Skip to main content
PMC home page
Vector Borne and Zoonotic Diseases logoLink to Vector Borne and Zoonotic Diseases
. 2013 Jul;13(7):443–448. doi: 10.1089/vbz.2012.1054

Tick-Borne Pathogens in Ticks Feeding on Migratory Passerines in Western Part of Estonia

Julia Geller 1,2, Lidia Nazarova 1,2, Olga Katargina 1, Agu Leivits 3, Lilian Järvekülg 2, Irina Golovljova 1,✉
PMCID: PMC3700471  PMID: 23590318

Abstract

During southward migration in the years 2006–2009, 178 migratory passerines of 24 bird species infested with ticks were captured at bird stations in Western Estonia. In total, 249 nymphal ticks were removed and analyzed individually for the presence of Borrelia burgdorferi sensu lato (s.l.), tick-borne encephalitis virus (TBEV), and Anaplasma phagocytophilum. The majority of ticks were collected from Acrocephalus (58%), Turdus (13%), Sylvia (8%), and Parus (6%) bird species. Tick-borne pathogens were detected in nymphs removed from Acrocephalus, Turdus, and Parus bird species. TBEV of the European subtype was detected in 1 I. ricinus nymph removed from A. palustris. B. burgdorferi s.l. DNA was found in 11 ticks (4.4%) collected from Turdus and Parus species. Bird-associated B. garinii and B. valaisiana were detected in I. ricinus nymphs removed from T. merula. Rodent-associated B. afzelii was detected in 3 I. ricinus nymphs from 2 P. major birds. One of the B. afzelii-positive nymphs was infected with a mix of 2 B. afzelii strains, whereas 1 of these strains was also detected in another nymph feeding on the same great tit. The sharing of the same B. afzelii strain by 2 nymphs indicates a possible transmission of B. afzelii by co-feeding on a bird. A. phagocytophilum DNA was detected in 1 I. ricinus nymph feeding on a T. iliacus. The results of the study confirm the possible role of migratory birds in the dispersal of ticks infected with tick-borne pathogens along the southward migration route via Estonia.

Key Words: Tick-borne pathogen, TBEV, Borrelia, Reservoir, tick, Ixodidae, Bird

Introduction

Migratory birds may play an important role in global dispersal, transport, and dissemination of ticks and tick-borne pathogens as they migrate within and between continents (Georgopoulou and Tsiouris 2008). Birds can carry ticks infected by such tick-borne pathogens as tick-borne encephalitis virus (TBEV) (Waldenstrom et al. 2007), Anaplasma phagocytophilum (Alekseev et al. 2001, Bjoersdorff et al. 2001, Daniels et al. 2002, Franke et al. 2010a) and Borrelia burgdorferi sensu lato (s.l.) (Olsen et al. 1995, Gylfe et al. 2000, Hanincova et al. 2003b, Poupon et al. 2006, Franke et al. 2010a).

Ixodes ricinus and I. persulcatus are the most important vectors for tick-borne pathogens in Europe and Asia, respectively. Estonia is located in a unique area where both tick species co-circulate. Our previous studies showed that all three known TBEV subtypes (Suss 2011), Western TBEV (W-TBEV), Far-Eastern TBEV (FE-TBEV), and Siberian TBEV (S-TBEV), co-circulate in Estonia (Golovljova et al. 2004). The prevalence of B. burgdorferi s.l. in the tick population varied from 3.8% to 23% (mean 9.7%) in different regions of Estonia (Geller, unpublished). A. phagocytophilum was found in questing I. ricinus ticks with a prevalence of 1.7% for mainland Estonia and 2.6% for Saaremaa island (Katargina et al. 2012).

Estonia is situated in the breeding area of long-distance migrating passerines, such as Acrocephalus spp., that might be potentially important in the dispersal of ticks and tick-borne pathogens along its southward migration route from Estonia, Fennoscandia, and southeastern Russia to Africa (A. Leivits, personal communication). Short-distance migrants of Turdus species, which are known to be reservoirs (Hanincova et al. 2003b, Humair et al. 1998) for pathogenic B. garinii and potentially pathogenic B. valaisiana, also breed in Estonia, Finland, and southeastern Russia. In this study, we investigated the prevalence of TBEV, B. burgdorferi s.l., and A. phagocytophilum in ticks harbored by passerines during southward migration. This is the first study regarding the role of birds in the dispersal of these pathogens in Estonia.

Materials and Methods

Collection of ticks from migratory birds

Birds were captured by ornithologists in Kabli (58.01431N 24.44942 E) and Pulgoja (58.09947N 24.4844E) bird stations situated on the East coast of the Gulf of Riga. Birds were trapped during the fall migration periods in August–October from 2006 to 2009. The birds were identified, examined, and released back into the wild as quickly as possible to minimize stress. Only birds from which ticks had been removed were included in the study. Ticks were collected from the bird's head using tweezers and placed in 70% ethanol. Samples were sent to the laboratory within 1 month after ticks' collection and processed immediately. The tick species were identified morphologically by use of a stereomicroscope. Ticks were washed in sterile water and homogenized in 300 μL phosphate-buffered saline (PBS) solution with TissueLyzer (Retsch, Haan, Germany). Two hundred microliters of suspensions were used for nucleic acid extraction. Due to small numbers, larvae collected from birds were not included in the study.

Nucleic acid isolation

Nucleic acids were extracted by the guanidinium thiocyanate–phenol–chloroform method using the TriPure isolation system (Roche Diagnostics, Lewes, UK) according to the manufacturer's recommendations. Sterile water was used as a negative control for every preparation set. DNA was stored at −20°C and RNA at −70°C until further use.

To avoid any possible contamination, all steps were performed in separate rooms with sterile techniques, and addition of the sample DNA to the PCR mix was performed in a laminar flow cabinet. All primers and probes used in the current study are presented in Table 1.

Table 1.

Primers and Probes Used for PCR, RT-PCR, and Real-Time PCR of Tick-Borne Pathogen Nucleic Acid Detection

Primer or probe name Sequences of oligonucleotide probes and primers (5′→3′) References
TBEV
 283F1 GAGAYCAGAGTGAYCGAGGCTGG Skarpaas et al. 2006
 827R1 AGGTGGTACTTGGTTCCMTCAAGT  
 349F2 GTCAAGGCGKCTTGTGAGGCAA  
 814R2 TTCCCTCAATGTGTGCCACAGG  
 F-TBE1 GGGCGGTTCTTGTTCTCC Schwaiger and Cassinotti 2003
 R-TBE1 ACACATCACCTCCTTGTCAGACT  
 TBE-Probe-WT TGAGCCACCATCACCCAGACACA  
B. burgdorferi s.l.
 NC1 CCTGTTATCATTCCGAACACAG Rar et al. 2005
 NC2 TACTCCATTCGGTAATCTTGGG  
 NC3 CTGCGAGTTCGCGGGAGA Postic et al. 1994
 NC4 TCCTAGGCATTCACCATA  
A. phagocytophilum
 ApMSP2f ATGGAAGGTAGTGTTGGTTATGGTATT Courtney et al. 2004
 ApMSP2r TTGGTCTTGAAGCGCTCGTA  
 ApMSP2 (probe) FAM-TGGTGCCAGGGTTGAGCTTGAGATTG-TAMRA  
Open in a new tab

TBEV, tick-borne encephalitis virus.

Detection of tick-borne encephalitis virus RNA

TBEV real-time reverse transcriptase PCR detection in ticks was carried out with F-TBE1 and R-TBE1 primers and TBE-probe-WT probe as described (Schwaiger and Cassinotti 2003) with some modifications. Forward primer concentration of 3 μM, reverse primer concentration of 0.3 μM, and probe concentration of 0.2 μM were used, and the reverse transcription step was performed at 42°C. The 7900 Real Time PCR system (Applied Biosystems) was used for all PCR reactions and fluorescent detections.

Samples positive for TBEV RNA by real-time PCR were amplified and sequenced for the partial E gene, as described earlier (Skarpaas et al. 2006) with outer primers 283F1 and 827R1 used for the cDNA synthesis and inner primers 349F2 and 814R2 for the second round of PCR amplification.

Detection of B. burgdorferi s.l. DNA

All samples were screened for the presence of B. burgdorferi s.l. by amplification of the 5S–23S rRNA intergenic spacer (IGS) region as described earlier (Postic et al. 1994, Rar et al. 2005), with modified cycling conditions. In the first-round PCR, the annealing step at 58°C was increased to 1 min and the extension step at 72°C was increased to 2 min. In the nested PCR, cycling conditions were performed as described (Postic et al. 1994).

The amplified products were separated by electrophoresis on a 1% agarose gel, stained with ethidium bromide and visualized under ultraviolet (UV) light.

Detection of A. phagocytophilum DNA

Ticks were screened for the presence of A. phagocytophilum by real-time PCR with ApMSP2f and ApMSP2r primers and ApMSP2 probe, as described previously (Courtney et al. 2004).

DNA sequencing and data analysis

Sequencing was performed by the Estonian Biocentre (Tartu, Estonia), where PCR products were sent. Assembling, editing, and analysis of collected sequences were performed using BioEdit Sequences Alignment Editor v.7.0.9.0.

Results

Examination of birds and ticks

In total, 178 birds of 24 bird species infested with ticks were examined in the study. All birds were juvenile passerines (order Passeriformes). Only 1 bird (great tit) was identified by ornithologists as an adult (>1 year old). The most common birds were the marsh warbler (A. palustris), the Eurasian reed-warbler (A. scirpaceus), and the great tit (P. major), comprising 34.3%, 14%, and 7.9% of all birds, respectively. All details concerning the captured birds, their species and the number of ticks removed from them are presented in Table 2.

Table 2.

Birds Captured in Estonia During the Summer—Autumn Migration Period and Their Infestation with I. ricinus Ticks

Bird species No. of birds % of all birds No. of ticks collected
Great reed-warbler Acrocephalus arundinaceus 1 0.6 1
Blyth's reed-warbler A. dumetorum 9 5.1 11
Marsh warbler A. palustris 61 34.3 99
Sedge warbler A. schoenobaenus 7 3.9 6a
Eurasian reed-warbler A. scirpaceus 25 14.0 28
Tree pipit Anthus trivialis 2 1.1 7
Common rosefinch Carpodacus erythrinus 1 0.6 4
Eurasian treecreeper Certhia familiaris 2 1.1 2
Reed bunting Emberiza schoeniclus 1 0.6 1
European robin Erithacus rubecula 2 1.1 1
Red-backed shrike Lanius collurio 1 0.6 1
Common grasshopper-warbler Locustella naevia 1 0.6 1
Blue tit Parus caeruleus 2 1.1 2
Great tit P. major 14 7.9 14
Common redstart Phoenicurus phoenicurus 1 0.6 1
Common chiffchaff Phylloscopus collybita 10 5.6 10
Willow warbler Ph. trochilus 4 2.2 5
Goldcrest Regulus regulus 1 0.6 1
Garden warbler Sylvia borin 1 0.6 1
Whitethroat S. communis 14 7.9 18
Winter wren Troglodytes troglodytes 2 1.1 2
Redwing Turdus iliacus 2 1.1 2
Song thrush T. philomeros 2 1.1 2
Common blackbird T. merula 12 6.7 29
 Total   178   249
Open in a new tab
a

One I. persulcatus nymph is included.

Overall, 249 nymphs were removed from the examined birds, of which 248 (99.6 %) were morphologically identified as I. ricinus and 1 (0.4%) as I. persulcatus (removed from A. schoenobaenus, sedge warbler). The majority of ticks (58%) were collected from Acrocephalus, Turdus (13%), Sylvia (8%), and Parus (6%) bird species.

Tick-borne pathogens detected in ticks

All ticks were investigated for the presence of TBEV, B. burgdorferi s.l., and A. phagocytophilum. Tick-borne pathogens were detected in nymphs removed from Acrocephalus, Turdus, and Parus bird species. Overall, 13 ticks (5.2%) removed from 7 birds were infected by tick-borne pathogens (Table 3).

Table 3.

Tick-Borne Pathogens in Ticks Removed from Birds

Bird species Infested tick species No. ticks infected/no. ticks on bird Infectious agent
Marsh warbler (A. palustris) I. ricinus 1N/4N TBEV-Eu
Great tit (P. major) I. ricinus 2N/2N B. afzelii
Great tit (P. major) I. ricinus 1N/1N B. afzelii
Common blackbird (T. merula) I. ricinus 4N/5N B. garinii
Common blackbird (T. merula) I. ricinus 3N/3N B. garinii
Common blackbird (T. merula) I. ricinus 1N/1N B. valaisiana
Redwing (T. iliacus) I. ricinus 1N/1N A. phagocytophilum
Open in a new tab

TBEV, tick-borne encephalitis virus.

TBEV detection

TBEV RNA was detected only in 1 tick (0.4% of all examined ticks) removed from a marsh warbler. Another 4 nymphs attached to the same bird were negative for TBEV. Phylogenetic analysis of partial E gene showed that it belonged to the TBEV-Eu subtype and is closely related to the strain Korppoo-259 from Finland (Jaaskelainen et al. 2010).

Detection of B. burgdorferi s.l.

B. burgdorferi s.l. DNA was detected in 11 ticks (4.4% of all examined ticks) removed from 5 birds of 2 species (common blackbird and great tit). B. garinii was detected in 7 I. ricinus nymphs removed from 2 common blackbirds. One common blackbird carried 1 B.valaisiana–positive nymph. Analysis of the 5S–23S IGS showed that the sequences were identical to those of B. garinii 20047 (Postic et al. 1994) and NE11 (Gern et al. 2010), and to the sequence of B. valaisiana genotype I-214 (Derdakova et al. 2003). Three I. ricinus nymph samples from 2 birds of P. major (great tit) were identified as B. afzelii. Two I. ricinus nymphs recovered from the same great tit were infected by 2 different types of B. afzelii. One nymph had a mixture of 2 sequences (B. afzelii strain PGau and B. afzelii strain Tom1503), and the sequence obtained from another nymph was identical only to B. afzelii strain PGau.

Despite the large number of ticks (145/249, 58%) removed from Acrocephalus species none of them were infected with B. burgdorferi s.l.

Detection of A. phagocytophilum

Only 1 I. ricinus nymph (0.4% of all examined ticks), removed from a redwing (T. iliacus) was positive for A. phagocytophilum by real-time PCR analysis with a cycle threshold (Ct) value of 25.3.

Discussion

Thousands of passerines migrate southward every autumn from their places of breeding in Estonia, Finland, and northwestern Russia to their wintering areas located in Southeast Asia, Europe, and Africa. The present study confirms the potential role of migratory passerines in the distribution of tick-borne pathogens by harboring infected ticks, as we found a TBEV-infected nymph harbored by Acrocephalus species, and ticks infected by Borrelia and A. phagocytophilum that were removed from Turdus species.

Birds carrying TBEV infected ticks may contribute to the introduction of TBEV and thereby to the emergence of new TBE foci (Lommano et al. 2012). Data from Sweden showed 0.5% TBEV prevalence in bird-feeding ticks removed from the tree pipit (Anthus trivialis), the European robin (Erithacus rubecula), the common redstart (Phoenicurus phoenicurus), and the song thrush (T. philomeros) (Waldenstrom et al. 2007). The prevalence of TBEV in ticks from birds in the current study was the similar (0.4%). A TBEV-positive I. ricinus nymph was removed from a marsh warbler (A. palustris), indicating a potential implication of Acrocephalus species in the dispersal of TBEV-infected nymphs from breeding areas in Estonia, Finland, and northwestern Russia along the route to the wintering areas in Central and South Africa. Although there were 4 nymphs attached to the same bird, only 1 of them was TBEV positive, indicating that transmission by co-feeding did not occur on this host. The close sequence relationship to the TBEV strain reported from Finland (Jaaskelainen et al. 2010) could be explained by the marsh warbler migration route, which is directed southward from their breeding areas in South Finland through Estonia to South Africa.

In Europe the prevalence of B. burgdorferi s.l spirochetes in I. ricinus nymphs feeding on bird ticks varies considerably. The B. burgdorferi s.l. prevalence found in this study is similar to that reported from the Lista Bird Observatory in southern Norway, where B. burgdorferi s.l was detected in 5.4% and 7.5% of I. ricinus nymphs removed from birds in the spring and autumn, respectively (Kjelland et al. 2010). Later studies from the southern Norwegian coast reported 13.6% prevalence of Borrelia spp. in bird-feeding nymphs (Hasle et al. 2011); the study was, however, performed during the spring migration period. A large-scale study from southeastern Sweden showed a 19.3% prevalence of B. burgdorferi s.l. in nymphs collected from birds (Comstedt et al. 2006). In contrast, data from Central Europe showed higher B. burgdorferi s.l. prevalence in bird-feeding ticks. In Thuringia, Germany, B. burgdorferi s.l. was detected in 35% of nymphs removed from birds (Kipp et al. 2006). Similar results were reported from Czech Republic (Dubska et al. 2009) and Switzerland (Poupon et al. 2006), where Borrelia spp. prevalence in bird-derived nymphs was 31.4%, and 34.6%, respectively.

Common blackbirds and thrushes serve as main reservoirs for B. garinii and B. valaisiana in Europe (Humair et al. 1998, Hanincova et al. 2003b, Taragel'ova et al. 2008). The results of our study also support the notion that birds of Turdus spp. may play an essential role in distribution of B. burgdorferi s.l. by ticks in Europe, as 8 of 11 ticks infected with Borrelia were removed from T. merula. Furthermore, sequences of B. garinii and B. valaisiana detected in our study were identical to those of B. garinii 20047 (Postic et al. 1994) and NE11 (Gern et al. 2010), and to sequences of B. valaisiana genotype I-214 (Derdakova et al. 2003), which are widely spread in Europe.

There are several studies reporting the presence of B. afzelii in bird-feeding ticks (Humair et al. 1998, Comstedt et al. 2006, Kipp et al. 2006, Poupon et al. 2006, Taragel'ova et al. 2008, Franke et al. 2010b), although B. afzelii is regarded to be a rodent-associated genospecies in Europe (Humair et al. 1999, Hanincova et al. 2003a). It has been previously shown that birds do not serve as adequate reservoirs for B. afzelii, and furthermore, that the uptake of avian blood initiates the elimination of B. afzelii in the tick (Kurtenbach et al. 2002). Because the B. afzelii DNA, detected in the current study, was recovered from nymphs feeding on great tits, we suggest that B. afzelii infection in these ticks was acquired at the larval stage from a rodent host. However detection of a mix of B. afzelii strains PGau and Tom1503 in 1 nymph and detection of strain PGau in another nymph removed from the same great tit may indicate transmission of B. afzelii PGau strain through co-feeding on a bird. It is theoretically possible that the nymph acquired a mix of both strains of B. afzelii from a rodent during the larval stage (Hu et al. 1997, Humair et al. 1999), but transmission through co-feeding would be a much more likely event than that 2 ticks independently acquired the same strain of B. afzelii and accidentally entered the same host.

The low prevalence (0.4%) of A. phagocytophilum in bird-feeding ticks in the present study corresponds to the data from other studies (Franke et al. 2010a, Palomar et al. 2012). It is also in correspondence with our previous studies that showed 0.9% prevalence of A. phagocytophilum in I. ricinus ticks collected from the vegetation in the area near Kabli and Pulgoja bird stations (Katargina et al. 2012). Because this microorganism was detected in an I. ricinus nymph feeding on T. iliacus, short-distance migrants of Turdus species might be considered as potential dispersers of this tick-borne pathogen from Fennoscandia to Central Europe.

Conclusions

This is the first study on the detection of tick-borne pathogens in ticks removed from passerines during southward migration from Estonia. These data support the notion that migratory birds may be essential in the long-distance distribution and introduction to new foci of TBEV, B. burgdorferi s.l., and A. phagocytophilum by transporting infected ticks while migrating from Fennoscandia and Russia to South Africa and Central Europe. Further large-scale studies are needed to reveal the significance of certain avian species in the maintenance and competence as reservoirs for different tick-borne pathogens in Europe.

Acknowledgments

This study was supported by Estonian Science Foundation, ETF grant 8691 and Estonian Ministry Education and Research, project SF0940033s09. We are grateful to all bird-ringers who collected ticks from birds trapped in Kabli and Pulgoja bird stations.

Author Disclosure Statement

No competing financial interests exist.

References

  1. Alekseev AN. Dubinina HV. Van De Pol I. Schouls LM. Identification of Ehrlichia spp. and Borrelia burgdorferi in Ixodes ticks in the Baltic regions of Russia. J Clin Microbiol. 2001;39:2237–2242. doi: 10.1128/JCM.39.6.2237-2242.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bjoersdorff A. Bergstrom S. Massung RF. Haemig PD, et al. Ehrlichia-infected ticks on migrating birds. Emerg Infect Dis. 2001;7:877–879. doi: 10.3201/eid0705.017517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Comstedt P. Bergstrom S. Olsen B. Garpmo U, et al. Migratory passerine birds as reservoirs of Lyme borreliosis in Europe. Emerg Infect Dis. 2006;12:1087–1095. doi: 10.3201/eid1207.060127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Courtney JW. Kostelnik LM. Zeidner NS. Massung RF. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J Clin Microbiol. 2004;42:3164–3168. doi: 10.1128/JCM.42.7.3164-3168.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Daniels TJ. Battaly GR. Liveris D. Falco RC, et al. Avian reservoirs of the agent of human granulocytic ehrlichiosis? Emerg Infect Dis. 2002;8:1524–1525. doi: 10.3201/eid0812.010527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Derdakova M. Beati L. Pet'ko B. Stanko M, et al. Genetic variability within Borrelia burgdorferi sensu lato genospecies established by PCR-single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacer in Ixodes ricinus ticks from the Czech Republic. Appl Environ Microbiol. 2003;69:509–516. doi: 10.1128/AEM.69.1.509-516.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dubska L. Literak I. Kocianova E. Taragelova V, et al. Differential role of passerine birds in distribution of Borrelia spirochetes, based on data from ticks collected from birds during the postbreeding migration period in Central Europe. Appl Environ Microbiol. 2009;75:596–602. doi: 10.1128/AEM.01674-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Franke J. Meier F. Moldenhauer A. Straube E, et al. Established and emerging pathogens in Ixodes ricinus ticks collected from birds on a conservation island in the Baltic Sea. Med Vet Entomol. 2010a;24:425–432. doi: 10.1111/j.1365-2915.2010.00905.x. [DOI] [PubMed] [Google Scholar]
  9. Franke J. Moldenhauer A. Hildebrandt A. Dorn W. Are birds reservoir hosts for Borrelia afzelii? Ticks Tick Borne Dis. 2010b;1:109–112. doi: 10.1016/j.ttbdis.2010.03.001. [DOI] [PubMed] [Google Scholar]
  10. Georgopoulou I. Tsiouris V. The potential role of migratory birds in the transmission of zoonoses. Vet Ital. 2008;44:671–677. [PubMed] [Google Scholar]
  11. Gern L. Douet V. Lopez Z. Rais O, et al. Diversity of Borrelia genospecies in Ixodes ricinus ticks in a Lyme borreliosis endemic area in Switzerland identified by using new probes for reverse line blotting. Ticks Tick Borne Dis. 2010;1:23–29. doi: 10.1016/j.ttbdis.2009.11.001. [DOI] [PubMed] [Google Scholar]
  12. Golovljova I. Vene S. Sjolander KB. Vasilenko V, et al. Characterization of tick-borne encephalitis virus from Estonia. J Med Virol. 2004;74:580–588. doi: 10.1002/jmv.20224. [DOI] [PubMed] [Google Scholar]
  13. Gylfe A. Bergstrom S. Lundstrom J. Olsen B. Reactivation of Borrelia infection in birds. Nature. 2000;403:724–725. doi: 10.1038/35001663. [DOI] [PubMed] [Google Scholar]
  14. Hanincova K. Schafer SM. Etti S. Sewell HS, et al. Association of Borrelia afzelii with rodents in Europe. Parasitology. 2003a;126:11–20. doi: 10.1017/s0031182002002548. [DOI] [PubMed] [Google Scholar]
  15. Hanincova K. Taragelova V. Koci J. Schafer SM, et al. Association of Borrelia garinii and B. valaisiana with songbirds in Slovakia. Appl Environ Microbiol. 2003b;69:2825–2830. doi: 10.1128/AEM.69.5.2825-2830.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hasle G. Bjune GA. Midthjell L. Roed KH, et al. Transport of Ixodes ricinus infected with Borrelia species to Norway by northward-migrating passerine birds. Ticks Tick Borne Dis. 2011;2:37–43. doi: 10.1016/j.ttbdis.2010.10.004. [DOI] [PubMed] [Google Scholar]
  17. Hu CM. Humair PF. Wallich R. Gern L. Apodemus sp. rodents, reservoir hosts for Borrelia afzelii in an endemic area in Switzerland. Zentralbl Bakteriol. 1997;285:558–564. doi: 10.1016/s0934-8840(97)80117-x. [DOI] [PubMed] [Google Scholar]
  18. Humair PF. Postic D. Wallich R. Gern L. An avian reservoir (Turdus merula) of the Lyme borreliosis spirochetes. Zentralbl Bakteriol. 1998;287:521–538. [PubMed] [Google Scholar]
  19. Humair PF. Rais O. Gern L. Transmission of Borrelia afzelii from Apodemus mice and Clethrionomys voles to Ixodes ricinus ticks: Differential transmission pattern and overwintering maintenance. Parasitology. 1999;118(Pt 1):33–42. doi: 10.1017/s0031182098003564. [DOI] [PubMed] [Google Scholar]
  20. Jaaskelainen AE. Sironen T. Murueva GB. Subbotina N, et al. Tick-borne encephalitis virus in ticks in Finland, Russian Karelia and Buryatia. J Gen Virol. 2010;91:2706–2712. doi: 10.1099/vir.0.023663-0. [DOI] [PubMed] [Google Scholar]
  21. Katargina O. Geller J. Alekseev A. Dubinina H, et al. Identification of Anaplasma phagocytophilum in tick populations in Estonia, the European part of Russia and Belarus. Clin Microbiol Infect. 2012;18:40–46. doi: 10.1111/j.1469-0691.2010.03457.x. [DOI] [PubMed] [Google Scholar]
  22. Kipp S. Goedecke A. Dorn W. Wilske B, et al. Role of birds in Thuringia, Germany, in the natural cycle of Borrelia burgdorferi sensu lato, the Lyme disease spirochaete. Int J Med Microbiol. 2006;296(Suppl 40):125–128. doi: 10.1016/j.ijmm.2006.01.001. [DOI] [PubMed] [Google Scholar]
  23. Kjelland V. Stuen S. Skarpaas T. Slettan A. Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from migratory birds in Southern Norway. Acta Vet Scand. 2010;52:59. doi: 10.1186/1751-0147-52-59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kurtenbach K. Schafer SM. Sewell HS. Peacey M, et al. Differential survival of Lyme borreliosis spirochetes in ticks that feed on birds. Infect Immun. 2002;70:5893–5895. doi: 10.1128/IAI.70.10.5893-5895.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lommano E. Burri C. Maeder G. Guerne M, et al. Prevalence and genotyping of tick-borne encephalitis virus in questing Ixodes ricinus ticks in a new endemic area in western Switzerland. J Med Entomol. 2012;49:156–164. doi: 10.1603/me11044. [DOI] [PubMed] [Google Scholar]
  26. Olsen B. Jaenson TG. Bergstrom S. Prevalence of Borrelia burgdorferi sensu lato-infected ticks on migrating birds. Appl Environ Microbiol. 1995;61:3082–3087. doi: 10.1128/aem.61.8.3082-3087.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Palomar AM. Santibanez P. Mazuelas D. Roncero L, et al. Role of birds in dispersal of etiologic agents of tick-borne zoonoses, Spain, 2009. Emerg Infect Dis. 2012;18:1188–1191. doi: 10.3201/eid1807.111777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Postic D. Assous MV. Grimont PA. Baranton G. Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. Int J Syst Bacteriol. 1994;44:743–752. doi: 10.1099/00207713-44-4-743. [DOI] [PubMed] [Google Scholar]
  29. Poupon M. Lommano E. Humair PF. Douet V, et al. Prevalence of Borrelia burgdorferi sensu lato in ticks collected from migratory birds in Switzerland. Appl Environ Microbiol. 2006;72:976–979. doi: 10.1128/AEM.72.1.976-979.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rar VA. Fomenko NV. Dobrotvorsky AK. Livanova NN, et al. Tickborne pathogen detection, Western Siberia, Russia. Emerg Infect Dis. 2005;11:1708–1715. doi: 10.3201/eid1111.041195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schwaiger M. Cassinotti P. Development of a quantitative real-time RT-PCR assay with internal control for the laboratory detection of tick borne encephalitis virus (TBEV) RNA. J Clin Virol. 2003;27:136–145. doi: 10.1016/s1386-6532(02)00168-3. [DOI] [PubMed] [Google Scholar]
  32. Skarpaas T. Golovljova I. Vene S. Ljostad U, et al. Tickborne encephalitis virus, Norway and Denmark. Emerg Infect Dis. 2006;12:1136–1138. doi: 10.3201/eid1207.051567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Suss J. Tick-borne encephalitis 2010: Epidemiology, risk areas, and virus strains in Europe and Asia-an overview. Ticks Tick Borne Dis. 2011;2:2–15. doi: 10.1016/j.ttbdis.2010.10.007. [DOI] [PubMed] [Google Scholar]
  34. Taragel'ova V. Koci J. Hanincova K. Kurtenbach K, et al. Blackbirds and song thrushes constitute a key reservoir of Borrelia garinii, the causative agent of borreliosis in Central Europe. Appl Environ Microbiol. 2008;74:1289–1293. doi: 10.1128/AEM.01060-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Waldenstrom J. Lundkvist A. Falk KI. Garpmo U, et al. Migrating birds and tickborne encephalitis virus. Emerg Infect Dis. 2007;13:1215–1218. doi: 10.3201/eid1308.061416. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Vector Borne and Zoonotic Diseases are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES