Skip to main content
Immunology logoLink to Immunology
. 2013 Jun 13;139(3):318–327. doi: 10.1111/imm.12070

The transcription factor Fli-1 regulates monocyte, macrophage and dendritic cell development in mice

Eiji Suzuki 1, Sarah Williams 2, Shuzo Sato 1, Gary Gilkeson 1,2, Dennis K Watson 3, Xian K Zhang 1,2
PMCID: PMC3701178  PMID: 23320737

Abstract

Fli-1 belongs to the Ets transcription factor family and is expressed in haematopoietic cells, including most of the cells that are active in immunity. The mononuclear phagocytes, i.e. monocytes, macrophages and dendritic cells, originate in haematopoietic stem cells and play an important role in immunity. To assess the role of Fli-1 in mononuclear phagocyte development in vivo, we generated mice that express a truncated Fli-1 protein, lacking the C-terminal transcriptional activation domain (Fli-1ΔCTA). Fli-1ΔCTACTA mice had significantly increased populations of haematopoietic stem cells and common dendritic cell precursors in bone marrow compared with wild-type littermates. Significantly increased classical dendritic cells, plasmacytoid dendritic cells, and macrophage populations were found in spleens from Fli-1ΔCTACTA mice compared with wild-type littermates. Fli-1ΔCTACTA mice also had increased pre-classical dendritic cell and monocyte populations in peripheral blood mononuclear cells. Furthermore, bone marrow reconstitution studies demonstrated that expression of Fli-1 in both haematopoietic cells and stromal cells affected mononuclear phagocyte development in mice. Expression of Fms-like tyrosine kinase 3 ligand (Flt3L), a haematopoietic growth factor, in multipotent progenitors was statistically significantly increased from Fli-1ΔCTACTA mice compared with wild-type littermates. Fli-1 protein binds directly to the promoter region of the Flt3L gene. Hence, Fli-1 plays an important role in the mononuclear phagocyte development, and the C-terminal transcriptional activation domain of Fli-1 negatively modulates mononuclear phagocyte development.

Keywords: dendritic cells, Fli-1 transcription factor, Fms-related tyrosine kinase 3 ligand, macrophages, monocytes

Introduction

Leucocytes are divided into several subtypes of cells by functional and physical characteristics. They have a common origin in haematopoietic stem cells (HSCs) and develop along distinct differentiation pathways in response to internal and external cues.1 The mononuclear phagocytes, i.e. monocytes, macrophages and dendritic cells, represent a subgroup of leucocytes. Monocytes are circulating blood leucocytes that play important roles in the inflammatory response, which is essential for the innate response to pathogens, development and homeostasis, in part via the removal of apoptotic cells and scavenging of toxic compounds. Furthermore, monocytes function as a considerable systemic reservoir of myeloid precursors for the renewal of some tissue macrophages and antigen-presenting dendritic cells (DCs).2 Macrophages are innate immune cells with well-established roles not only in the primary response to pathogens, but also in tissue homeostasis, coordination of adaptive immune response, inflammation, resolution and repair.3 Dendritic cells are named for their unique morphology, which is characterized by dendrite-like extensions that mediate cell contact to regulate lymphocytes via antigen presentation, and are important antigen-presenting cells for the innate and adaptive immune response to infections and for maintaining immune tolerance to self-tissue.4,5 The DCs are a heterogeneous population of cells that can be divided into two major populations: classical DCs (cDCs) and plasmacytoid DCs (pDCs). Classical DCs are specialized antigen-processing and antigen-presenting cells, equipped with high phagocytic activity as immature cells and high cytokine-producing capacity as mature cells; pDCs are specialized to respond to viral infection with massive production of type I interferon; however, they can also act as antigen-presenting cells and regulate T-cell responses.1 These mononuclear phagocytes are important sources of inflammatory cytokines, including tumour necrosis factor-α, interleukin-6 (IL-6), IL-1β etc., and chemokines.1,6

Recent studies revealed progenitors and differentiated cell populations of monocytes, macrophages and DCs, on the basis of the expression of multiple cell surface markers.2,7 Commitment to the mononuclear phagocyte lineage is determined at the stage of the macrophage and DC progenitor (MDP), at which point, erythroid, megakaryocyte, lymphoid and granulocyte fates have been precluded. The MDP give rise to monocytes and common DC progenitors (CDPs). Although monocytes can directly participate in immune responses or differentiate into macrophages or DCs, the differentiation potential of CDPs is restricted to the DC lineage. Common DPs give rise to cDCs and pre-classical DCs (pre-cDCs), which subsequently give rise to DCs.8 In these differentiation steps, several cytokines and transcription factors have been identified as key molecules in regulating mononuclear phagocyte development. Several reports have demonstrated that granulocyte–macrophage colony-stimulating factor (GM-CSF) drives inflammatory DC development from monocytes, and FMS-like tyrosine kinase 3 ligand (Flt3L) plays a critical role in the development of cDCs and pDCs in the steady state.4,5,9 The use of knockout mouse models revealed key roles of several transcription factors in DC development. Many transcription factors – including interferon regulatory factors, signal transducers and activators of transcription proteins (STATs), and Ets gene family members (SpiB, PU.1) –participate in DC differentiation and homeostasis.4,5,911

The Fli-1 gene is a member of the Ets gene family of transcription factors.12,13 Members of the Ets gene family are found in genomes of diverse organisms, including Drosophila, Xenopus, sea urchin, chicken, mouse and human.1416 Like other Ets gene family members, Fli-1 has the conserved DNA binding sequence, the Ets domain. Ets proteins bind to DNA sequences that contain a consensus GGA(A/T) core motif (Ets binding site) and function as either transcriptional activators or repressors.15,16 It has also been demonstrated that the Fli-1 transcription factor plays an important role in megakaryocytic differentiation and B-cell development.1722 Targeted disruption of the Fli-1 gene resulted in haemorrhage into the neural tube and embryonic death, due in part to thrombocytopenia.23 We have reported that the number of platelets in the peripheral blood was reduced, and platelet aggregation and activation were also impaired in homozygous mutant Fli-1 mice that express Fli-1 protein (Fli-1ΔCTA) with a truncated C-terminal regulatory (CTA) domain.24 Expression of Fli-1 has been implicated in systemic lupus erythematosus in both human patients and murine models.2527

In this report, we investigated the role of Fli-1 in development of monocytes, macrophages and DCs. We found that populations of monocytes, macrophages and DCs were significantly increased in Fli-1ΔCTA/ΔCTA mice compared with wild-type littermates, and expression of Fli-1 in both haematopoietic cells and stromal cells has an effect on mononuclear phagocyte development. Expression of Flt3L was statistically higher in multipotent progenitors from Fli-1ΔCTA/ΔCTA mice compared with wild-type controls, and Fli-1 directly binds to the promoter of the Flt3L gene. Our results indicate the Fli-1 gene plays an important role in regulating mononuclear phagocyte development.

Materials and methods

Mice and cell lines

Generation of the Fli-1 allele (Fli-1ΔCTA) that encodes the truncated Fli-1 protein (amino acids 1–384) mice has been described in detail.24 The mice were backcrossed with C57BL/6 (B6) mice for at least eight generations and then used in this study. All mice were maintained in specific-pathogen-free animal facilities of the Ralph H. Johnson Veterans Affairs Medical Center, and all animal procedures were approved by the institutional animal care and use committee.

Murine endothelial cell line MS1 was purchased from the American Type Culture Collection (ATCC, Bethesda, MD) and maintained with Dulbecco's modified Eagle's medium with 5% fetal bovine serum.

Bone marrow transplantation

Four groups of 8- to 12-week-old B6 mice (five mice/group) were irradiated (600 Gy), as previously described.22 After final irradiation, each mouse in the four groups received 1 million bone marrow (BM) cells by tail vein injection. The BM cells were collected from the femurs of donor mice at the age of 8–12 weeks. In group 1, wild-type B6 mice received BM cells from Fli-1ΔCTA/ΔCTA B6 donor mice. In group 2, Fli-1ΔCTA/ΔCTA mice received BM cells from wild-type B6 donor mice. In group 3, wild-type B6 mice received BM cells from wild-type B6 donor mice. In group 4, Fli-1ΔCTA/ΔCTA mice received BM cells from Fli-1ΔCTA/ΔCTA B6 donor mice; another two groups of wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice were used as controls without irradiation and BM transplantation.

All irradiated mice were treated with 1 mg/ml neomycin sulphate for 3 weeks while recovering from bone marrow transplantation. Peripheral blood cells were collected from the four groups and wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice 8 weeks after bone marrow transplantation.

Flow cytometry analysis

Single-cell suspensions were prepared from spleen, bone marrow or peripheral blood from the wild-type B6 mice and Fli-1ΔCTA/ΔCTA mice at the age of 8–12 weeks. The cells were stained with fluorochrome-conjugated or biotin-conjugated antibodies and analysed on a FACSCalibur flow cytometer. Data were analysed using cellquest (BD Immunocytometry System, San Jose, CA) software. The antibodies were purchased from BD Pharmingen (San Diego, CA) or eBioscience (San Diego, CA). The following specific antibodies were used to characterize cell subsets: HSCs (Sca-1+ c-kit+ CD3e CD4 CD8a CD11b CD11c CD19 B220 NK1.1 Ter119); common DC precursors (Sca-1 c-kitlow CD115+ Flt3+ CD3e CD4CD8a CD11b CD11c CD19 B220 NK1·1 Ter119); macrophage/DC progenitors (Sca-1 c-kithigh CD115+ Flt3+ CD3e CD4 CD8a CD11b CD11c CD19 B220 NK1.1 Ter119); pre-cDC (I-AbCD11cint Flt3+ SIRPαint); pDCs (I-Ab CD11cint B220+CD3e CD19 NK1·1 Ter119); CD8+ cDCs (I-Ab+ CD11c+ CD4 CD8a+); CD4+ cDCs (I-Ab+ CD11c+CD4+ CD8a); double-negative DCs (I-Ab+ CD11c+CD4 CD8a); macrophages (CD11b+ CD11clow F4/80+); monocytes (CD11b+ CD11c CD115+).

Bone marrow cell culture and sorting

Bone marrow suspensions were prepared from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. Cells were cultured in RPMI-1640 medium with 2 mm l-glutamine (Mediatech Inc., Manassas, VA), supplemented with 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA), 100 U/ml penicillin/streptomycin (Mediatech Inc.), and 50 μm 2-ME (Invitrogen Life Technologies, Carlsbad, CA) with 25 ng/ml Flt3L (eBioscience), 30 U/ml stem cell factor (eBioscience), 2·5 ng/ml IL-6 (eBioscience), 2·5 ng/ml IL-6R (BioLegend, San Diego, CA) and 40 ng/ml long-range insulin-like growth factor-1 (Sigma-Aldrich, St Louis, MO). After 3 days of culture, cells were subjected to Ficoll–Hypaque density gradient centrifugation. Cells were kept at 2 × 106 cells/ml and refreshed with medium and cytokines every second day. Progenitor cells were harvested on day 7 of culture.

Amplified multipotent progenitors (MPPs) were sorted as Flt3–/low c-kithigh CD11c cells, at day 7 of culture. Cultures were deprived of cytokines for 1·5–2 hr pre-staining for flow cytometry. Cell sorting was performed with a FACSAria device (BD Biosciences).

Real-time PCR

Total RNA was prepared from cultured MPPs for real-time PCR analysis. A total of 1 μg RNA was used to synthesize cDNA (RT2 First Strand Kit; Qiagen, Tokyo, Japan). Real-time PCR was performed according to the manufacturer's instructions, in triplicate using rt2 sybr green rox qpcr mastermix (Qiagen) and primers were purchased from Qiagen. PCR was performed using the myiq machine (Bio-Rad, Hercules, CA) and relative expression analysis was performed according to the manufacturer's instructions. The cycling conditions for all genes were: pre-incubation at 95° for 10 min, followed by 40 cycles of denaturation at 95° for 15 seconds, and annealing and extension at 60° for 1 min, with a single data acquisition at the end of each extension.

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (ChIP) assay was performed as we have described previously using anti-Fli-1 rabbit polyclonal antibody.22 The primers used for the ChIP assay are listed in Table 1.

Table 1.

PCR primer sequences for mouse Flt3L-1 promoter ChIP assay

Primer name Forward primer Reverse primer Position from TSSa Amplicon length
ChIP 1 AAACGCACCCACATCAAGG AAGTGACAGGAGGGCAGGTC 93–195 103
ChIP 2 AGACCTGGGGAGGATTCTGG CCTTGATGTGGGTGCGTTTC −13 to 111 125
ChIP 3 CTGGCACTGTCTACCCCAAA CCTTGATGTGGGTGCGTTTC −183 to −79 105
ChIP 4 AGGCTGGAGGTTCACAAGTTC ATTCACCCCACGCACCA −459 to −358 102
ChIP 5 AACAAGGCCAGCCTCCAAC AACTTGTGAACCTCCAGCCTCT −585 to −440 146
ChIP 6 CCAAGAGAATGCCCACCTGA CCACCTCACCCCTCCACATA −1074 to −941 134
ChIP 7 TTCTTGGGGAAGGGTGTCAT CAGGTGGGCATTCTCTTGG −1204 to −1056 149
ChIP 8 TGCTGCTTAGGCGAGTCATAG CACCCTGCTTTGCCCTTATC −1360 to −1227 134
ChIP 9 AACCAAAACCAAAGCCCAGA ATTCTTCCGTGGCTGTTTCC −1437 to −1294 144
ChIP 10 TCTGAATTGCCTCTGTGTGGA AGGATGTGTCTGGGCTTTGG −1539 to −1410 130
ChIP 11 GTCTGGCTTGCCTGGAGATG GGTGGATTGCTTGTTCTTGG −1863 to −1725 139
ChIP 12 CAGAGCCCAGAGGAGCATAGA AGGCAGACCAGACTAGGTGGAG −1992 to −1851 142
ChIP 13 CTGGAGATACCAGCAGTGTGAA GGCAAGTTTGTTTGCTTTGG −2547 to −2399 149
ChIP 14 TCCAGGCCAGGGCTACATAC GGGCGGGAGAATCACAGTA −2727 to −2603 125
ChIP 15 TGGACACATGAGGTCAGAAGAGA AATGTGGGGCTGAAAGATG −2963 to −2836 128
a

TSS, translation start site.

Statistical analysis

The unpaired Student's t-test was used to determine significant differences between the two groups. A P < 0·05 was considered to be statistically significant.

Results

Increased HSCs and CDP cell populations in bone marrow from Fli-1ΔCTA/ΔCTA mice

First, we isolated bone marrow cells from the femurs of wild-type and Fli-1ΔCTA/ΔCTA mice and analysed the HSCs and mononuclear phagocyte populations with flow cytometry. Definition of HSC and CDP analysis was described in the Materials and Methods section. The percentage of HSCs was significantly increased in Fli-1ΔCTA/ΔCTA compared with wild-type mice (wild-type, 0·602 ± 0·044% versus Fli-1ΔCTA/ΔCTA, 0·914 ± 0·058%, n = 4 in each group, P = 0·0052, Fig. 1a,d). The percentage of CDPs was also significantly increased in Fli-1ΔCTA/ΔCTA compared with wild-type mice (wild-type, 0·246 ± 0·028% versus Fli-1ΔCTA/ΔCTA, 0·454 ± 0·061%, n = 4 in each group, P = 0·0215, Fig. 1b,d). There were no significant differences in the percentage of MDP and pre-cDCs in bone marrow from Fli-1ΔCTA/ΔCTA mice compared with wild-type mice (Fig. 1b,c,d).

Figure 1.

Figure 1

Increased haematopoietic stem cells (HSCs) and common dendritic cell precursors (CDPs) in bone marrow in Fli-1ΔCTA/ΔCTA B6 mice. Flow cytometric analyses of HSCs, monocyte, macrophage and dendritic cell precursors (MDPs), CDPs and pre-classical dendritic cells (pre-cDCs) in bone marrow cells in wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice were performed. (a) HSCs were defined as lineage (CD3e, CD4, CD8a, CD11b, CD11c, CD19, B220, NK1.1 and Ter119) c-kit+ Sca-1+. (b) CDPs and MDPs were defined as lineage Sca-1 Flt3+ CD115+ c-kitlow and lineage Sca-1 Flt3+ CD115+ c-kithigh, respectively. (c) Pre-cDCs were defined as I-Ab CD11cint Flt3+ SIRPαint. The numbers represent the percentage of cells in indicated gates. (d) The percentage of HSCs, MDPs, CDPs and pre-cDCs in the bone marrow from Fli-1ΔCTA/ΔCTA mice and controls. Mean ± SD of the cells from a minimum of four mice are shown. Data are representative of three independent experiments. *P < 0·05, **P < 0·01.

Significantly increased cDC, pDC and macrophage populations in spleens from Fli-1ΔCTA/ΔCTA mice

Next, we investigated the DC and macrophage populations in spleens from Fli-1ΔCTA/ΔCTA mice and wild-type littermate controls. The percentage and absolute cell number of cDCs (I-Ab+ CD11c+) was significantly increased in the spleen from Fli-1ΔCTA/ΔCTA mice compared with wild-type mice (for the percentage, wild-type, 3·845 ± 0·222% versus Fli-1ΔCTA/ΔCTA, 7·325 ± 0·582%, n = 4 in each group, P = 0·0014; for the absolute cell number, wild-type, 4·458 × 106 ± 0·553 × 106 versus Fli-1ΔCTA/ΔCTA, 15·10 × 106 ± 1·791 × 106, n = 4 in each group, P = 0·0013, Fig. 2a,e,g). We further analysed subgroup populations of cDCs, i.e. CD8+ cDCs (CD8a+ CD4), CD4+ cDCs (CD8a CD4+), and double-negative (DN) cDCs (CD8a CD4). The percentages of CD8+ cDCs, CD4+ cDCs and DN cDCs in the spleen from Fli-1ΔCTA/ΔCTA mice were significantly increased compared with wild-type mice (for CD8+ cDC, wild-type, 0·778 ± 0·091% versus Fli-1ΔCTA/ΔCTA, 1·263 ± 0·104%, n = 4 in each group, P = 0·0126; for CD4+ cDC, wild-type, 0·618 ± 0·037% versus Fli-1ΔCTA/ΔCTA, 1·248 ± 0·092%, n = 4 in each group, P = 0·0007; for DN cDC, wild-type, 2·015 ± 0·089% versus Fli-1ΔCTA/ΔCTA, 4·223 ± 0·368%, n = 4 in each group, P = 0·0011, Fig. 2a,e). The absolute cell numbers of those three groups of cells were significantly increased in the spleens from Fli-1ΔCTA/ΔCTA mice compared with wild-type littermates (for CD8+ cDC, wild-type, 0·902 × 106 ± 0·151 × 106 versus Fli-1ΔCTA/ΔCTA, 2·572 × 106 ± 0·211 × 106, n = 4 in each group, P = 0·0007; for CD4+ cDC, wild-type, 0·718 × 106 ± 0·095 × 106 versus Fli-1ΔCTA/ΔCTA, 2·579 × 106 ± 0·318 × 106, n = 4 in each group, P = 0·0014; for DN cDC, wild-type, 2·326 × 106 ± 0·251 × 106 versus Fli-1ΔCTA/ΔCTA, 8·734 × 106 ± 1·157 × 106, n = 4 in each group, P = 0·0016, Fig. 2g). The populations of pDCs, pre-cDCs and macrophages were significantly increased in spleens from Fli-1ΔCTA/ΔCTA mice when compared with those cells from wild-type controls (for pDCs, wild-type, 0·165 ± 0·022% versus Fli-1ΔCTA/ΔCTA, 0·285 ± 0·019%, n = 4 in each group, P = 0·0062; for pre-cDCs, wild-type, 0·0250 ± 0·0065% versus Fli-1ΔCTA/ΔCTA, 0·0825 ± 0·0018%, n = 4 in each group, P = 0·0237; for macrophages, wild-type, 0·540 ± 0·085% versus Fli-1ΔCTA/ΔCTA, 1·553 ± 0·209%, n = 4 in each group, P = 0·041, Fig. 2b,c,d,f). The absolute cell numbers of pDCs, pre-cDCs, and macrophages in spleen cells in Fli-1ΔCTA/ΔCTA mice were significantly increased compared with wild-type mice (for pDCs, wild-type, 1·928 × 105 ± 0·380 × 105 versus Fli-1ΔCTA/ΔCTA, 5·803 × 105 ± 0·253 × 105, n = 4 in each group, P = 0·0001; pre-cDCs, wild-type, 0·298 × 105 ± 0·066 × 105 versus Fli-1ΔCTA/ΔCTA, 1·690 × 105 ± 0·462 × 105, n = 4 in each group, P = 0·0245; for macrophages, wild-type, 6·278 × 105 ± 01·325 × 105 versus Fli-1ΔCTA/ΔCTA, 32·79 × 105 ± 6·928 × 105, n = 4 in each group, P = 0·0094, Fig. 2h).

Figure 2.

Figure 2

Increased classical dendritic cells (cDCs), plasmacytoid dendritic cells (pDCs) and macrophages in spleen cells in Fli-1ΔCTA/ΔCTA B6 mice. Flow cytometric analysis of cDCs, pDCs, pre-cDCs, and macrophages in spleen cells from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice were performed. (a) cDCs were defined as I-Ab+ and CD11c+, then cDCs were divided into three groups; CD8+ cDCs (CD8+ CD4), CD4+ cDCs (CD8 CD4+), and double-negative (DN) cDCs (CD8 CD4). (b) pDCs were defined as CD3e CD19 NK1.1 Ter119 I-Ab− CD11cint B220+. (c) Pre-cDCs were defined as I-Ab CD11cint Flt3+ SIRPαint. (d) Macrophages were defined as CD11b+ CD11clow F4/80+. The numbers represent the percentage of cells in the indicated gates. (e) The percentage of CD8 cDCs, CD4 cDCs and DN cDCs in the spleens from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. (f) The percentage of pDCs, pre-cDCs and macrophages in the spleens from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. (g) The absolute number of CD8 cDCs, CD4 cDCs and DN cDCs in the spleens from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. (h) The absolute number of pDCs, pre-cDCs, and macrophages in the spleens from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. Mean ± SD of the cells from a minimum of four mice are shown. Data are representative of three independent experiments. *P < 0·05, **P < 0·01, ***P < 0·001, ****P < 0·0001.

Significantly increased pre-cDC and monocyte populations in peripheral blood mononuclear cells from Fli-1ΔCTA/ΔCTA mice

We checked for differences in the percentage of DC populations in peripheral blood mononuclear cells (PBMCs) between Fli-1ΔCTA/ΔCTA mice and wild-type controls. Total blood cells were collected from each mouse, and PBMCs were prepared by using red blood cell lysis buffer. The percentages of pre-cDCs and monocytes were significantly increased in Fli-1ΔCTA/ΔCTA compared with wild-type mice (for pre-cDCs, wild-type, 0·0325 ± 0·0075% versus Fli-1ΔCTA/ΔCTA, 0·0725 ± 0·0085%, n = 4 in each group, P = 0·0125; for monocytes, wild-type, 0·1500 ± 0·0334% versus Fli-1ΔCTA/ΔCTA, 0·375 ± 0·0337%, n = 4 in each group, P = 0·0032, Fig. 3b,c,d). There was no significant difference in the percentage of pDCs obtained from Fli-1ΔCTA/ΔCTA mice and wild-type control mice (Fig. 3a,d).

Figure 3.

Figure 3

Increased monocytes in peripheral blood mononuclear cells (PBMCs) in Fli-1ΔCTA/ΔCTA B6 mice. Flow cytometric analysis of pre-classical dendritic cells (pre-cDCs), plasmacytoid dendritic cells (pDCs), and monocytes in PBMCs from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice were performed. (a) Pre-cDCs were defined as I-Ab CD11cint Flt3+ SIRPαint. (b) pDCs were defined as CD3e CD19 NK1.1 Ter119 I-Ab− CD11cint B220+. (c) Monocytes were defined as CD11b+ CD11c CD115+. The numbers represent the percentage of cells in indicated gates. (d) The percentage of pre-cDCs, pDCs, and monocytes in the PBMCs from wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice. Mean ± SD of the cells from a minimum of four mice are shown. Data are representative of three independent experiments. **P < 0·01.

Expression of Fli-1 in both haematopoietic cells and stromal cells affects mononuclear phagocyte development in mice

To investigate if expression of Fli-1 in haematopoietic cells or stromal cells affects mononuclear phagocyte development, we transplanted BM cells from Fli-1ΔCTA/ΔCTA mice or wild-type mice to recipient mice (irradiated wild-type mice or Fli-1ΔCTA/ΔCTA mice), and analysed DC and monocyte populations in PBMCs. To monitor the efficiency, we transferred bone marrow cells from wild-type or Fli-1ΔCTA/ΔCTA mice with the Ly5.2 (CD45.2) genotype into sublethally irradiated B6 mice with the Ly5.1 (CD45.1) genotype. We have found that over 99% of PBMCs and spleen cells from the recipients were CD45.2+ indicating that the reconstituting haematopoietic cells in the recipients were derived from donor BM (data not shown). The percentages of pre-cDCs in wild-type B6 mice receiving BM cells from Fli-1ΔCTA/ΔCTA B6 mice (FW) was significantly increased compared with wild-type B6 mice receiving BM cells from wild-type B6 mice (WW) (FW, 0·158 ± 0·026% versus WW, 0·070 ± 0·019%, n = 4 or n = 5 in each group, P = 0·026, Fig. 4a). The percentage of pre-cDCs in Fli-1ΔCTA/ΔCTA B6 mice receiving BM cells from wild-type B6 mice (WF) tended to be higher compared with WW, but did not reach statistical significance (WF, 0·198 ± 0·070% versus WW, 0·070 ± 0·019%, n = 4 or n = 5 in each group, P = 0·0901, Fig. 4a). The percentage of monocytes in WF was significantly increased compared with WW (WF, 1·144 ± 0·123% versus WW, 0·649 ± 0·111%, n = 4 or n = 5 in each group, P = 0·0205, Fig. 4c). In the percentage of pDCs, there were no significant differences among each group (Fig. 4b).

Figure 4.

Figure 4

Increase of preclassical dendritic cells (pre-cDC) in wild-type B6 mice receiving bone marrow (BM) cells from Fli-1ΔCTA/ΔCTA B6 mice, and monocytes in Fli-1ΔCTA/CTA B6 mice receiving BM cells from wild-type B6 mice in peripheral blood mononuclear cells (PBMCs). Wild-type B6 mice and Fli-1ΔCTA/ΔCTA B6 mice were irradiated at 600 Gy at the age of 8 weeks, and received BM cells from wild-type B6 mice or Fli-1ΔCTA/ΔCTA B6 mice. The PBMCs were collected from the mice after 8 weeks of bone marrow transplantation, and flow cytometric analyses were performed. FW: wild-type B6 mice received BM cells from Fli-1ΔCTA/ΔCTA B6 mice (n = 5), WF: Fli-1ΔCTA/ΔCTA B6 mice received BM cells from wild-type B6 mice (n = 4), WW: wild-type B6 mice received BM cells from wild-type B6 mice (n = 5), FF: Fli-1ΔCTA/ΔCTA B/6 mice received BM cells from Fli-1ΔCTA/ΔCTA B6 mice (n = 2), W: wild-type B6 mice (n = 4), F: Fli-1ΔCTA/ΔCTA B6 mice (n = 5). (a), The percentage of pre-cDCs in PBMCs from six groups of mice. Pre-cDCs were defined as I-Ab CD11cint Flt3+ SIRPαint. (b), The percentage of plasmacytoid dendritic cells (pDCs) in PBMCs from six groups of mice. pDCs were defined as CD3e CD19 NK1.1 Ter119 I-Ab− CD11cint B220+. (c), The percentage of monocytes in PBMCs from six groups of mice. Monocytes were defined as CD11b+ CD11c CD115+. *P < 0·05.

Expression of Flt3L in MPPs were increased from Fli-1ΔCTA/ΔCTA mice

To investigate the molecular mechanisms of Fli-1 effects on mononuclear phagocyte development, we investigated the differences of key genes expressed in MPPs between Fli-1ΔCTA/ΔCTA mice and wild-type littermates. The BM cells from Fli-1ΔCTA/ΔCTA mice and wild-type littermates were isolated and cultured in the presence of Flt3L, stem cell factor, IL-6, IL-6R and insulin-like growth factor-1. After 7 days in culture, MPPs were sorted by FACSAir, and then total RNA was prepared from the cells and converted to cDNAs. The gene expression of FMS-like tyrosine 3 (Flt3), Flt3 ligand (Flt3L), colony-stimulating factor 2 receptor α (Csf2ra), colony-stimulating factor 1 (Csf1), Csf1 receptor (Csf1r), STAT3, interferon regulatory factor (Irf) 2, Irf8, PU.1, IKAROS family zinc finger 1 (Ikz1), inhibitor of DNA binding 2 (Id2) and transcription factor 4 (Tcf4) was measured by real-time PCR. As shown in Fig. 5, Flt3L gene expression was significantly increased in MPPs from Fli-1ΔCTA/ΔCTA B6 mice compared with that cultured from wild-type B6 mice. The expressions of STAT3, Csf1 and Flt3 were higher in MPPS from Fli-1ΔCTA/ΔCTA B6 mice compared with that cultured from wild-type B6 mice, though the difference was not statistically significant (Fig. 5).

Figure 5.

Figure 5

Increased expression of FMS-like tyrosine kinase 3 ligand (Flt3L) in multipotent progenitors (MPPs) from Fli-1ΔCTA/ΔCTA B6 mice. Bone marrow (BM) cells were isolated from wild-type B6 and Fli-1ΔCTA/CTA B6 mice, and were cultured in RPMI-1640 medium with 2 mm l-glutamine, supplemented with 10% fetal bovine serum, 100 U/ml penicillin/streptomycin, and 50 μm 2-mercaptoethanol with 25 ng/ml Flt3L (eBioscience), 30 U/ml stem cell factor, 2·5 ng/ml interleukin-6, 2·5 ng/ml interleukin-6R, and 40 ng/ml long-range insulin-like growth factor-1. After 7 days in culture, MPPs were sorted as Flt3−/low c-kithigh CD11c cells. Total RNA was extracted from the sorted MPPs, and converted to cDNA for using real-time PCR analysis. *P < 0·05.

Fli-1 protein binds directly to the promoter region of the Flt3L gene

To assess whether Fli-1 directly or indirectly regulates the expression of Flt3L, we analysed the promoter region of the Flt3L gene. There are 15 putative Fli-1 binding sites in the promoter region of the mouse Flt3L gene. We designed 15 pairs of primers to cover these sites, and a ChIP assay was performed to examine if Fli-1 binds to the promoter of Flt3L. The primers used are listed in Table 1. We examined the expression of Fli-1 and Flt3L in MS1 endothelial cell lines by RT-PCR and found that both Fli-1 and Flt3L are expressed in the cell line (data not shown). After immunoprecipitation by a Fli-1-specific antibody with cross-linked protein/DNA complexes from MS1 cell lines, two Fli-1 sites were significantly enriched with specific Fli-1 antibodies as detected by PCR amplification and compared with normal rabbit IgG controls (Fig. 6). These results clearly indicate Fli-1 can directly bind to the promoter of the Flt3L gene and probably regulate the expression of Flt3L.

Figure 6.

Figure 6

ChIP analysis of Fli-1 binding to the Flt3L promoter. Total MS1 endothelial cells were cross-linked with formaldehyde and chromatin was isolated from cells and immunoprecipitated with specific Fli-1 antibodies or control IgG. The genomic fragments associated with immunoprecipitated DNA were amplified by RT-PCR using the primers shown in Table 1. PCR products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining. Input represents 1% total cross-linked, reversed chromatin before immunoprecipitation. Fold changes were calculated by RT-PCR.

Discussion

Fli-1 transcription factor regulates the differentiation and development of haematopoietic lineages, especially megakaryocytic and erythrocytic lineages.2830 We previously demonstrated that Fli-1 modulates B-cell development and is implicated in autoimmune disease.22,26,27,31 We report here that Fli-1 also plays an important role in mononuclear phagocyte development.

We found that Fli-1ΔCTA/ΔCTA mice had significantly increased populations of HSCs and CDPs in BM compared with wild-type littermates (Fig. 1). Therefore, Fli-1 is likely to play an important role in regulating HSC and CDP development. Expression of Fli-1 clearly affects the HSC population and lack of the CTA domain in Fli-1 resulted in the increase of the HSC population. Previous studies have demonstrated that expression of Fli-1 affects development and differentiation of megakaryocytes, erythrocytes, neutrophils and monocytes in Fli-1-deficient or Fli-1 heterozygous mice.28,29 Complete Fli-1 deficiency in HSCs resulted in a decrease in neutrophilic granulocyte and monocyte populations in mice.29 In this report, we used Fli-1ΔCTA/ΔCTA mice with expression of a truncated Fli-1 protein, lacking the C-terminal transcriptional activation domain.24 Cell proportion and absolute cell number of pDCs, cDCs, pre-cDCs and macrophages in the spleen from Fli-1ΔCTA/ΔCTA mice were significantly increased when compared with wild-type littermates (Fig. 2). The splenic cDC population can be subdivided into three groups according to their surface markers.9,32 CD4+ CD8 α CD11b+ DCs (CD4+ cDCs) are localized mostly in the marginal zone and specialize in MHC class II presentation. CD4 CD8α+ CD11b DCs (CD8+ cDCs) are localized in the T-cell zone and specialize in MHC class I presentation. CD4 CD8 α CD11b+ DCs have also been identified and are called DN cDCs.9,32 All three subtypes of DCs were significantly increased in the spleens from Fli-1ΔCTA/ΔCTA mice compared with wild-type controls. On the other hand, Fli-1ΔCTA/ΔCTA B6 mice had increased pre-cDCs and monocyte populations in PBMCs compared with wild-type littermates (Fig. 3). Despite the significant increase of macrophage and DC populations in spleens from Fli-1ΔCTA/ΔCTA mice, these mice did not show any phenotypic pathology. There were also no pathological changes in bone marrow from Fli-1ΔCTA/ΔCTA mice. The pDC population in the spleens from Fli-1ΔCTA/ΔCTA mice was significantly increased when compared with wild-type littermates (Fig. 2). The pDCs are strong producers of type I interferon, and type I interferon signature is linked to development of systemic lupus erythematosus.1,6 Expression of Fli-1 is implicated in lupus disease development in both human patients and animal models of lupus.2527 However, the interferon level in the serum is not detectable from Fli-1ΔCTA/ΔCTA mice (data not shown). It is interesting to note that Fli-1ΔCTA/ΔCTA mice had significantly increased pDCs in the spleen but not in PBMCs, expression levels of MHC on pDCs in the spleens from Fli-1ΔCTA/ΔCTA mice were similar compared with those from wild-type mice. Further study is needed to address this difference.

We have found that the pre-cDC populations in BM from Fli-1ΔCTA/ΔCTA mice were not significantly different compared with that from wild-type mice, however, both the cDC and pre-cDC populations in spleens from Fli-1ΔCTA/ΔCTA mice were higher compared with wild-type controls (Figs 1 and 2). We do not know the mechanisms that result in the increase in the pre-cDC population in the spleen of Fli-1ΔCTA/ΔCTA mice, one possibility may be a change in the migration of pre-cDCs in Fli-1ΔCTA/ΔCTA mice and more pre-cDCs are actively attracted into the spleen in these mice. The increase in cDC populations in spleen suggests that pre-cDC cells may mature in lymphoid tissues like the spleen, outside the bone marrow.

Several studies have demonstrated that stromal cells play an important role in immune cell development and that gene-deficient stromal cells affect normal immune cell development.33,34 Our bone marrow transplantation study clearly demonstrated that the expression of Fli-1 in both HSCs and stromal cells affects mononuclear phagocyte development. We found that Fli-1ΔCTA/ΔCTA B6 mice receiving BM cells from wild-type B6 mice (WF) had a significantly increased population of monocytes in PBMCs when compared with wild-type B6 mice receiving BM from wild-type B6 mice (WW). In addition, wild-type B6 mice receiving BM cells from Fli-1ΔCTA/ΔCTA mice had an increased population of pre-cDC in PBMCs when compared with wild-type B6 mice receiving BM from wild-type B6 mice (WW).

Various cytokines, chemokines and transcription factors are involved in mononuclear phagocyte development and differentiation, and GM-CSF and Flt3L are key cytokines among them.4,6,9,35 Over-expression of GM-CSF in transgenic animals or mice receiving daily injections of a modified form of recombinant GM-CSF resulted in a significant expansion in DCs in the spleen and thymus, with the expanded DC populations most likely representing inflammatory DCs.36,37 The mice had a massive expansion of pDCs and cDCs in the spleen after injection of the recombinant Flt3L cytokine.37,38 Type I interfeorn-induced mice exhibited increased populations of pDCs and suppressed cDCs. On the other hand, many transcription factors have been reported in regulating development of monocytes, macrophages and DCs. Transcription factors including the interferon regulatory factor family (IRF8, IRF4 and IRF1); STAT3, STAT5 and STAT1; E2-2, Id2 and Spi-B regulate mononuclear phagocyte development.4,35 To investigate the molecular mechanisms of the effect of Fli-1 on mononuclear phagocyte development, we cultured MPPs from BM cells from both Fli-1ΔCTA/ΔCTA B6 mice and wild-type B6 mice, and examined differences among key genes that impact mononuclear phagocyte development. We found that expression of Flt3L was significantly increased in MPPs from Fli-1ΔCTA/ΔCTA B6 mice compared with wild-type littermates (Fig. 5). Furthermore, we demonstrated that the Fli-1 protein binds directly to the promoter region of the Flt3L gene (Fig. 6). We are actively investigating how Fli-1 regulates the expression of the Flt3L gene. A previous report demonstrated that STAT3 can be activated by Flt3L signalling, and that STAT3 regulates the differentiation of pDCs and cDCs from progenitors.39 We found that expression of STAT3 was higher in MPPs from Fli-1ΔCTA/ΔCTA B6 mice compared with wild-type mice although the difference was not statistically significant.

In summary, we have found that Fli-1ΔCTA/ΔCTA B6 mice had significantly increased populations of HSCs and CDPs in BM, increased pre-cDCs, cDCs, pDCs and macrophages in the spleen, and increased pre-cDCs and monocytes in PBMCs compared with wild-type littermates. Expression of Flt3L in MPPs from Fli-1ΔCTAΔCTA BM cells was significantly increased when compared with wild-type B6 mice and Fli-1 binds the promoter region of Flt3L. The CTA domain of Fli-1 negatively regulates mononuclear phagocyte development and Fli-1 is one of the transcriptional factors regulating the HSC and myeloid cell development in mice.

Acknowledgments

This study was supported in part by National Institutes of Health grants (AR056670 to X.K.Z.) and the Medical Research Service, Department of Veterans Affairs (to G.G. and X.K. Z.). We thank Dr Mara Lennard-Richard at the Medical University of South Carolina for critical reading of the manuscript.

Glossary

cDCs

classical dendritic cells

CDPs

common dendritic cell progenitors

ChIP

chromatin immunoprecipitation

Csf1

colony stimulating factor 1

Csf2ra

colony stimulating factor 2 receptor α

DCs

dendritic cells

Flt3

FMS-like tyrosine 3

Flt3L

Fms-like tyrosine kinase 3 ligand

GM-CSF

granulocyte–macrophage colony-stimulating factor

HSC

haematopoietic stem cell

MDP

macrophage and dendritic cell progenitor

ID2

inhibitor of DNA binding 2

MPPs

multipotent progenitors

pDCs

plasmacytoid DCs

PBMCs

peripheral blood mononuclear cells

STAT3

signal transducer and activator of transcription 3

Tcf4

transcription factor 4

Disclosures

The authors have no conflicts of interest to disclose.

References

  • 1.Geissmann F, Manz MG, Jung S, Sieweke MH, Meras M, Ley K. Development of monocytes, macrophages, and dendritic cells. Science. 2010;327:656–61. doi: 10.1126/science.1178331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Auffary C, Sieweke MH, Geissmass F. Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu Rev Immunol. 2009;27:669–92. doi: 10.1146/annurev.immunol.021908.132557. [DOI] [PubMed] [Google Scholar]
  • 3.Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic functional perspective. Annu Rev Immunol. 2009;27:451–83. doi: 10.1146/annurev.immunol.021908.132532. [DOI] [PubMed] [Google Scholar]
  • 4.Watowich SS, Liu Y. Mechanisms regulating dendritic cell specification and development. Immunol Rev. 2010;238:76–92. doi: 10.1111/j.1600-065X.2010.00949.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wu L, Liu Y. Development of dendritic-cell lineages. Immunity. 2007;26:741–50. doi: 10.1016/j.immuni.2007.06.006. [DOI] [PubMed] [Google Scholar]
  • 6.Blanco P, Paiucka AK, Banchereau J. Dendritic cells and cytokines in human inflammatory and autoimmune diseases. Cytokine Growth Factor Rev. 2008;19:41–52. doi: 10.1016/j.cytogfr.2007.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Liu K, Victora GD, Schwickert TA, et al. In vivo analysis of dendritic cell development and homeostasis. Science. 2009;324:392–97. doi: 10.1126/science.1170540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chow A, Brown BD, Merad M. Studying the mononuclear phagocyte system in the molecular age. Nat Rev Immunol. 2011;11:788–98. doi: 10.1038/nri3087. [DOI] [PubMed] [Google Scholar]
  • 9.Merad M, Manz MG. Dendritic cell homeostasis. Blood. 2009;113:3418–27. doi: 10.1182/blood-2008-12-180646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Anderson KL, Perkin H, Surh CD, Venturini S, Maki RA, Torbett BE. Transcription factor PU.1 is necessary for development of thymic and myeloid progenitor-derived dendritic cells. J Immunol. 2000;164:1855–61. doi: 10.4049/jimmunol.164.4.1855. [DOI] [PubMed] [Google Scholar]
  • 11.Schotte R, Nagasawa M, Weijer K, Spits H, Blom B. The ETS transcription factor Spi-B is required for human plasmacytoid dendritic cell development. J Exp Med. 2004;200:1503–9. doi: 10.1084/jem.20041231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ben-David Y, Giddenns EB, Letwin K, Berstein A. Erythroleukemia induction by friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev. 1991;5:908–18. doi: 10.1101/gad.5.6.908. [DOI] [PubMed] [Google Scholar]
  • 13.Watson DK, Smyth FE, Thompson DM, Cheng JQ, Testa JR, Papas TS, Seth A. The ERGB/Fli-1 gene: isolation and characterization of new member of the family of human ETS transcription factors. Cell Growth Differ. 1992;3:705–13. [PubMed] [Google Scholar]
  • 14.Seth A, Ascino R, Fisher RS, Mavrothalassitis GJ, Bhat NB, Papas TS. The ets gene family. Cell growth Differ. 1992;3:327–34. [PubMed] [Google Scholar]
  • 15.Papas TS, Bhat NK, Spyropoulos DD, Mjaatvedt AE, Vournakis J, Seth A, Watson DK. Functional relationships among ETS gene family members. Leukemia. 1997;11:557–66. [PubMed] [Google Scholar]
  • 16.Karim FD, Urness LD, Thummel CS, et al. The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev. 1990;4:1451–3. doi: 10.1101/gad.4.9.1451. [DOI] [PubMed] [Google Scholar]
  • 17.Athanasiou M, Clausen PA, Mavrothalassitis GJ, Zhang XK, Watson DK, Blair DG. Increase expression of ETS-related transcriptional factor Fli-1/ERGB correlates with and can induce the megakaryocytic phenotype. Cell Growth Differ. 1996;7:1525–34. [PubMed] [Google Scholar]
  • 18.Lemarchndel V, Ghysdael J, Mignotte V, Rahuel C, Romeo PH. GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression. Mol Cell Biol. 1993;13:668–76. doi: 10.1128/mcb.13.1.668-676.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang X, Crispino JD, Letting DL, Nakazawa M, Poncz M, Blobel GA. Control of megakariocyte-specific gene expression by GATA-1 and FOG-1: role of Ets transcription factors. EMBO J. 2002;21:225–34. doi: 10.1093/emboj/cdf527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jackers P, Szalai G, Moussa O, Watson DK. Ets-dependent regulation of target gene expression during megakaryopoiesis. J Biochem. 2004;279:52183–190. doi: 10.1074/jbc.M407489200. [DOI] [PubMed] [Google Scholar]
  • 21.Szalai G, LaRue AC, Watson DK. Molecular mechanisms of megakaryopoiesis. Cell Mol Life Sci. 2006;63:2460–76. doi: 10.1007/s00018-006-6190-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang XK, Moussa O, LaRue A, Bradshaw S, Molano I, Spyropoulos DD, Gilkeson GS, Watson DK. The transcription factor Fli-1 modulates marginal zone and follicular B cell development in mice. J Immunol. 2008;81:1644–54. doi: 10.4049/jimmunol.181.3.1644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Spyropoulos DD, Pharr PN, Lavenburg KR, Jackers P, Papas TS, Ogawa M, Watson DK. Hemorrhage, impaired hemotopoiesis and lethality in mouse embryos carrying a targeted disruption of Fli-1 transcription factor. Mol Cell Biol. 2000;20:5643–52. doi: 10.1128/mcb.20.15.5643-5652.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Moussa O, LaRue AC, Abangan RS, et al. Thrombocytopenia in mice lacking the carboxy-terminal regulatory domain of Ets transcription factor Fli-1. Mol Cell Biol. 2010;30:5194–206. doi: 10.1128/MCB.01112-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Georgiou P, Maroulakou IG, Green JE, et al. Expression of ets family of genes in systemic lupus erythematosus and Sjögren's syndrome. Int J Oncol. 1996;9:9–18. [PubMed] [Google Scholar]
  • 26.Zhang XK, Gallant S, Molano I, Moussa OM, Ruiz P, Spyropoulos DD, Watson DK, Gilkeson G. Decreased expression of the Ets family transcription factor Fli-1 markedly prolongs survival and significantly reduces renal disease in MRL/lpr mice. J Immunol. 2004;173:6481–9. doi: 10.4049/jimmunol.173.10.6481. [DOI] [PubMed] [Google Scholar]
  • 27.Mathenia J, Reyes-Cortes E, Williams S, Molano I, Ruiz P, Watson DK, Gilkeson GS, Zhang XK. Impact of Fli-1 transcription factor on autoantibody and lupus nephritis in NZM2410 mice. Clin Exp Immunol. 2010;162:362–71. doi: 10.1111/j.1365-2249.2010.04245.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kawada H, Ito T, Pharr PN, Spyropoulos DD, Watson DK, Ogawa M. Defective megakaryopoiesis and abnormal erythroid development in Fli-1 gene-targeted mice. Int J Hematol. 2001;73:463–8. doi: 10.1007/BF02994008. [DOI] [PubMed] [Google Scholar]
  • 29.Masuya M, Moussa O, Abe T, et al. Dysregulation of granulocyte, erythrocyte, and NK cell lineages in Fli-1 gene-targeted mice. Blood. 2005;105:95–102. doi: 10.1182/blood-2003-12-4345. [DOI] [PubMed] [Google Scholar]
  • 30.Starck J, Weiss-Gayet M, Gonnet C, Guyot B, Vicat JM, Morle F. Inducible Fli-1 gene deletion in adult mice modifies several myeloid lineage commitment decisions and accelerates proliferation arrest and terminal erythrotic differentiation. Blood. 2010;23:4795–805. doi: 10.1182/blood-2010-02-270405. [DOI] [PubMed] [Google Scholar]
  • 31.Bradshaw S, Zheng WJ, Tsoi LC, Gilkeson G, Zhang XK. A role for Fli-1 in B cell proliferation: implication for SLE pathogenesis. Clin Immunol. 2008;129:19–30. doi: 10.1016/j.clim.2008.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vremec D, Pooley J, Hochrein H, Wu L, Shortman K. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J Immunol. 2000;164:2978–86. doi: 10.4049/jimmunol.164.6.2978. [DOI] [PubMed] [Google Scholar]
  • 33.Fukui Y, Hashimoto O. Haematopoietic cell-specific CDM family protein DOCK2 is essential for lymphocyte migration. Nature. 2001;412:826–31. doi: 10.1038/35090591. [DOI] [PubMed] [Google Scholar]
  • 34.Weih DS, Yilmaz ZB, Weih F. Essential role of RelB in germinal center and marginal zone formation and proper expression of homing chemokines. J Immunol. 2001;167:1909–19. doi: 10.4049/jimmunol.167.4.1909. [DOI] [PubMed] [Google Scholar]
  • 35.Gabriele L, Ozato K. The role of the interferon regulatory factor (IRF) family in dendritic cell development and function. Cytokine Growth Factor Rev. 2007;18:503–10. doi: 10.1016/j.cytogfr.2007.06.008. [DOI] [PubMed] [Google Scholar]
  • 36.Vremec D, Lieschke GJ, Dunn AR, Robb L, Metcalf D, Shortman K. The influence of granulocyte/macrophage colony-stimulating factor on dendritic cell levels in mouse lyphoid organs. Eur J Immunol. 1997;27:40–4. doi: 10.1002/eji.1830270107. [DOI] [PubMed] [Google Scholar]
  • 37.Daro E, Pulendran B, Brasel K, et al. Polyethylene glycol-modified GM-CSF expands CD11bhigh CD11chigh but not CD11blow CD11chigh murine dendritic cells in vivo: a comparative analysis with Flt3 ligand. J Immunol. 2000;165:49–58. doi: 10.4049/jimmunol.165.1.49. [DOI] [PubMed] [Google Scholar]
  • 38.Maraskovskt E, Brasel K, Teepe M, Roux ER, Lyman SD, Shortman K, McKenna HJ. Dramatic increase in the number of functionally mature dendritc cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med. 1996;184:1953–62. doi: 10.1084/jem.184.5.1953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Laouar Y, Welte T, Fu XY, Flavell RA. STAT3 is required for Flt3L-dependent dendritic cell differentiation. Immunity. 2003;19:903–12. doi: 10.1016/s1074-7613(03)00332-7. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES