an investigation confirming the potential for cooling towers to transmit Legionella species. Clin. Infect. Dis. 22:257–261 [DOI] [PubMed] [Google Scholar]
  • 6. Arnow PM, Chou T, Weil D, Shapiro EN, Kretzschmar C. 1982. Nosocomial Legionnaires' disease caused by aerosolized tap water from respiratory devices. J. Infect. Dis. 146:460–467 [DOI] [PubMed] [Google Scholar]
  • 7. Euzeby JP. 2013. List of prokaryotic names with standing in nomenclature—genus Legionella. http://www.bacterio.cict.fr/l/legionella.html Accessed 27 February 2013
  • 8. Yu VL, Plouffe JF, Pastoris MC, Stout JE, Schousboe M, Widmer A, Summersgill J, File T, Heath CM, Paterson DL, Chereshsky A. 2002. Distribution of Legionella species and serogroups isolated by culture in patients with sporadic community-acquired legionellosis: an international collaborative survey. J. Infect. Dis. 186:127–128 [DOI] [PubMed] [Google Scholar]
  • 9. Amemura-Maekawa J, Kura F, Helbig JH, Chang B, Kaneko A, Watanabe Y, Isobe J, Nukina M, Nakajima H, Kawano K, Tada Y, Watanabe H, the Working Group for Legionella in Japan 2010. Characterization of Legionella pneumophila isolates from patients in Japan according to serogroups, monoclonal antibody subgroups and sequence types. J. Med. Microbiol. 59:653–659 [DOI] [PubMed] [Google Scholar]
  • 10. Kozak NA, Benson RF, Brown E, Alexander NT, Taylor TH, Jr, Shelton BG, Fields BS. 2009. Distribution of lag-1 alleles and sequence-based types among Legionella pneumophila serogroup 1 clinical and environmental isolates in the United States. J. Clin. Microbiol. 47:2525–2535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Gaia V, Fly NK, Afshar B, Lück PC, Meugnier H, Etienne J, Peduzzi R, Harrison TG. 2005. Consensus sequence-based scheme for epidemiological typing of clinical and environmental isolates of Legionella pneumophila. J. Clin. Microbiol. 43:2047–2052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Ratzow S, Gaia V, Helbig JH, Fly NK, Lück PC. 2007. Addition of neuA, the gene encoding N-acylneuraminate cytidylyl transferase, increases the discriminatory ability of the consensus sequence-based scheme for typing Legionella pneumophila serogroup 1 strains. J. Clin. Microbiol. 45:1965–1968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Farhat C, Mentasti M, Jacobs E, Fry NK, Lück C. 2011. The N-acylneuraminate cytidyltransferase gene, neuA, is heterogenous in Legionella pneumophila strains but can be used as a marker for epidemiological typing in the consensus sequence-based typing scheme. J. Clin. Microbiol. 49:4052–4058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Coscollá M, Fenollar J, Escribano I, González-Candelas F. 2010. Legionellosis outbreak associated with asphalt paving machine, Spain, 2009. Emerg. Infect. Dis. 16:1381–1387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. O'Loughlin RE, Kightlinger L, Werpy MC, Brown E, Stevens V, Hepper C, Keane T, Benson RF, Fields BS, Moore MR. 2007. Restaurant outbreak of Legionnaires' disease associated with a decorative fountain: an environmental and case-control study. BMC Infect. Dis. 7:93. 10.1186/1471-2334-7-93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Scaturro M, Losardo M, De Ponte G, Ricci ML. 2005. Comparison of three molecular methods used for subtyping of Legionella pneumophila strains isolated during an epidemic of legionellosis in Rome. J. Clin. Microbiol. 43:5348–5350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. National Institute of Infectious Diseases and Tuberculosis and Infectious Diseases Control Division, Ministry of Health, Labour and Welfare 2000. Legionellosis, April 1999-July 2000. Infect. Agents Surveill. Rep. 21:186–187 http://idsc.nih.go.jp/iasr/21/247/tpc247.html Accessed 27 February 2013 [Google Scholar]
  • 18. Kuroki T, Ishihara T, Ito K, Kura F. 2009. Bathwater-associated cases of legionellosis in Japan, with a special focus on Legionella concentrations in water. Jpn. J. Infect. Dis. 62:201–205 [PubMed] [Google Scholar]
  • 19. Okada M, Kawano K, Kura F, Amemura-Maekawa J, Watanabe H, Yagita K, Endo T, Suzuki S. 2005. The largest outbreak of legionellosis in Japan associated with spa baths: epidemic curve and environmental investigation. Kansenshogaku Zasshi 79:365–374 (In Japanese.) [DOI] [PubMed] [Google Scholar]
  • 20. Sakamoto R, Ohno A, Nakahara T, Satomura K, Iwanaga S, Kouyama Y, Kura F, Kato N, Matsubayashi K, Okumiya K, Yamaguchi K. 2009. Legionella pneumophila in rainwater on roads. Emerg. Infect. Dis. 15:1295–1297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Sakamoto R, Ohno A, Nakahara T, Satomura K, Iwanaga S, Kouyama Y, Kura F, Noami M, Kusaka K, Funato T, Takeda M, Matsubayashi K, Okumiya K, Kato N, Yamaguchi K. 2009. Is driving a car a risk for Legionnaires' disease? Epidemiol. Infect. 137:1615–1622 [DOI] [PubMed] [Google Scholar]
  • 22. Kanatani J, Isobe J, Kimata K, Shima T, Shimizu M, Kura F, Sata T, Watahiki M. 27 December 2012. Molecular epidemiology of Legionella pneumophila serogroup 1 isolates identify a prevalent sequence type, ST505, and a distinct clonal group of clinical isolates in Toyama prefecture, Japan. J. Infect. Chemother. [Epub ahead of print.] 10.1007/s10156-012-0537-x [DOI] [PubMed] [Google Scholar]
  • 23. Morimoto Y. 2010. Usefulness of selection of Legionella by colony appearance. Japanese J. Environ. Infect. 25:8–14 (In Japanese.) [Google Scholar]
  • 24. Yamamoto H. 1992. Detection and identification of Legionella species by PCR. Nihon Rinsho 50:394–399 (In Japanese.) [PubMed] [Google Scholar]
  • 25. Mahbubani MH, Bej AK, Miller R, Haff L, DiCesare J, Atlas RM. 1990. Detection of Legionella with polymerase chain reaction and gene probe methods. Mol. Cell. Probes 4:175–187 [DOI] [PubMed] [Google Scholar]
  • 26. Tanaka D, Isobe J, Watahiki M, Nagai Y, Katsukawa C, Kawahara R, Endoh M, Okuno R, Kumagai N, Matsumoto M, Morioka Y, Ikebe T, Watanabe H, the Working Group for Group A Streptococci in Japan 2008. Genetic features of clinical isolates of Streptococcus dysgalactiae subsp. equisimilis possessing Lancefield's group A antigen. J. Clin. Microbiol. 46:1526–1529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Amemura-Maekawa J, Kikukawa K, Helbig JH, Kaneko S, Suzuki-Hashimoto A, Furuhata K, Chang B, Murai M, Ichinose M, Ohnishi M, Kura F, the Working Group for Legionella in Japan 2012. Distribution of monoclonal antibody subgroups and sequence-based types among Legionella pneumophila serogroup 1 isolates derived from cooling tower water, bath water and soil in Japan. Appl. Environ. Microbiol. 78:4263–4270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Hicks LA, Rose CE, Jr, Fields BS, Drees ML, Engel JP, Jenkins PR, Rouse BS, Blythe D, Khalifah AP, Feikin DR, Whitney CG. 2007. Increased rainfall is associated with increased risk for legionellosis. Epidemiol. Infect. 135:811–817 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Fisman DN, Lim S, Wellenius GA, Johnson C, Britz P, Gaskins M, Maher J, Mittleman MA, Spain CV, Haas CN, Newbern C. 2005. It's not the heat, it's the humidity: wet weather increases legionellosis risk in the greater Philadelphia metropolitan area. J. Infect. Dis. 192:2066–2073 [DOI] [PubMed] [Google Scholar]
  • 30. Wallensten A, Oliver I, Ricketts K, Kafatos G, Stuart JM, Joseph C. 2010. Windscreen wiper fluid without added screenwash in motor vehicles: a newly identified risk factor for Legionnaires' disease. Eur. J. Epidemiol. 25:661–665 [DOI] [PubMed] [Google Scholar]
  • 31. Palmer ME, Longmaid K, Lamph D, Willis C, Heaslip V, Khattab A. 2012. Legionella pneumophila found in windscreen washer fluid without added screenwash. Eur. J. Epidemiol. 27:667. [DOI] [PubMed] [Google Scholar]
  • 32. National Institute of Infectious Diseases and Tuberculosis and Infectious Diseases Control Division, Ministry of Health, Labour and Welfare 2008. Legionellosis, January 2003-September 2008, Japan. Infect. Agents Surveill. Rep. 29:327–328 http://idsc.nih.go.jp/iasr/29/346/tpc346.html Accessed 27 February 2013 [Google Scholar]
  • 33. Ozeki Y, Yamada F, Saito A, Kishimoto T, Tanno S, Nakamura Y. 2012. Seasonal patterns of legionellosis in Saitama, 2005-2009. Jpn. J. Infect. Dis. 65:330–333 [PubMed] [Google Scholar]
  • 34. Söderberg MA, Dao J, Starkenburg SR, Cianciotto NP. 2008. Importance of type II secretion for survival of Legionella pneumophila in tap water and in amoebae at low temperatures. Appl. Environ. Microbiol. 74:5583–5588 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Benson RF, Thacker WL, Fang FC, Kanter B, Mayberry WR, Brenner DJ. 1990. Legionella sainthelensi serogroup 2 isolated from patients with pneumonia. Res. Microbiol. 141:453–463 [DOI] [PubMed] [Google Scholar]
  • 36. Lo Presti F, Riffard S, Jarraud S, Le Gallou F, Richet H, Vandenesch F, Etienne J. 2000. Isolation of Legionella oakridgensis from two patients with pleural effusion living in the same geographical area. J. Clin. Microbiol. 38:3128–3130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. McKinney RM, Porschen RK, Edelstein PH, Bissett ML, Harris PP, Bondell SP, Steigerwalt AG, Weaver RE, Ein ME, Lindquist DS, Kops RS, Brenner DJ. 1981. Legionella longbeachae species nova, another etiologic agent of human pneumonia. Ann. Intern. Med. 94:739–743 [DOI] [PubMed] [Google Scholar]
  • 38. König C, Hebestreit H, Valenza G, Abele-Horn M, Speer CP. 2005. Legionella waltersii—a novel cause of pneumonia? Acta Paediatr. 94:1505–1507 [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES