Skip to main content
PLOS One logoLink to PLOS One
. 2013 Jul 2;8(7):e66406. doi: 10.1371/journal.pone.0066406

Real-Time Fluorescence Loop Mediated Isothermal Amplification for the Detection of Acinetobacter baumannii

Qinqin Wang 1,2, Yanbin Zhou 1,2,*, Shaoli Li 1,2, Chao Zhuo 3, Siqi Xu 1,2, Lixia Huang 1,2, Ling Yang 3, Kang Liao 4
Editor: Shuang-yong Xu5
PMCID: PMC3699609  PMID: 23843955

Abstract

Background

Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii.

Methodology and Significant Findings

Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively.

Conclusion

The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has great potential of field use as a molecular tool for detection of A. baumannii.

Introduction

Acinetobacter baumannii, one of the important nosocomial pathogens, is often associated with epidemic outbreaks of infection. The organism is frequently pandrug-resistant and capable of causing substantial morbidity and mortality in patients with severe underlying diseases, both in the hospital and in the community [1]. Rapid identification of this pathogen is critical for the appropriate therapy and outbreak control. Conventional methods, such as a phenotypic system and commercial phenotypic method, have successfully identified most Acinetobacter species. However, these methods can not distinguish Acinetobacter calcoaceticus, Acinetobacter baumannii, Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU, and require specific media and several days of incubation [2]. DNA- based methods have been successfully applied in the detection of A. baumannii [3], [4]. However, these methods have been hampered by inconsistent results with culture-based methods. Moreover, most protocols developed for identification of A. baumannii by PCR have used primers complementary to a universal region found in several different bacterial genera, so that DNA from bacteria belonging to other genera might also be amplified [2], [5]. However, as progress is made towards better outbreak control, more sensitive tools will be required in order to detect low level of A. baumannii. Therefore, further efforts are needed to develop next generation molecular tools for field use with a goal that such tools can complement, or in some situations, replace the existing molecular methods for A. baumannii detection.

The recently developed loop-mediated isothermal amplification (LAMP) method is a powerful innovative gene amplification technique [6]. It is based on autocycling strand displacement DNA synthesis in the presence of Bacillus stearothermophilus (Bst) polymerase under isothermal conditions. Six primers are used to recognize eight distinct regions on the target sequence [7]. Given that this method does not require a thermocycler or sophisticated training, it has the potential as a molecular diagnostic tool for point-of-care (POC) diagnosis. Indeed, LAMP has been used for the detection of several infectious diseases such as Mycobacterium tuberculosis [8], Plesiomonas shigelloides [9], severe acute respiratory syndrome coronavirus [10], human immunodeficiency virus-1 [11], and Plasmodium vivax [12].

Recently, the LAMP method has been used for the detection of A. baumannii targeting the 16S-23S rRNA intergenic spacer (ITS) sequence [13]. The results showed that the LAMP method was more suitable than PCR for rapid detection of A. baumannii in clinical samples, especially for infection control purposes. However, Soo et al. [13] could not effectively distinguish A. baumannii from Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU.

Therefore, we designed species-specific primers and attempted the utility of a simple portable device (tube scanner), in which both the amplification platform (heating block) and fluorescent detection unit for end point use (with the ability to acquire real time data) are combined into a single unit for LAMP assay, to detect A. baumannii. The method has been used to detect different human-infecting plasmodium species [14]. This method is referred to as real-time loop-mediated isothermal amplification (RealAmp). In this study, we demonstrated the utility of this method for the detection of A. baumannii and distinguishing A. baumannii from Acinetobacter genomic species 3, Acinetobacter calcoaceticus by using species-specific primers and comparing it to an automated identification system VITEK 2 system and a polymerase chain reaction (PCR) method. The VITEK 2 system uses a fluorescence-based technology for routine identification of gram-negative bacteria [15].

Methods

Ethics Statement

Samples used in this study were obtained from First Affiliated Hospital of Sun Yat-sen University and State Key Laboratory of Respiratory Diseases, Guangzhou Medical College. This study was approved by the Institutional Research Ethics Committee of First Affiliated Hospital of Sun Yat-sen University and State Key Laboratory of Respiratory Diseases, Guangzhou Medical College. Informed written consent was obtained from each subject.

A. baumannii ATCC19606, Acinetobacter calcoaceticus, Acinetobacter genomic species 3, Acinetobacter genomic species 13TU and clinical samples

A. baumannii ATCC19606 was kindly provided by Wang [16]. Acinetobacter calcoaceticus, Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU were kindly provided by Zhou et al. [17]. A. baumannii ATCC19606, Acinetobacter calcoaceticus, Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU were grown overnight in Luria–Bertani broth at 37°C. Pure genomic DNA was extracted from A. baumannii ATCC19606 using a TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit Ver.2.0 (TaKaRa Code: DV810A), and the genomic DNA was subjected to serial 10-fold dilutions in sterilized distilled water to produce concentrations ranging from 100 ng/μL to 1 pg/μL and assess the correlation between time to amplification and amount of target DNA. In addition, the number of colony forming units/mL (CFU/mL) was determined by using plate count. To test the limits of detection of RealAmp, overnight cultures were serially diluted (ten-fold) in Luria–Bertani broth from starting inocula of 1×107 CFU/mL to 101 CFU/mL before DNA extraction. In addition, to evaluate the specificity of RealAmp, DNA extracts from the array of bacterial species were tested (Table 1). One hundred and sixty-two spontaneous early-morning sputa from patients evaluated using light microscopy (WBC ≥25 and epithelia cells <10 per 100×field) were qualified. Ninety sputum samples identified as A. baumannii positive and 72 sputum samples as A. baumannii negative by VITEK 2 system (BioMérieux Inc, France), were used to assess the RealAmp assay. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. A. baumannii ATCC19606 DNA was used as a positive control. Blood sample DNA from healthy individual was used as a negative control. Each of the molecular tests was carried out and interpreted by independent researchers blinded to the origin of the specimens and the laboratory results. Samples with discrepant results in the 2 tests were retested.

Table 1. Strains used and the results of RealAmp assays.

Strains No. of strains RealAmp
Gram-negative organisms
Acinetobacter baumannii ATCC19606 a 1 +
Pseudomonas aeruginosa ATCC27853 a 1
Escherichia coli ATCC25922 a 1
Escherichia coli ATCC35218 a 1
Acinetobacter calcoaceticus b 1
Acinetobacter genomic species 13TU b 1 +
Acinetobacter genomic species 3 b 1
Acinetobacter junii c 2
Acinetobacter lwoffii c 2
Klebsiella pneumoniae c 1
Enterobacter cloacae c 1
Hemophilus influenzae c 1
Pseudomonas maltophilia c 1
Pseudomonas cepacia Burkholder c 1
Proteus mirabilis c 1
Gram-positive organisms
Staphylococcus aureus ATCC25923 a 1
Staphlococcus epidermidis c 1
Staphylococcus haemolyticus c 1
Enterococcus faecium c 1
Enterococcus faecalis c 1
Streptococcus pneumoniae c 1
Fungi
Candida albicans c 1
Candida glabrata c 1
Candida tropicalis c 1
Total 26

a: American Type Culture Collection, USA.

b: Department of Respiratory Diseases, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.

c: State Key Laboratory of Respiratory Diseases, Guangzhou Medical College, Guangzhou, Guangdong, China.

RealAmp: real-time loop-mediated isothermal amplification.

−: Result of RealAmp reaction was negative.

+: Result of RealAmp reaction was positive.

Design of RealAmp primers

A. baumannii contains a pgaABCD locus that encodes proteins that synthesize cell-associated poly-β-(1-6)-N-acetylglucosamine (PNAG). Choi et al. [18] found that all 30 clinical A. baumannii isolates examined had the pga genes by PCR analysis. The primers forward outer primer (F3), backward outer primer (B3), forward internal primer (FIP), backward internal primer (BIP) and loop backward primer (LB) listed in Table 2 for the RealAmp test were designed by targeting the conserved regions of the pgaD gene of A. baumannii (GeneBank accession numbers: FJ866500, CP003856, CP003500, CP001937, CP002522, CP001921, CP000863, CP001172, CP001182, CU459141, CP000521, NZ_GG704572). The target selection for primer design can be accomplished by using the Primer Explorer (http://Primer Explorer.jp/e/v4_manual/In.

Table 2. Sequences of primers F3, B3, FIP, BIP and LB used in the RealAmp assay.

Target Sequences(5′–') Size(bp) Position
F3 CTTCTGTTAATAGGTCTAAGCG 22 238–59
B3 TTAAATACCCCTGCTCATCA 20 426–45
FIP CGGCGATCATCCCCATGAAAGCTCATTTTAATTTTATGGGCAA 43 261–83, 301–20
BIP GCTCCGAATAGCTCTGTTGAGTGCTGAGACTTTTGTAATTCTGAT 45 328–49, 387–09
LB CTGGCCTCACAGTTTATGGTCA 22 352–73

F3: forward outer primer; B3: backward outer primer.

FIP: forward internal primer; BIP: backward internal primer.

LB: loop backward primer; bp: base pair.

dex.html). The primer specificity was checked using the basic local alignment search tool (BLAST) against human DNA and other Acinetobacter sequences in the nonredundant GenBank database.

DNA extraction

DNA was isolated from all the samples using a boiling method as described by Kocagöz et al. [19] with some modifications. Briefly, each sputum sample was liquefied in 3 times volume of 4% NaOH, placed 40 minutes at room temperature after strong vibration. One milliliter of the liquefaction of sputum was moved into 1.5 ml Eppendorf tube, and then centrifuged at 12,000 rpm for 10 minutes and the precipitate collected. The precipitate was washed by one milliliter of 1×TE (Tris-EDTA) buffer once, and then centrifuged at 12,000 rpm for 10 minutes and the precipitate collected. Forty microliters of sterilized distilled water was added to the tube containing the precipitate and mixed. The tube was heated on a heat-block at 100°C for 15 minutes, and then placed on ice for 10 minutes. Finally, the tube was then centrifuged at 12,000 rpm for 10 minutes and the supernatants were collected and used in the RealAmp and PCR assays.

Conventional PCR

Conventional PCR was performed as described by Choi et al. [18] with some modifications. Reactions were performed according to TaKaRa TaqTM (Code: DR001A ) in 25 μL total volume containing 1×PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 0.2 mM of dNTPs each, 1.5 mM MgCl2, 400 nM of F3 and B3 primers each, 0.5 units of Taq Polymerase (Takara Co. Ltd., Japan), and 2 μL of DNA as the template. Reaction conditions were set at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 45 s, with a final extension at 72°C for 10 min. Five microliters of the PCR product was then analyzed by 2% agarose gel electrophoresis.

RealAmp Method

The RealAmp method was performed using the commercially available DNA thermostatic amplification kit (Guangzhou Diao Bio-technology Co., Ltd., Guangdong, China) following the manufacturer's instructions. Reactions were performed in 25 μL total volume containing 2×reaction buffer (40 mM Tris-HCl pH 8.8, 20 mM KCl, 16 mM MgSO4, 20 mM (NH4)2SO4, 0.2% Tween-20, 0.8M Betaine, 2.8 mM of dNTPs each), 0.5 μL of a 1∶100 dilution SYBR green I (Invitrogen), 0.2 μM of each outer primers of F3 and B3, 1.6 μM of each inner primers of FIP and BIP, 0.8 μM of loop primer of LB, and 8 units of Bst polymerase (New England Biolabs, Ipswich, MA). DNA amplification was carried out at 63°C for 60 minutes using the ESE-Quant Tube Scanner which was set to collect fluorescence signals at 30 seconds intervals. The ESE-Quant Tube Scanner used in this study was developed by a company (QIAGEN Lake Constance GmbH, Stockach, Germany). This device has an eight tube holder heating block with adjustable temperature settings and spectral devices to detect amplified product using fluorescence spectra. This equipment weighs about 1 kg with the dimensions 74 mm×178 mm×188 mm. The unit is completely portable and can be operated with a Li-Ion rechargeable power pack without external power supply. A small liquid crystal display (monitor) is available to display the results (as positive or negative) without the need of a computer. However, the device can also be used together with a computer to generate real time amplification plots as the reaction progresses [14].

Statistics

The sensitivity and specificity of RealAmp method was calculated using both VITEK 2 system and a conventional PCR assay [14]. The percentage specificity and sensitivity were calculated using the formulae shown below:

graphic file with name pone.0066406.e001.jpg

In addition, 95% Confidence Intervals (95%CI) for both sensitivity and specificity were calculated.

Results

The correlation between time to amplification and amount of target DNA

The results showed that time to amplification prolonged in line with the decrease of the amount of target DNA (Figure 1).

Figure 1. The correlation between time to amplification and amount of target DNA.

Figure 1

The plot reported the fluorescence in millivolts (mV) on the Y-axis and time in minutes on the X-axis. 1, 100 ng/μL; 2, 10 ng/μL; 3, 1 ng/μL; 4, 100 pg/μL; 5, 10 pg/μL; 6, 1 pg/μL; PC, positive control; NC, negative control.

Sensitivity of the RealAmp method

The lower limit of detection of RealAmp determined using DNA obtained from A. baumannii ATCC19606 was 1×103 CFU/mL, but the conventional PCR only 1×104 CFU/mL (Figure 2). The time to amplification of RealAmp varied between 15–60 minutes. More time to amplification was required for clinical sputum samples with lower bacterial content.

Figure 2.Comparative. sensitivity of the RealAmp and PCR assays for the detection of A. baumannii ATCC19606.

Figure 2.Comparative

(A) The sensitivity of the RealAmp assay for the detection of A. baumannii ATCC19606. The plot reported the fluorescence in millivolts (mV) on the Y-axis and time in minutes on the X-axis. 1, 1×107 CFU/mL; 2, 1×106 CFU/mL; 3, 1×105 CFU/mL; 4, 1×104 CFU/mL; 5, 1×103 CFU/mL; 6, 1×102 CFU/mL; 7, 1×101 CFU/mL; NC, negative control. (B) The sensitivity of the PCR assay for the detection of A. baumannii ATCC19606. 1, 1×107 CFU/mL; 2, 1×106 CFU/mL; 3, 1×105 CFU/mL; 4, 1×104 CFU/mL; 5, 1×103 CFU/mL; 6, 1×102 CFU/mL; 7, 1×101 CFU/mL; NC, negative control. The number of colony forming units/mL (CFU/mL) of A. baumannii ATCC19606 are indicated.

Specificity of the RealAmp method

We selected 6 Acinetobacter species (8 strains) and 18 strains belonging to other genera (Table 1). The results showed that the RealAmp assay could effectively differentiate A. baumannii from 18 strains of other non-Acinetobacter genera (Table 1). In addition, in the detection of the A. calcoaceticus–A. baumannii (Ac–Ab) complex, the results showed that the RealAmp assay could differentiate A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3 (Figure 3).

Figure 3. The RealAmp assay for the detection of A. calcoaceticus–A. baumannii (Ac–Ab) complex.

Figure 3

The plot reported the fluorescence in millivolts (mV) on the Y-axis and time in minutes on the X-axis. 1, Acinetobacter baumannii ATCC19606; 2, Acinetobacter genomic species 13TU; 3, Acinetobacter genomic species 3; 4, Acinetobacter calcoaceticus; PC, positive control; NC, negative control.

Identification of bacterial strains isolated from clinical sputum samples

Clinical sputum samples were first discriminated by VITEK 2 system and further identified by 16S rRNA gene sequencing, and then assessed by conventional PCR and RealAmp established in this study, with median bacterial content of 1×105 CFU/mL (range 1×103–1×108 CFU/mL) (Table S1). The sensitivity and specificity of the RealAmp method compared to VITEK 2 system and conventional PCR were listed in Table 3. Of the 90 positive samples tested in VITEK 2 system, 89 samples were confirmed to be positive in the RealAmp assay and 84 positive in the PCR assay. Fifty-four out of the 72 negative samples by VITEK 2 system were shown to be negative by RealAmp and 60 negative by the PCR assay. The RealAmp assay showed 98.9% (95% CI: 94.0–99.8%) sensitivity and 75.0% (95% CI: 63.9–83.6%) specificity when compared to VITEK 2 system. The RealAmp method showed 100% (95% CI: 95.6–100%) sensitivity and 90.0% (95% CI: 79.9–5.3%) specificity when compared to the PCR assay. Overall, the sensitivity of conventional PCR and RealAmp was similar, when compared to VITEK 2 system data.

Table 3. Sensitivity and Specificity of the RealAmp assay compared to VITEK 2 system and PCR assay.

VITEK 2 system(n) RealAmp PCR
Positive Negative Positive Negative
Positive (90)* 89 1 84 6
Negative (72) 18* 54 12* 60
Sensitivity 98.9% (95% CI: 94.0–99.8%) 93.3% (95% CI: 86.2–96.9%)
Specificity 75.0% (95% CI: 63.9–83.6%) 83.3% (95% CI: 73.1–90.2%)
Positive likelihood ratio 3.956 (95%CI: 2.65–.905) 5.600(95%CI: 3.331–.414)
Negative likelihood ratio 0.015(95%CI:0.002–.105) 0.080(95%CI:0.037–.174)
Diagnostic odds ratio 267.000(95%CI:34.653–057.206) 70.000(95%CI:24.879–96.952)
*

: The species of Acinetobacter determined by 16S rRNA gene sequencing.

VITEK 2 system: a fluorescence-based automated identification system.

RealAmp: real-time loop-mediated isothermal amplification.

PCR: polymerase chain reaction.

Discussion

Recently, multiplex PCR and real-time PCR approaches have been found to be useful for detection of A. baumannii strains [20], [21]. Multiplex PCR can achieve simultaneous detection of multiple agents that cause similar or identical clinical syndromes and/or share similar epidemiological features in a single test. However, multiplex PCR can pose several difficulties, including poor sensitivity or specificity and/or preferential amplification of certain specific targets. The presence of more than one primer pair in the multiplex PCR increases the chance of obtaining spurious amplification products, primarily because of the formation of primer dimers [20], [22]. Real-time PCR assay have many advantages over conventional PCR, including rapidity, lower contamination rate, higher sensitivity and easy standardization. However, demanding operation and expensive kits and equipment restrict its clinical application [23].

In this study, a rapid RealAmp assay for the detection of A. baumannii was developed by using ESE-Quant tube scanner, which is portable, small, lightweight, and can be operated by an optional Li-Ion rechargeable power pack to achieve amplification step and product detection step simultaneously [14]. The RealAmp test does not require time-consuming steps for DNA purification, or downstream processing for amplicon detection. More importantly, the interpretation of results from this closed-tube test does not require highly experienced staff. A small LCD panel is available to display the results (as positive or negative). These features make the RealAmp assay an excellent option for the molecular test of A. baumannii even in basic healthcare settings. However, the disadvantage of the device is that it can accommodate only eight samples once and uses nonspecific dye [24]. Therefore, modification is required to expand the device to accommodate more samples.

Due to the high level of genotypic and phenotypic similarity among Acinetobacter calcoaceticus, A. baumannii, Acinetobacter genomic species 13TU and Acinetobacter genomic species 3, they are grouped together as the A. calcoaceticus–A. baumannii (Ac–Ab) complex [25]. However, there are considerable epidemiological and clinically relevant differences among these species. To our knowledge, A. calcoaceticus is an environmental organism, which has never been involved in serious human disease, and therefore it should not be misidentified as A. baumannii [26]. The natural habitats of A. baumannii and Acinetobacter genomic species 13TU are unknown, as are the differences in their epidemic behaviors, resistance mechanisms, and pathogenicities. Acinetobacter genomic species 3 can be found regularly on human skin, as well as in aquatic environments [27]. Acinetobacter genomic species 3 has also been implicated in nosocomial infections, but its tendency for epidemic spread and resistance development is far less obvious than that of A. baumannii [27]. For epidemiological and clinical purposes, it is very critical to differentiate among these species correctly. In our study, the species-specific primers were designed to distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. However, the previously reported LAMP test based on A. baumannii targeting the 16S–23S rRNA intergenic spacer sequence could not effectively distinguish A. baumannii from Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU [13].

The RealAmp assay was at least 10-fold more sensitive than the PCR assay. Therefore, the LAMP assay is more suitable than PCR for rapid detection of A. baumannii.

Out of the 90 positive samples detected by VITEK 2 system used in this study, 89 were A. baumannii and 1 was Acinetobacter calcoaceticus ADP1 by 16S rRNA gene sequencing. Six were negative by conventional PCR and 1 by RealAmp assay. Failure to amplify one sample by RealAmp was Acinetobacter calcoaceticus ADP1. Therefore, the results showed that the RealAmp assay could differentiate between A. baumannii and Acinetobacter calcoaceticus. Failure to amplify these samples by conventional PCR was likely due to low bacterial content. But further studies in different transmission settings are required to evaluate the performance of the RealAmp method in comparison with other routine diagnostic tests.

Of the 72 VITEK 2 system negative samples, 60 were negative by conventional PCR and 54 by RealAmp assay. Eighteen were positive by RealAmp assay, which were further confirmed to be A. baumannii by 16S rRNA gene sequencing. Moreover, the slower rate of metabolism of A. baumannii could cause weaker fluorescent biochemical reactions in the reaction wells of VITEK 2 ID-GNB cards, and this may cause more discrepant identifications with the VITEK 2 system [28]. Joyanes et al. [15] found that the VITEK 2 system identified 91.6%, 100%, and 76% of P. aeruginosa, S. maltophilia, and A. baumannii isolates, within 3 h. However, the RealAmp assay could detect A. baumannii isolates which would not be affected by biochemical reactions. In addition, for the RealAmp assay, the targets for detection are representative sequences from the pathogens, alive or dead. Culture-based assays, on the other hand, detect all living bacterial cells grown in the culture media. To be objective, there are more elements and factors to be considered when culture-based assays are performed, such as how to keep the cells alive and what selective media to use for visualizing the colonies.

The RealAmp method will be more attractive for field use if the LAMP reagents can be made into dry powder and stored at room temperature without requiring a cold chain. In summary, this study has shown that the RealAmp method is a potential of field use as a tool for detection of A. baumannii.

Supporting Information

Table S1

The information of the clinical samples in this study.

(DOC)

Acknowledgments

We thank Professor Zheng Wang from Da ping Hospital, Research Institute of Surgery, Third Military Medical University, Chongqing, China for kindly providing A. baumannii ATCC19606, and thank Professor Jianying Zhou from Department of Respiratory Diseases, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, China for friendly providing Acinetobacter calcoaceticus, Acinetobacter genomic species 3 and Acinetobacter genomic species 13TU. We also thank colleagues from the bacteriology room at State Key Laboratory of Respiratory Diseases, Guangzhou Medical College, for sample collection.

Funding Statement

This work is supported by grants from the National Natural Science foundation of China (81071931, Yanbin Zhou), the Natural Science Foundation of Guangdong Province of China (S2011010004703, Yanbin Zhou and S2012010008393, Yanbin Zhou), and Scientific Research Foundation for Returned Scholars, Ministry of Education of China (2010-609, Yanbin Zhou). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Visca P, Seifert H, Towner KJ (2011) Acinetobacter infection – an emerging threat to human health. 63: 1048–1054. [DOI] [PubMed] [Google Scholar]
  • 2. Chen TL, Siu LK, Wu RC, Shaio MF, Huang LY, et al. (2007) Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii Clin Microbiol Infect. 13: 801–806. [DOI] [PubMed] [Google Scholar]
  • 3. Chang HC, Wei YF, Dijkshoorn L, Vaneechoutte M, Tang CT, et al. (2005) Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S–23S rRNA gene spacer region. 43: 1632–1639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Higgins PG, Wisplinghoff H, Krut O, Seifert H (2007) A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clin Microbiol Infect 13: 1199–1201. [DOI] [PubMed] [Google Scholar]
  • 5. García-Arata MI, Gerner-Smidt P, Baquero F, Ibrahim A (1997) PCR-amplified 16S and 23S rDNA restriction analysis for the identification of Acinetobacter strains at the DNA group level. Res Microbiol 148: 777–784. [DOI] [PubMed] [Google Scholar]
  • 6. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, et al. (2000) Loop-mediated isothermal amplification of DNA. 28: E63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Nagamine K, Hase T, Notomi T (2002) Accelerated reaction by loop-mediated isothermal amplification using loop primers. 16: 223–229. [DOI] [PubMed] [Google Scholar]
  • 8. George G, Mony P, Kenneth J (2011) Comparison of the efficacies of loop-mediated isothermal amplification, fluorescence smear microscopy and culture for the diagnosis of tuberculosis. 6: e21007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Meng S, Xu J, Xiong Y, Ye C (2012) Rapid and sensitive detection of Plesiomonas shigelloides by loop-mediated isothermal amplification of the hugA gene. PLoS One 7: e41978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hong TC, Mai QL, Cuong DV, Parida M, Minekawa H, et al. (2004) Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus. 42: 1956–1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Curtis KA, Rudolph DL, Nejad I, Singleton J, Beddoe A, et al. (2012) Isothermal amplification using a chemical heating device for point-of-care detection of HIV-1. PLoS One 7: e31432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Patel JC, Oberstaller J, Xayavong M, Narayanan J, DeBarry JD, et al. (2013) Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax. . PLoS One 8: e54986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Soo PC, Tseng CC, Ling SR, Liou ML, Liu CC, et al. (2012) Rapid and sensitive detection of Acinetobacter baumannii using loop-mediated isothermal amplification. J Microbiol Methods 92: 197–200. [DOI] [PubMed] [Google Scholar]
  • 14. Lucchi NW, Demas A, Narayanan J, Sumari D, Kabanywanyi A, et al. (2010) Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria. PLoS One 5: e13733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Joyanes P, del Carmen Conejo M, Martínez-Martínez L, Perea EJ (2001) Evaluation of the VITEK 2 system for the identification and susceptibility testing of three species of nonfermenting gram-negative rods frequently isolated from clinical samples. 39: 3247–3253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Hu Z, Wang Z, Liu D, Chen P, Wang H, et al. (2011) Clinical and molecular microbiological characteristics of carbapenem-resistant Acinetobacter baumannii strains in an NICU. 53: 867–872. [DOI] [PubMed] [Google Scholar]
  • 17. Fu Y, Zhou J, Zhou H, Yang Q, Wei Z, et al. (2010) Wide dissemination of OXA-23-producing carbapenem-resistant Acinetobacter baumannii clonal complex 22 in multiple cities of China. J Antimicrob Chemother 65: 644–650. [DOI] [PubMed] [Google Scholar]
  • 18. Choi AH, Slamti L, Avci FY, Pier GB, Maira-Litrán T (2009) The pgaABCD locus of Acinetobacter baumannii encodes the production of poly-beta-1-6-N-acetylglucosamine, which is critical for biofilm formation. 191: 5953–5963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kocagöz T, Yilmaz E, Ozkara S, Kocagöz S, Hayran M, et al. (1993) Detection of Mycobacterium tuberculosis in sputum samples by polymerase chain reaction using a simplified procedure. J Clin Microbiol 31: 1435–1438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Zander E, Higgins PG, Fernández-González A, Seifert H (2013) Detection of intrinsic blaOXA-51-like by multiplex PCR on its own is not reliable for the identification of Acinetobacter baumannii . Int J Med Microbiol 303: 88–89. [DOI] [PubMed] [Google Scholar]
  • 21. Clifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, et al. (2012) Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS One 7: e48558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE (2000) Multiplex PCR: optimization and application in diagnostic virology. 13: 559–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Podnecky NL, Elrod MG, Newton BR, Dauphin LA, Shi J, et al. (2013) Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR. PLoS One 8: e58032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Njiru ZK, Yeboah-Manu D, Stinear TP, Fyfe JA (2012) Rapid and sensitive detection of Mycobacterium ulcerans by use of a loop-mediated isothermal amplification test. J Clin Microbiol 50: 1737–1741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Gerner-Smidt P, Tjernberg I, Ursing J (1991) Reliability of phenotypic tests for identification of Acinetobacter species. J Clin Microbiol 29: 277–282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Peleg AY, de Breij A, Adams MD, Cerqueira GM, Mocali S, et al. (2012) The success of Acinetobacter species; genetic, metabolic and virulence attributes. PLoS One 7: e46984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Higgins PG, Lehmann M, Wisplinghoff H, Seifert H (2010) gyrB multiplex PCR to differentiate between Acinetobacter calcoaceticus and Acinetobacter genomic species 3. J Clin Microbiol 48: 4592–4594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Funke G, Monnet D, deBernardis C, von Graevenitz A, Freney J (1998) Evaluation of the VITEK 2 system for rapid identification of medically relevant gram-negative rods. 36: 1948–1952. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

The information of the clinical samples in this study.

(DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES