Abstract
Botulinum neurotoxins (BoNTs) are produced by phenotypically and genetically different Clostridium species, including Clostridium botulinum and some strains of Clostridium baratii (serotype F) and Clostridium butyricum (serotype E). BoNT-producing clostridia responsible for human botulism encompass strains of group I (secreting proteases, producing toxin serotype A, B, or F, and growing optimally at 37°C) and group II (nonproteolytic, producing toxin serotype E, B, or F, and growing optimally at 30°C). Here we report the development of real-time PCR assays for genotyping C. botulinum strains of groups I and II based on flaVR (variable region sequence of flaA) sequences and the flaB gene. Real-time PCR typing of regions flaVR1 to flaVR10 and flaB was optimized and validated with 62 historical and Canadian C. botulinum strains that had been previously typed. Analysis of 210 isolates of European origin allowed the identification of four new C. botulinum flaVR types (flaVR11 to flaVR14) and one new flaVR type specific to C. butyricum type E (flaVR15). The genetic diversity of the flaVR among C. botulinum strains investigated in the present study reveals the clustering of flaVR types into 5 major subgroups. Subgroups 1, 3, and 4 contain proteolytic Clostridium botulinum, subgroup 2 is made up of nonproteolytic C. botulinum only, and subgroup 5 is specific to C. butyricum type E. The genetic variability of the flagellin genes carried by C. botulinum and the possible association of flaVR types with certain geographical areas make gene profiling of flaVR and flaB promising in molecular surveillance and epidemiology of C. botulinum.
INTRODUCTION
Clostridium botulinum is the etiological agent of botulism, a disease characterized by a descending symmetrical flaccid paralysis. Food-borne botulism develops after consumption of contaminated foods containing botulinum neurotoxin (BoNT) (1, 2). Nonetheless, there are other forms of botulism in which C. botulinum produces toxin in vivo, including infant botulism, adult intestinal colonization botulism, and wound botulism.
C. botulinum is a taxonomic designation for Gram-positive, spore-forming, anaerobic bacteria that encompasses most organisms that produce BoNT but that are otherwise unrelated genetically. Physiological traits, biochemical tests, and toxin serotyping based on the mouse bioassay are used to divide strains among major groups. Group I strains secrete proteases, produce toxin serotypes A, B, or F, and grow optimally at 37°C, whereas group II strains are nonproteolytic, produce toxin serotype E, B, or F, and grow optimally at 30°C. While these two groups are associated with botulism in humans, animals are affected by toxin serotypes C and D, and mosaic forms of these two serotypes (produced by group III strains). Other clostridial species can produce BoNT, i.e., C. baratii (serotype F), C. butyricum (serotype E), and C. argentinense (serotype G; formerly known as C. botulinum group IV).
Although physiological traits, biochemical tests, and toxin serotyping are still used to characterize C. botulinum strains, this information does not possess the discrimination required for source attribution and epidemiological investigations. Other methods were developed to this end, e.g., randomly amplified polymorphic DNA analysis, amplified rRNA gene restriction analysis, pulsed-field gel electrophoresis (PFGE), amplified fragment length polymorphism, single locus and multilocus sequence typing, and multilocus variable-number tandem repeat analysis (MLVA) (3–7). Real-time PCR-based approaches for identification of neurotoxin genes have also been developed (8–13). Real-time PCR allows rapid, simple detection and typing. This approach can be expanded by inclusion of new target sequences to make typing methods more discriminatory.
Flagellin subunits are composed of conserved C- and N-terminus domains bracketing a variable domain (14). During assembly, monomers bury their termini toward the central channel of the filament, leaving the variable domains exposed to the surface. Flagellin genes and their products have been used in genotypic and phenotypic typing methods for food-borne pathogens (15). Utilizing flagellin variable region (flaVR) sequences, Paul et al. (5) classified 80 historical and Canadian C. botulinum strains into 10 flaVR types and identified flaB, a putatively type E-specific flagellin gene. Here, we present the development of real-time PCR assays for typing C. botulinum groups I and II using flaVR sequences and flaB. Specific identification of bont/A, bont/B, bont/E, and bont/F by previously developed PCR assays (8) was used as a control. A PCR assay targeting fldB was employed as a marker for proteolytic clostridia (16). The assays were first tested using a panel of 62 C. botulinum strains as reference and characterized as described by Paul et al. (5) before being extended to 210 isolates of European origin. We report the finding of four new C. botulinum flaVR types and one new flaVR type specific to C. butyricum type E.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
C. botulinum strains used as references (n = 62) were stored on Microbank beads (Pro-Lab Diagnostics, Richmond Hill, Canada) at −86°C and archived at the Botulism Reference Service for Canada. Spores were inoculated onto McClung-Toabe 1.5% agar (Difco, Tucker, GA) with 5% egg yolk and 0.5% yeast extract (MTEYE) and allowed to grow for approximately 72 h at 35°C (group I) or at room temperature (group II) in an atmosphere of 10% H2, 10% CO2 and 80% N2. Single colonies were transferred into SPGY broth containing (wt/vol) 5% special peptone (Oxoid Inc., Basingstoke, United Kingdom), 0.5% peptone, 2% yeast extract, 0.4% glucose (Difco), and 0.1% sodium thioglycolate (Sigma-Aldrich, St. Louis, MO) adjusted to pH 7.2 using HCl. Broth cultures were grown for 24 h at 35°C (group I) or 48 h at room temperature (group II). C. botulinum strains native to Europe (n = 210) investigated in this study were cultivated in TPGY medium under anaerobic conditions as described previously (10). Ten C. botulinum strains of types C, C-D, D, D-C, and G were included in the panel of C. botulinum strains. Eighteen strains of other clostridial species were used as non-BoNT-producing negative controls (C. butyricum, C. baratii, C. beijerinckii, C. bifermentans, C. chauvoei, C. difficile, C. mangenotii, C. oedematiens, C. perfringens type A, C, D, and E, C. septicum, C. sordellii, C. sporogenes, C. subterminale, and C. tetani). Eighteen strains of other bacterial species were also analyzed as non-Clostridium negative controls (B. cereus, B. thuringiensis, Citrobacter sp., Escherichia coli, Hafnia alvei, Klebsiella pneumoniae, Listeria monocytogenes, Proteus sp., Pseudomonas sp., Salmonella enterica serovar Virchow, S. enterica serovar Hadar, S. enterica serovar Enteritidis, S. enterica serovar Infantis, S. enterica serovar Typhimurium, Shigella sp., Staphylococcus aureus, Streptococcus faecalis, and Yersinia enterocolitica).
Genomic DNA isolation.
The DNA of the 62 C. botulinum reference strains encompassing the original 10 flaVR types was isolated as described previously (17) or using a QIAamp minikit (Qiagen, Hilden, Germany). The DNA of the 210 C. botulinum strains native to Italy, France, Germany, and the Netherlands was extracted using the following protocols and apparatus: phenol-chloroform extraction (18), a DNeasy blood and tissue kit (Qiagen, Hilden, Germany), Chelex 100 (Bio-Rad Life Science Research, Hercules, CA), and a Microlab Starlet (Hamilton, NV) automatic system employing a MegMax total nucleic acid isolation kit (Ambion, Austin, TX), according to the manufacturer's instructions for Gram-positive bacteria. DNA samples were stored at −20°C until high-throughput real-time PCR analysis.
High-throughput real-time PCR.
A LightCycler 1536 (Roche, Meylan, France) was used to perform high-throughput real-time PCR amplifications. For the PCR setup of the LightCycler 1536 multiwell plates, a Bravo liquid dispenser automat (Agilent Technologies, Massy, France) equipped with a chiller, and a PlateLoc thermal microplate sealer (Agilent Technologies) was used. The PCR mixtures contained 1 μl DNA sample and 1 μl master mix containing 1× RealTime ready DNA probe master mix (Roche), a 300 nM concentration of each primer, and a 300 nM concentration of each probe. Amplifications were performed using HEX-labeled TaqMan probes. The following thermal profile was used for PCR: 95°C for 1 min followed by 30 cycles of 95°C for 0 s and 55°C for 30 s. Primers and probes used for PCR amplifications are listed in Table 1. Oligonucleotides used for determining the flaVR type were derived from the flaA (accession numbers DQ844946 to DQ845031) and flaB (DQ658239) sequences. Oligonucleotides targeting fldB were designed to differentiate group I and group II C. botulinum strains (16). Specific oligonucleotides for typing bont/A, bont/B, bont/E, and bont/F were described previously (8). Primers and probes were purchased from Sigma-Aldrich (St. Quentin Fallavier, France) and Eurofins MWG Operon (Courtaboeuf, France).
Table 1.
Primers and probes
| Primer or probea | Sequence (5′ → 3′)b | Amplicon size (bp) |
|---|---|---|
| FlaVR-1-F | CGCTGCTAATGTAACAAA | 101 |
| FlaVR-1-R | GCTCTAATCTGTTTTGGTTA | |
| FlaVR-1-P | CTGAATTAATAGCATTATCTATTGTCGCT | |
| FlaVR-2-F | CTGCTGCTAATATAACAAA | 102 |
| FlaVR-2-R | GTTCTAATCTGTTTTGGTTA | |
| FlaVR-2-P | AGCAACAATAGATTCAGCTATTAATTCAG | |
| FlaVR-3-F | AAGACCAAGTTATGGAGTTA | 106 |
| FlaVR-3-R | ATTCCTGATATTGACTTAGC | |
| FlaVR-3-P | CCTTTTCCACTTCCTATATTTATACTTCC | |
| FlaVR-4-F | GCTGCTTCAATATCAGGC | 98 |
| FlaVR-4-R | TCTAATCTGTTTTGATTAGCTCC | |
| FlaVR-4-P | ACTGTATCAGCAGAAAGAGCCAAGCT | |
| FlaVR-5-F | AATAGGAGCAAATAGTGGA | 96 |
| FlaVR-5-R | CTTCCTATTGTAACTTTATCAC | |
| FlaVR-5-P | CAACACCTAATGCAGCAACATC | |
| FlaVR-6-F | GAAGCAGACTTAACTTTAGATA | 87 |
| FlaVR-6-R | ATCAGCAACACTTACACTT | |
| FlaVR-6-P | TGCTCCTGAACTCATGCTTCC | |
| FlaVR-7-F | GATACTGCATTAACTTTAGAAG | 101 |
| FlaVR-7-R | GTAGCATCTGCATTAGTTC | |
| FlaVR-7-P | TGGATTCAACAGCATTAACAATTACAG | |
| FlaVR-8-F | GATTTAGCGCAAAAACATT | 114 |
| FlaVR-8-R | CAGTACTAACTGAAACTCCT | |
| FlaVR-8-P | TGCTGACATATCTCCAATTGTTAATGT | |
| FlaVR-9-F | AATGAGAGAACTAGCTGTAC | 80 |
| FlaVR-9-R | CAGTAATTTCTGTTTTTATAGCTTC | |
| FlaVR-9-P | AGGAACTAACGATACAAACGTTACTGCA | |
| FlaVR-10-F | AAGAAACTCACAAGATTCG | 153 |
| FlaVR-10-R | ATTTCTGTTTTTATAGCGGC | |
| FlaVR-10-P | TCTGTTAGTGCTCCTTCTGCTGT | |
| FlaVR-11-F | GTTCTGCAAAAAGTATGATG | 126 |
| FlaVR-11-R | CTTTTACTCCACTTCCTATG | |
| FlaVR-11-P | CAAGCTATTAAGCTAACTATAGGAGCT | |
| FlaVR-12-F | GAAATATGGGAATCAACACTAC | 110 |
| FlaVR-12-R | TTCAGAAATTGCTAGTCCAG | |
| FlaVR-12-P | AGCTTAATTTTTCCATAGCTTTTCCAGA | |
| FlaVR-13-F | ACAACAAATGTAAGTGTTGC | 114 |
| FlaVR-13-R | gTTTTGGAAAGCACCAAG | |
| FlaVR-13-P | AGCTTTAGATGTTGCATTATCAGCAACAC | |
| FlaVR-14-F | AAGCATAACTTCAACAAGCG | 124 |
| FlaVR-14-R | GTTTTGGAAAGCACCAAG | |
| FlaVR-14-P | ACGCTGCATTATCAACAACACTTACGC | |
| FlaVR-15-F | CAGCAGGTCTATGTATATCGG | 112 |
| FlaVR-15-R | GTTGAGCTTTCTATAGTTTGAAAC | |
| FlaVR-15-P | ATCCATCTTGAGTATTCGTGCTTGCTT | |
| FlaB-F | ggAAACAGAGCTGGAGATG | 81 |
| FlaB-R | gGAAGCTTGRTCTAATCCTC | |
| FlaB-P | TCTGAGATTGCAAGACCTGCTGC | |
| FldB-F | CTAGTATCATATTGTGCTTCTGAG | 98 |
| FldB-R | GGAAGAAGATTAGAAAAGGAGAC | |
| FldB-P | AATTTCTTGGGTCTGCTTGATCCCC | |
| Sequencing primers | ||
| FlaB_seq-F1 | gCAGTTAATTCAGGAAAGAGC | |
| FlaB_seq-F2 | AGGGAAATGCAGATGTTAAAG | |
| FlaB_seq-F3 | ACTGCAGTAGCTAATGTAGATG | |
| FlaB_seq-F4 | TGTTGAAAATGCATTAGATGTAAG | |
| FlaB_seq-R1 | TGAAGAACTCCTTGTGGTTG | |
| FlaB_seq-R2 | gCTTACATCTAATGCATTTTCAAC | |
| FlaB_seq-R3 | TCATCTACATTAGCTACTGCAG | |
| FlaB_seq-R4 | GCTTTAACATCTGCATTTCCC | |
| FlaA_butyr-seq-F1 | gTAATATATCATCATTAGCGAGTTG | |
| FlaA_butyr-seq-F2 | ACTAATACCAATGATGATAGAAAGC | |
| FlaA_butyr-seq-R1 | gACTAATTTTAAAACATACTCCGG | |
| FlaA_butyr-seq-R2 | CTTGATGAAATTTCATCAATTGCC |
F, forward (primer); R, reverse (primer); P, probe.
All probes were labeled with 6-HEX and BHQ1 (Black Hole Quencher). Lowercase indicates nucleotides not present in the original gene sequence added to increase primers annealing temperature.
Flagellin DNA locus sequencing.
Double-stranded DNA sequencing of flagellin genes was performed according to a previously published method (5) by Eurofins MWG Operon (Courtaboeuf, France). Primers used for DNA sequencing of flaA and flaB are listed in Table 1.
Phylogenetic analysis.
Phylogenetic analysis of the flagellin genes is shown in Fig. 1. The dendrogram comparing the flagellin gene sequences used was obtained using the unweighted pair group method with arithmetic averages (UPGMA) with default settings.
Fig 1.
Clustering of flaVR types.
Nucleotide sequence accession numbers.
New sequences of C. botulinum flagellin genes were deposited in GenBank with accession numbers KC235357 to KC235394 and KC407595 to KC407603.
RESULTS
Molecular characterization of reference C. botulinum strains.
A panel of 62 strains of C. botulinum was characterized for their flagellin genes as previously reported (5). These strains were also characterized by high-throughput real-time PCR for flaVR1 to flaVR10, flaB, bont/A, bont/B, bont/E, bont/F, and fldB (Table 2). The expected results of bont subtypes and detection of the proteolytic strain-specific gene fldB were confirmed, with the exception of 3 strains previously serotyped as type A. The latter were identified by PCR as type AB and found to carry a silent BoNT/B gene. The flaVR1 to flaVR10 genotype determined by real-time PCR corroborated the results obtained by sequencing of flaA and previous flaVR classification (5). Likewise, C. botulinum type E strain Bennett was shown to carry both flaVR8 and flaB sequences as previously reported (5). Interestingly, flaB was observed not only in 3 other flaVR8 strains but also in 15 flaVR10 strains. The flaB sequences detected in isolates positive for flaVR8 were sequenced (GenBank accession numbers KC407601 to KC407603). It is noteworthy that all flaB-positive strains were reported as group II C. botulinum type E and that C. botulinum type B strains belonging to the group II tested all negative for flaB.
Table 2.
Molecular characterization of 62 reference strains
| Strain | Origina | BoNT serotype (15) | bont type (5)b | flaVR type (15) | PCR flaVR type (this study) | Clostridium botulinum group | fldB (this study) |
|---|---|---|---|---|---|---|---|
| 62A | NA | A | A | 1 | 1 | I | + |
| A6 | NA | A | A | 1 | 1 | I | + |
| CK2-A | Feces | A | A | 1 | 1 | I | + |
| FE0101AJO | Feces | A | A | 1 | 1 | I | + |
| GA0101AJO | Gastric liquid | A | A | 1 | 1 | I | + |
| NG0107ASA | Gastric liquid | A | A | 1 | 1 | I | + |
| F9801-A | Feces | A | A | 1 | 1 | I | + |
| FE0205A1AK | Feces | A | A | 1 | 1 | I | + |
| INWB2202A2 | Seal intestine | A | A | 1 | 1 | I | + |
| PC0101AJO | Pork | A | A | 1 | 1 | I | + |
| SO300A1 | Soil | A | A | 1 | 1 | I | + |
| 1344-1-77 | Feces | B | B | 1 | 1 | I | + |
| 1366-1-77 | Honey | B | B | 1 | 1 | I | + |
| 368B | Feces | B | B | 1 | 1 | I | + |
| 426B | Honey | B | B | 1 | 1 | I | + |
| 427-2-76 | Honey | B | B | 1 | 1 | I | + |
| 920A-2-76 | Feces | B | B | 1 | 1 | I | + |
| GA0108BEC | Gastric liquid | B | B | 1 | 1 | I | + |
| FE9504ACG | Feces | AB | A, B | 1 | 1 | I | + |
| FE0207AMB | Feces | A | A, B | 1 | 1 | I | + |
| F9604-A | Feces | A | A | 2 | 2 | I | + |
| FE9508BPD | Feces | B | B | 2 | 2 | I | + |
| FE9508BRB | Feces | B | B | 2 | 2 | I | + |
| PA9508B | Pate | B | B | 2 | 2 | I | + |
| FE0303A1YO | Feces | A | A, B | 3 | 3 | I | + |
| FE9909ACS-Alberta | Feces | A | A, B | 3 | 3 | I | + |
| NCTC2916 | Canned corn | AB | A, B | 3 | 3 | I | + |
| Langeland | Liver paste | F | F | 3 | 3 | I | + |
| FE9904BMT | Feces | B | B | 4 | 4 | I | + |
| 17A | NA | A | A | 5 | 5 | I | + |
| 1B1-B | Feces | B | B | 6 | 6 | I | + |
| MRB | Mushrooms | B | B | 6 | 6 | I | + |
| EN0509BLP | Dust | B | B | 7 | 7 | I | + |
| FE0507BLP | Feces | B | B | 7 | 7 | I | + |
| Bennett | Gastric liquid | E | E | 8 | 8 and flaB | II | − |
| SO329E1 | Shoreline soil | E | E | 8 | 8 and flaBc | II | − |
| SP455/456E2 | Coastal rock | E | E | 8 | 8 and flaBd | II | − |
| SOKR 38E2 | Shoreline soil | E | E | 8 | 8 and flaBe | II | − |
| 17B | Marine sediment | B | B | 9 | 9 | II | − |
| 19501F | Marine sediment | F | F | 9 | 9 | II | − |
| 70F | Marine sediment | F | F | 9 | 9 | II | − |
| 205F | Marine sediment | F | F | 9 | 9 | II | − |
| KAP-B-3 | Kapchunka | B | B | 9 | 9 | II | − |
| KAP-B-8 | Kapchunka | B | B | 9 | 9 | II | − |
| 190F | Marine sediment | F | F | 9 | 9 | II | − |
| II60-15B | Feces | B | B | 9 | 9 | II | − |
| 610F | Salmon | F | F | 9 | 9 | II | − |
| Gordon | Clinical sample | E | E | 10 | 10 and flaB | II | − |
| F9508EPB | Feces | E | E | 10 | 10 and flaB | II | − |
| FE0005EJT | Feces | E | E | 10 | 10 and flaB | II | − |
| FE9507EEA | Feces | E | E | 10 | 10 and flaB | II | − |
| FE9709EBB | Feces | E | E | 10 | 10 and flaB | II | − |
| FE9909ERG | Feces | E | E | 10 | 10 and flaB | II | − |
| GA9709EHS | Gastric liquid | E | E | 10 | 10 and flaB | II | − |
| GA9709EJA | Gastric liquid | E | E | 10 | 10 and flaB | II | − |
| MU0005EJT | Muktuk | E | E | 10 | 10 and flaB | II | − |
| GA9709ENS | Gastric liquid | E | E | 10 | 10 and flaB | II | − |
| MI9507E | Misiraq | E | E | 10 | 10 and flaB | II | − |
| SO326E1 | Shoreline soil | E | E | 10 | 10 and flaB | II | − |
| SOKR-23E1 | River sediment | E | E | 10 | 10 and flaB | II | − |
| SOKR-29E1 | Shoreline soil | E | E | 10 | 10 and flaB | II | − |
| FE9709ELB | Feces | E | E | 10 | 10 and flaB | II | − |
Molecular characterization of 210 C. botulinum strains isolated in European countries.
A collection of 210 C. botulinum strains native to Italy (n = 196), Germany (n = 7), France (n = 5), and the Netherlands (n = 3) was typed, using high-throughput real-time PCR, based on flaVR1 to flaVR10 sequences in flaA and bont type. The same approach was used to determine the presence of flaB and fldB. Among the 210 strains investigated in this study, 167 were subtyped based on flaVR sequences as described previously (Table 3). Four C. botulinum type E strains derived from France, Germany, and the Netherlands tested positive for flaB. Of the 210 isolates, 43 were not typeable based on flaVR and flaB, despite having their BoNT type determined by real-time PCR. Double-strand sequencing of flaA of 38 of these isolates revealed new flaVR types, which we named flaVR11 to flaVR14 (Table 4). Six Clostridium butyricum type E strains failed to be sequenced (5). Based on the sequence of flaA of C. butyricum type E strains BL5262 and 5521, new sequencing primers and a flaVR15 real-time PCR assay were designed. The 6 strains gave a specific positive signal for flaVR15 and were successfully sequenced (GenBank accession numbers KC407595 to KC407600).
Table 3.
Search for flaVR1 to flaVR10 and fldB in C. botulinum strains isolated in Europe
| Strain(s)a | Originb | BoNT serotype (15) | bont type (5) | flaVR type (this study) | fldB (this study) |
|---|---|---|---|---|---|
| IP64c, IP910c, IP969c, BfR7272d, RIVM2e | NA | A | A | 1 | + |
| ISS29, ISS103, ISS186, ISS260 | Feces | A | A | 1 | + |
| ISS345 | Canned spinach | A | A | 1 | + |
| ISS30 | Sauerkraut | A | A | 2 | + |
| ISS117, ISS137, ISS138 | Feces | A | A | 3 | + |
| ISS280, ISS289, ISS292, ISS300, ISS301, ISS303, ISS312, ISS313, ISS317, ISS318, ISS326, ISS327, ISS328, ISS329, ISS330, ISS348 | Honey | A | A | 3 | + |
| ISS334, ISS391, ISS420, ISS451 | Feces | A | A | 3 | + |
| ISS452 | Mushroom in oil | A | A | 3 | + |
| ISS22 | Mushroom in oil | A | A | 5 | + |
| ISS104 | Feces | A | A | 5 | + |
| ISS126 | Ribollita toscana | A | A | 5 | + |
| ISS127 | Honey | A | A | 5 | + |
| ISS129 | Feces | A | A | 5 | + |
| ISS130 | Feces | A2 | A | 5 | + |
| ISS270 | Feces | A | A | 5 | + |
| ISS362, ISS363 | Honey | A | A | 5 | + |
| ISS364 | Homogenized meat | A | A | 5 | + |
| ISS365, ISS390, ISS392 | Feces | A | A | 5 | + |
| ISS395 | Foal gastric content | A | A | 5 | + |
| ISS464 | Sea salt | A | A | 5 | + |
| ISS31, ISS264, ISS380, ISS382, ISS413 | Feces | B | B | 1 | + |
| ISS268 | Canned tuna | B | B | 3 | + |
| ISS173, ISS269, ISS277, ISS304, ISS305, ISS344, ISS361, ISS376, ISS385, ISS393, ISS403, ISS404, ISS414, ISS421, ISS441, ISS442 | Feces | B | B | 3 | + |
| ISS311 | Turnip tops | B | B | 3 | + |
| ISS347 | Mushrooms | B | B | 3 | + |
| ISS368 | Creamed truffle | B | B | 3 | + |
| ISS406, ISS407, ISS408, ISS409, ISS410, ISS411 | Truffle in oil | B | B | 3 | + |
| ISS415 | Canned chicory in oil | B | B | 3 | + |
| ISS463 | Sea salt | B | B | 3 | + |
| BfR1944d | NA | B | B | 4 | + |
| ISS64 | Peppers in oil | B | B | 4 | + |
| ISS67, ISS200, ISS266 | Mushroom in oil | B | B | 4 | + |
| ISS95 | Pesto | B | B | 4 | + |
| ISS211 | Food | B | B | 4 | + |
| ISS238 | Olives | B | B | 4 | + |
| ISS275 | Tissue | B | B | 4 | + |
| ISS156, ISS212 ISS213, ISS214 | Sea salt | B | B | 4 | + |
| ISS343, ISS397 | Canned tuna in oil | B | B | 4 | + |
| ISS90, ISS131, ISS133, ISS134, ISS136, ISS140, ISS167, ISS199, ISS201, ISS202, ISS203, ISS204, ISS210, ISS235, ISS236, ISS265, ISS272, ISS322, ISS402, ISS416 | Feces | B | B | 4 | + |
| ISS257, ISS331 ISS274 | Feces | B2 | B | 4 | + |
| ISS276, ISS314, ISS338, ISS341 | Honey | B2 | B | 4 | + |
| BfR89d | NA | B | B | 5 | + |
| ISS142 | Olives | B | B | 5 | + |
| ISS223, ISS224, ISS225, ISS226, ISS227, ISS228, ISS229, ISS230, ISS231 | Sea salt | B | B | 5 | + |
| ISS261 | Honey | B | B | 5 | + |
| ISS32, ISS70, ISS135, ISS172, ISS208, ISS307, ISS308, ISS309, ISS346, ISS384, ISS389, ISS418, ISS419, ISS443, ISS444 | Feces | B | B | 5 | + |
| ISS267 | Feces | B2 | B | 5 | + |
| IPBL10c, BfR7273d, RIVM3e | NA | B | B | 6 | + |
| ISS386 | Feces | AB | A, B | 1 | + |
| ISS89 | Salami | A2B3 | A, B | 5 | + |
| ISS87C | Feces | A2B3 | A, B | 5 | + |
| RIVM5e | NA | E | E | 8 and flaB | − |
| IPHV2c, BfR1718d, BfR8550d | NA | E | E | flaB | − |
| BfR1956d | NA | F | F | 3 | + |
| ISS356, ISS357 | Feces | F | F | 3 | + |
| ISS358 | Asparagus | F | F | 3 | + |
The ISS prefix indicates Italian origin.
NA, not available.
French origin.
German origin.
Dutch origin.
Table 4.
Search for flaVR11 to flaVR15 and fldB in C. botulinum strains isolated in Europe
| Strains (GenBank accession no.)a | Origin | BoNT serotype (15) | bont type (5) | flaVR type (this study) | fldB (this study) |
|---|---|---|---|---|---|
| ISS234 (KC407595), ISS237 (KC235358), ISS430 (KC235359), ISS431 (KC235360), ISS432 (KC235361), ISS445 (KC235362) | Feces | B | B | 11 | + |
| ISS446 (KC235363) | Canned spinach | B | B | 11 | + |
| ISS447 (KC235364) | Mushroom in oil | B | B | 11 | + |
| ISS250 (KC235365), ISS253 (KC235367), ISS428 (KC235370), ISS429 (KC235371) | Feces | B | B | 12 | + |
| ISS251 (KC235366) | Canned chickpeas | B2 | B | 12 | + |
| ISS254 (KC235368) | Canned vegetables in oil | B | B | 12 | + |
| ISS427 (KC235369) | Peppers in oil | B | B | 12 | + |
| ISS271 (KC235372) | Tofu | B2 | B | 13 | + |
| ISS434 (KC235373) | Feces | B | B | 13 | + |
| ISS396 (KC235375) | Ileum | AB | A, B | 13 | + |
| ISS128 (KC235376) | Infant formula | B | B | 14 | + |
| ISS178 (KC235377), ISS181 (KC235378), ISS239 (KC235379), ISS241 (KC235381) | Feces | B | B | 14 | + |
| ISS240 (KC235380) | Meat in aspic | B | B | 14 | + |
| ISS242 (KC235382) | Canned beans | B | B | 14 | + |
| ISS243 (KC235383) | Beans | B | B | 14 | + |
| ISS244 (KC235384) | Mushroom in oil | B | B | 14 | + |
| ISS245 (KC235385) | Canned beans | B | B | 14 | + |
| ISS248 (KC235385, KC235388) | Canned beans and carrots | B | B | 14 | + |
| ISS246 (KC235386), ISS247 (KC235387), ISS249 (KC235389) | Peppers in oil | B | B | 14 | + |
| ISS252 (KC235390) | Canned chickpea | B2 | B | 14 | + |
| ISS256 (KC235391) | Feces | B2 | B | 14 | + |
| ISS259 (KC235392), ISS401 (KC235393), ISS422 (KC235394) | Feces | B | B | 14 | + |
| ATCC 43755b (KC407599), ATCC 43181b (KC407600) | Feces | E4 | E | 15 | − |
| ISS109b (KC407595), ISS145b (KC407596), ISS146b (KC407597) | Feces | E | E | 15 | − |
| ISS184b (KC407598) | Soil | E | E | 15 | − |
The ISS prefix indicates Italian origin.
Clostridium butyricum.
The flaVR, flaB, and fldB real-time PCR assays were evaluated for their specificity. Ten C. botulinum strains types C, C-D, D, D-C, and G, 18 nonbotulinum clostridia, and 18 nonclostridium bacteria tested negative for flaVR and flaB (data not shown). fldB was detected only in Clostridium sporogenes ATCC 3584. This finding is consistent with the draft genome sequence of C. sporogenes ATCC 15579.
Phylogenetic analysis of flaVR1 to flaVR15 types.
The dendrogram shown in Fig. 1 gives an illustration of the genetic diversity of the flaVR among C. botulinum strains investigated in the present study. It reveals the clustering of flaVR types into 5 major subgroups: flaVR1 to flaVR5 and flaVR11 belong to subgroup 1; flaVR8 to flaVR10 are classified in subgroup 2; flaVR6, and flaVR12 to flaVR14 belong to subgroup 3; flaVR7 is part of subgroup 4; and flaVR15 is reported as subgroup 5.
DISCUSSION
Flagellar structure and genetics of Gram-positive bacteria, in particular Clostridium species, have not been investigated as extensively as those of Gram-negative bacteria. Paul et al. (5) reported the first study showing the genetic diversity of the flagellin genes of C. botulinum strains belonging to groups I and II. Their work opened the door for the development of new genotyping methods based on the sequence of the variable region of flaA.
In the present study, we developed real-time PCR genotyping assays for flaVR and flaB sequences for better discrimination of C. botulinum strains derived from groups I and II. Real-time PCR typing of flaVR1 to flaVR10 regions and flaB was optimized and validated on 62 historical and Canadian strains of C. botulinum that have been previously typed (5). These PCR assays were highly specific for C. botulinum strains belonging to groups I and II. C. botulinum strains from groups III and IV, other Clostridium species and non-Clostridium bacteria all tested negative. Our results are in accordance with a recent study (19) showing that C. botulinum type C strains carry flagellin gene sequences that are significantly different from those of C. botulinum types A, B, and E. The flaVR types of C. botulinum types C and D and their mosaic variants C/D and D/C remain to be investigated, and this would constitute another study focusing on the characterization of C. botulinum strains involved in animal botulism. flaB, first identified in C. botulinum type E strain Bennett (5), was detected in all C. botulinum type E isolates investigated. The sequence of flaB in C. botulinum type E strains of flaVR type 8 has been determined and showed high sequence similarity to the flaB sequence of strain Bennett (99.71 to 99.92% identity; 99.43 to 99.64% similarity).
We investigated the flaVR genetic diversity in 210 group I and II strains of C. botulinum native to European countries (mainly of Italian origin). The flaVR type of 167 isolates fell into the various flaVR types previously determined in the panel of 62 C. botulinum reference strains. However, 43 isolates remained unclassified (mostly C. botulinum type B group I and type E group II). Sequencing the flagellin gene of these strains revealed four new flaVR types for C. botulinum strains belonging to group I. Likewise, a new real-time PCR assay targeting flaA of C. butyricum type E was designed.
Molecular typing of flaVR sequences showed that 75.1% of historical and Canadian strains previously typed by Paul et al. (5) harbor flaVR1, flaVR9, and flaVR10, whereas 75.3% of the European strains carry flaVR1, flaVR3, flaVR4, and flaVR5. Interestingly, 20.8% of the European isolates display new flaVR types. Neither flaVR7, flaVR9, nor flaVR10 was recorded among isolates of European origin. However, it should be noted that these isolates were mostly (95.3%) group I C. botulinum strains, in contrast to the historical and Canadian strain collection, in which C. botulinum groups I and II were almost equally represented. These results suggest that flaVR distribution may vary with the geographical origin; further investigations are necessary to confirm this hypothesis. No significant association between the BoNT type and the flaVR determination was observed. Conversely, flaB was highly related to C. botulinum type E. Analysis of the genetic diversity of flaVR and flaB resulted in the clustering of C. botulinum strains into 5 major subgroups. Subgroups 1, 3, and 4 contain proteolytic Clostridium botulinum, subgroup 2 is made up of nonproteolytic C. botulinum only, and subgroup 5 is specific to C. butyricum. The genetic variability of the flagellin genes carried by C. botulinum and the possible association of flaVR types with certain geographical area make gene profiling of flaVR and flaB promising in molecular surveillance and epidemiology of C. botulinum.
ACKNOWLEDGMENTS
This work was supported in part by funding from the Centre for Security Science, Defence Research and Development Canada.
We thank Jeff Bussey, Greg Sanders, and Bruna Auricchio for technical assistance. We are grateful to Juliane Braeunig from BfR (Federal Institute for Risk Assessment, Berlin, Germany) and Bart Van Rotterdam from RIVM (National Institute for Public Health and the Environment, Bilthoven, The Netherlands) for providing DNA extracts from C. botulinum.
Footnotes
Published ahead of print 19 April 2013
REFERENCES
- 1. Hansen LT, Austin JW, Gill TA. 2001. Antibacterial effect of protamine in combination with EDTA and refrigeration. Int. J. Food Microbiol. 66:149–161 [DOI] [PubMed] [Google Scholar]
- 2. Peck MW, Stringer SC, Carter AT. 2011. Clostridium botulinum in the post-genomic era. Food Microbiol. 28:183–191 [DOI] [PubMed] [Google Scholar]
- 3. Nevas M, Lindstrom M, Hielm S, Bjorkroth KJ, Peck MW, Korkeala H. 2005. Diversity of proteolytic Clostridium botulinum strains, determined by a pulsed-field gel electrophoresis approach. Appl. Environ. Microbiol. 71:1311–1317 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Leclair D, Pagotto F, Farber JM, Cadieux B, Austin JW. 2006. Comparison of DNA fingerprinting methods for use in investigation of type E botulism outbreaks in the Canadian Arctic. J. Clin. Microbiol. 44:1635–1644 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Paul CJ, Twine SM, Tam KJ, Mullen JA, Kelly JF, Austin JW, Logan SM. 2007. Flagellin diversity in Clostridium botulinum groups I and II: a new strategy for strain identification. Appl. Environ. Microbiol. 73:2963–2975 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Jacobson MJ, Lin G, Whittam TS, Johnson EA. 2008. Phylogenetic analysis of Clostridium botulinum type A by multi-locus sequence typing. Microbiology 154:2408–2415 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Macdonald TE, Helma CH, Shou Y, Valdez YE, Ticknor LO, Foley BT, Davis SW, Hannett GE, Kelly-Cirino CD, Barash JR, Arnon SS, Lindström M, Korkeala H, Smith LA, Smith TJ, Hill KK. 2011. Analysis of Clostridium botulinum serotype E strains by using multilocus sequence typing, amplified fragment length polymorphism, variable-number tandem-repeat analysis, and botulinum neurotoxin gene sequencing. Appl. Environ. Microbiol. 77:8625–8634 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Fach P, Micheau P, Mazuet C, Perelle S, Popoff M. 2009. Development of real-time PCR tests for detecting botulinum neurotoxins A, B, E, F producing Clostridium botulinum, Clostridium baratii and Clostridium butyricum. J. Appl. Microbiol. 107:465–473 [DOI] [PubMed] [Google Scholar]
- 9. Fach P, Fenicia L, Knutsson R, Wielinga PR, Anniballi F, Delibato E, Auricchio B, Woudstra C, Agren J, Segerman B, de Medici D, van Rotterdam BJ. 2011. An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A, B, E, F and other botulinum neurotoxin producing Clostridia based on the GeneDisc cycler. Int. J. Food Microbiol. 145(Suppl 1):S145–S151 [DOI] [PubMed] [Google Scholar]
- 10. Fenicia L, Fach P, van Rotterdam BJ, Anniballi F, Segerman B, Auricchio B, Delibato E, Hamidjaja RA, Wielinga PR, Woudstra C, Agren J, De Medici D, Knutsson R. 2011. Towards an international standard for detection and typing botulinum neurotoxin-producing Clostridia types A, B, E and F in food, feed and environmental samples: a European ring trial study to evaluate a real-time PCR assay. Int. J. Food Microbiol. 145(Suppl 1):S152–S157 [DOI] [PubMed] [Google Scholar]
- 11. Woudstra C, Skarin H, Anniballi F, Fenicia L, Bano L, Drigo I, Koene M, Bäyon-Auboyer MH, Buffereau JP, De Medici D, Fach P. 2012. Neurotoxin gene profiling of Clostridium botulinum types C and D native to different countries within Europe. Appl. Environ. Microbiol. 78:3120–3127 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kirchner S, Kramer KM, Schulze M, Pauly D, Jacob D, Gessler F, Nitsche A, Dorner BG, Dorner MB. 2010. Pentaplexed quantitative real-time PCR assay for the simultaneous detection and quantification of botulinum neurotoxin-producing clostridia in food and clinical samples. Appl. Environ. Microbiol. 76:4387–4395 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Fillo S, Giordani F, Anniballi F, Gorge O, Ramisse V, Vergnaud G, Riehm JM, Scholz HC, Splettstoesser WD, Kieboom J, Olsen JS, Fenicia L, Lista F. 2011. Clostridium botulinum group I strain genotyping by 15-locus multilocus variable-number tandem-repeat analysis. J. Clin. Microbiol. 49:4252–4263 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Macnab RM. 2004. Type III flagellar protein export and flagellar assembly. Biochim. Biophys. Acta 1694:207–217 [DOI] [PubMed] [Google Scholar]
- 15. Eberle KN, Kiess AS. 2012. Phenotypic and genotypic methods for typing Campylobacter jejuni and Campylobacter coli in poultry. Poult Sci. 91:255–264 [DOI] [PubMed] [Google Scholar]
- 16. Dahlsten E, Korkeala H, Somervuo P, Lindstrom M. 2008. PCR assay for differentiating between group I (proteolytic) and group II (nonproteolytic) strains of Clostridium botulinum. Int. J. Food Microbiol. 124:108–111 [DOI] [PubMed] [Google Scholar]
- 17. Keto-Timonen R, Nevas M, Korkeala H. 2005. Efficient DNA fingerprinting of Clostridium botulinum types A, B, E, and F by amplified fragment length polymorphism analysis. Appl. Environ. Microbiol. 71:1148–1154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Fach P, Guillou JP. 1993. Detection by in vitro amplification of the alpha-toxin (phospholipase C) gene from Clostridium perfringens. J. Appl. Bacteriol. 74:61–66 [DOI] [PubMed] [Google Scholar]
- 19. Skarin H, Hafstrom T, Westerberg J, Segerman B. 2011. Clostridium botulinum group III: a group with dual identity shaped by plasmids, phages and mobile elements. BMC Genomics 12:185. [DOI] [PMC free article] [PubMed] [Google Scholar]