Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2013 Jul 4;7(7):e2297. doi: 10.1371/journal.pntd.0002297

Molecular Epidemiology Reveals Genetic Diversity amongst Isolates of the Cryptococcus neoformans/C. gattii Species Complex in Thailand

Sirada Kaocharoen 1,2, Popchai Ngamskulrungroj 2,3, Carolina Firacative 2,4, Luciana Trilles 2,5, Dumrongdej Piyabongkarn 1, Wijit Banlunara 6, Natteewan Poonwan 7, Angkana Chaiprasert 3, Wieland Meyer 2, Ariya Chindamporn 1,*
Editor: Bodo Wanke8
PMCID: PMC3701708  PMID: 23861989

Abstract

To gain a more detailed picture of cryptococcosis in Thailand, a retrospective study of 498 C. neoformans and C. gattii isolates has been conducted. Among these, 386, 83 and 29 strains were from clinical, environmental and veterinary sources, respectively. A total of 485 C. neoformans and 13 C. gattii strains were studied. The majority of the strains (68.9%) were isolated from males (mean age of 37.97 years), 88.5% of C. neoformans and only 37.5% of C. gattii strains were from HIV patients. URA5-RFLP and/or M13 PCR-fingerprinting analysis revealed that the majority of the isolates were C. neoformans molecular type VNI regardless of their sources (94.8%; 94.6% of the clinical, 98.8% of the environmental and 86.2% of the veterinary isolates). In addition, the molecular types VNII (2.4%; 66.7% of the clinical and 33.3% of the veterinary isolates), VNIV (0.2%; 100% environmental isolate), VGI (0.2%; 100% clinical isolate) and VGII (2.4%; 100% clinical isolates) were found less frequently. Multilocus Sequence Type (MLST) analysis using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex identified a total of 20 sequence types (ST) in Thailand combining current and previous data. The Thai isolates are an integrated part of the global cryptococcal population genetic structure, with ST30 for C. gattii and ST82, ST83, ST137, ST141, ST172 and ST173 for C. neoformans being unique to Thailand. Most of the C. gattii isolates were ST7 = VGIIb, which is identical to the less virulent minor Vancouver island outbreak genotype, indicating Thailand as a stepping stone in the global spread of this outbreak strain. The current study revealed a greater genetic diversity and a wider range of major molecular types being present amongst Thai cryptococcal isolates than previously reported.

Author Summary

The most common fungal pathogen of the central nervous system, members of the Cryptococcus neoformans/C. gattii species complex, causes life-threatening infection in humans with either normal or compromised immunity worldwide. The molecular epidemiology of this fungus in developing countries is highly under-investigated. Thus, three standard molecular typing methods were performed on 498 cryptococcal strains isolated from humans, the environment and animals in Thailand. As in developed countries, C. neoformans was found to be correlated with HIV infected patients and C. gattii infected humans with apparent normal immune status. Combining current and previous data, a total of 20 sequence types (ST) were identified suggesting a greater spectrum of major molecular types and genotypes of the C. neoformans/C. gattii species complex in Thailand than previously reported. Moreover, the discovery of the minor genotype (ST7) of the Vancouver Island outbreak in Thailand indicates that Asia may be an important stepping stone in its global expansion. This study gives an insight in the molecular epidemiological picture of this important fungal pathogen and necessitates further detailed studies.

Introduction

The members of the Cryptococcus neoformans/C. gattii species complex are the causative agent of cryptococcosis, which is a systemic mycosis, in a wide range of animals and humans [1]–[4]. Inhalation of infectious propagules (basidiospores or blastoconidia) are proposed to be the source of the infection [1]. C. neoformans comprises two varieties and three serotypes: C. neoformans var. grubii (serotype A), C. neoformans var. neoformans (serotype D) and a hybrid (serotype AD), whereas C. gattii comprises two serotypes, B and C [1], [3].

Extensive surveys of the yeast have shown that the ecological niches of both species are different. C. neoformans has been associated worldwide with soil enriched with pigeon excreta and decaying wood [1], [5], [6]. On the contrary, C. gattii was until recently thought to be geographically restricted to tropical and subtropical regions and thought to be related mainly to eucalyptus trees [7]–[9]. Further environmental studies in South America and Asia pointed out several species of tropical trees as the natural habitat of C. gattii such as oiti (Licania tomentosa), almond trees (Terminalia cattapa), cassia (Cassia grandis), pottery tree (Ficus microcarpa) and Syzygium cumini [10]–[12]. A recent ongoing outbreak of C. gattii on Vancouver Island, Canada, a temperate area, indicated an environmental shift of this species [13]. Moreover, in contrast to previous known environmental sources of this species, C. gattii has been found in association with a number of native tree species (Douglas fir, alder, maple and Garry oak) on Vancouver Island rather than with eucalypt trees [13].

A number of molecular typing techniques have been used to study the molecular epidemiology of the C. neoformans/C. gattii species complex [14]–[17], providing more discriminatory power than conventional techniques [1]. Using M13-PCR fingerprinting, eight major molecular types have been established [18], [19]. The major molecular types VNI/AFLP1 and VNII/AFLP1A correspond to C. neoformans var. grubii, serotype A; VNIII/AFLP2 corresponds to the AD hybrid; serotype AD, and VNIV/AFLP3 corresponds to C. neoformans var. neoformans, serotype D. The molecular types VGI/AFLP4, VGII/AFLP6, VGIII/AFLP5 and VGIV/AFLP7 correspond all to C. gattii, serotypes B and C. These eight major molecular types have been subsequently confirmed using restriction fragment length polymorphism (RFLP) analysis of the orotidine monophosphate pyrophosphorylase (URA5) or phospholipase B (PLB1) genes, Amplified Fragment Length Polymorphism (AFLP) and Multi-Locus Sequence Typing (MLST) analysis [16], [19]–[23].

Cryptococcosis is among the most prevalent life-threatening mycoses, especially in hosts with an impaired immune system such as HIV positive patients. C. neoformans has been known to be the major cause of the infection in immunocompromised hosts, while the immunocompetent hosts were virtually always affected by C. gattii [1]. Previous studies showed that VNI is the major cause of cryptococcosis in AIDS patients, whereas VGI has been the most prevalent genotype of infections due to C. gattii [19]. However, in temperate climates, especially in the American continent, VGII is found to be on the rise [13], [24].

Before the AIDS era, cryptococcosis in Thailand was mainly caused by C. gattii, serotypes B and C [25]. At that time, the serotypes A and D were reported as opportunistic fungal pathogens, which were mainly related to pet bird excreta [26]. C. gattii has never been reported from the environment in Thailand [25]–[27]. The prevalence of cryptococcosis has increased dramatically since 1992 due to a rising number of AIDS patients, with C. neoformans var. grubii serotype A being the major cause of infection [27]–[31]. Two typing methods, random amplification of polymorphic DNA (RAPD) [27], [30], [32] and Pulsed Field Gel Electrophoresis (PFGE) [32], were previously applied for the genotyping of Thai isolates, which revealed the prevalence of serotype A strains. A recent molecular epidemiological study of 183 Thai isolates using MLST analysis showed that almost all of the isolates belonged to the VNI molecular type, with only one isolate being found to be VNII [33]. However, the genetic diversity of Thai isolates is expected to be more diverse since C. neoformans var. neoformans (VNIV) and C. gattii (VG) strains had been isolated before in Thailand [26], [30]. Thus, the current study aimed to expend the current epidemiological knowledge by including a further 498 clinical, environmental and veterinary isolates of the C. neoformans/C. gattii species complex.

Methods

Strains and media

The 498 cryptococcal isolates were recovered from the culture collections of the Molecular Mycology and Mycobacteriology Laboratory, Faculty of Medicine, Siriraj Hospital, Mahidol University, the Mycology Unit Laboratory, King Chulalongkorn Memorial Hospital, Faculty of Medicine, Chulalongkorn University, the Mycology Laboratory of the National Institute of Health, Nonthaburi, Thailand [30] and the Molecular Mycology Research Laboratory, Westmead Hospital, Westmead, NSW, Australia (see Table S1). All strains were maintained in glycerol at −80°C.

Environmental sampling

The environmental strains were collected from pigeon droppings in Bangkok during the years 2002–2005 using a method described previously [26]. Briefly, the pigeon droppings were collected into sterile zip-lock bags from 21 districts in Bangkok and transferred to the Mycology Unit Laboratory, King Chulalongkorn Memorial Hospital for isolation and identification. The pigeon droppings were dissolved in 0.85% normal saline, vigorously vortex and centrifuged. The supernatant was diluted, then spread onto Sabouraud Dextrose Agar plates supplemented with 40 µg/mL chloramphenicol and incubated at 37°C and observed for growth of yeast colonies every day. The grown yeast colonies were transferred to new media and identified as C. neoformans via india-ink preparation, urease test and phenoloxidase production test [34]. If the isolates were positive for all three tests they were preliminarily identified as belonging to the C. neoformans/C. gattii species complex and included into the study. Two additional environmental strains isolated from pigeon droppings were kindly provided from the mycology laboratory, Chiang Mai University. The strain information is listed in Table S1.

URA5-RFLP

Genomic DNA was isolated as described previously [19]. The major molecular types were determined by URA5-RFLP analysis as previously described [19]. Briefly, the URA5 gene was amplified with the following primers URA5 (5′ATGTCCTCCCAAGCCCTCGACTCCG3′) and SJ01 (5′TTAAGACC TCTGAACACCGTACTC3′). The obtained amplification products were digested with the restriction enzymes HhaI and Sau96I. The digested PCR products were visualized and compared to the reference strains on a 3% agarose gel after staining with ethidium bromide.

PCR-fingerprinting

PCR-fingerprinting was carried out as described previously [18] using the microsatellite specific primer M13 (5′ GAGGGTGGCGGTTCT 3′). The PCR-fingerprinting profiles were visualized and compared on 1.4% agarose gels containing ethidium bromide using the 1D gel analysis module BioGalaxy in the software package BioloMICS ver. 7.5.30 (BioAware, Hannut, Belgium). Strains with identical M13 PCR-fingerprints were grouped in the same M13 type (see Table S1).

MLST

VNI strains representative of the different M13 types identified by PCR-fingerprinting and all VNII, VNIV and VGII strains were chosen for MLST analysis. Using the ISHAM consensus MLST typing scheme, seven unlinked genetic loci, including conserved and variable regions of CAP59, GPD1, LAC1, PLB1, SOD1, URA5 and the IGS1 region, were amplified using the primers and amplification parameters described by the ISHAM Cryptococcal Working Group [21], sequenced and analyzed as reported previously [35], [36]. To put the newly identified molecular patterns into context with previous Thai studies, sequences of additional strains of the C. neoformans/C. gattii species complex were retrieved from those studies [33], [37] (see Tables S2 and S3). The previously published Thai sequence types [33] were downloaded from the mlst.mycologylab.org webpage. The generated sequences were manually edited using the software Sequencher 4.9 (Gene Codes Corporation, MI, USA) and aligned using Clustal W [38], part of the program Bioedit 7.0.9.0 [39]. The concatenated alignments were then imported to the program MEGA 5.03 [40] and analyzed using the neighbor-joining method with p-distance [41]. Bootstrap analysis [42] using 1000 replicates was used to estimate support for clades of the concatenate dataset. The genetic network analysis was performed using the software Network 4.5.1.6 (Fluxus Technologies Ltd., Suffolk, UK). All allele types and subsequently the combined sequence types were assigned using the ISHAM consensus database at mlst.mycologylab.org, as described previously [35]. All MLST sequences are deposited at mlst.mycologylab.org. The sequences of the herein determined alleles of the seven MLST loci are deposited in GenBank (Table S4).

Reference strains

The following set of laboratory standard reference strains representing each of the eight major molecular type of the Cryptococcus neoformans/C. gattii species complex were used: WM 148 (serotype A, VNI/AFLP1), WM 626 (serotype A, VNII/AFLP1A), WM 628 (serotype AD, VNIII/AFLP2), WM629 (serotype D, VNIV/AFLP3), WM 179 (serotype B, VGI/AFLP4), WM 178 (serotype B, VGII/AFLP6), WM 175 (serotype B, VGIII/AFLP5) WM 779 (serotype C, VGIV/AFLP7), R265 (VGIIa) and R272 (VGIIb) [19], [35].

Patient data

Demographic and clinical data for each isolate, including isolation site and date, patient's residence, age, gender and HIV status, were retrieved from the clinical records if they were available and are listed in Table S1. These isolates are anonymous and the data cannot be used to trace back to individuals

Data analysis

Statistical analysis was performed using the SPSS software package ver. 18.0.0 (IBM, Armonk, New York). Unknown data were regarded as missing data and excluded from the calculations.

Results

Demographic data

Among the 498 strains collected, 386, 83 and 29 strains were from clinical, environmental and veterinary sources, respectively. Of the clinical strains, 68.9% were from male and 31.1% from female patients, with an average age of 37.97 years. A total of 485 C. neoformans and 13 C. gattii strains were studied. Most of the C. neoformans clinical strains were from HIV positive patients (88.5%). In comparison, only 37.5% of the C. gattii strains were from HIV positive patients. The clinical strains were collected from all areas of Thailand with most strains originating from Bangkok (47.3%) and the central part of Thailand (27.0%). From the clinical strains, 80% were recovered from CSF, 17.5% from blood and 2.5% from other sites. All environmental isolates were obtained from pigeon droppings. The most common site of cryptococcal isolation in veterinary cases was the nasal cavity of cats (72.4%). For further information, see Table S1.

Major molecular types

To examine the genetic diversity of Thai cryptococcal strains, the major molecular types were determined by M13 PCR-fingerprinting and/or URA5-RFLP analysis [19]. As seen globally [43], VNI was the most common molecular type among Thai human (94.6%), environmental (98.8%) and animal (86.2%) isolates, though less frequent, VNII, VNIV, VGI and VGII were also found (Table 1).

Table 1. Distribution of the major molecular types among strains ofCryptococcus neoformans and C. gattii from different sources in Thailand.

Source Molecular type Total
VNI VNII VNIV VGI VGII
Human 365 (94.6%) 8 (2.1%) 0 1 (0.3%) 12 (3.1%) 386
Environment 82 (98.8%) 0 1 (1.2%) 0 0 83
Animal 25 (86.2%) 4 (13.8%) 0 0 0 29
Total 472 (94.8%) 12 (2.4%) 1 (0.2%) 1 (0.2%) 12 (2.4%) 498

M13 PCR-fingerprinting of VNI Thai isolates showed six different subtypes

As the majority of VNI Thai isolates were reported previously to be clonal [33], M13 PCR fingerprinting analysis, which has shown to differentiate cryptococcal molecular subtypes in several previous studies [13], [18], [37], was performed to check for clonality amongst the collected Thai VNI isolates. The obtained PCR fingerprinting patterns were assigned with a M13 type. Six M13 types (A, B, C, D, E, and F) were identified amongst all studied isolates, with type A being the most common type identified (90.3%) (Table 2). The genetic diversity identified by M13 PCR-fingerprinting analysis suggested that the Thai isolates are more genetically diversified than previously reported [33].

Table 2. Distribution of the M13 types among Thai VNI isolates.

M13 type Frequency
A 426 (90.3%)
B 1 (0.2%)
C 3 (0.6%)
D 9 (1.9%)
E 1 (0.2)
F 32 (6.8%)
Total 472

ThaiC. neoformans isolates are genetically diversified

To verify the obtained diversity and to enable comparison with previous studies, MLST analysis, which has a superior discriminatory power and reproducibility over M13 PCR-fingerprinting [37], was performed. MLST analysis was performed on representative strains of each M13 type from the VNI isolates (14 strains of M13 type A, 1 of M13 type B, 2 of M13 type C, 2 of M13 type D, 1 of M13 type E, and 4 of M13 F) and for all VNII and VNIV isolates. Eight additional sequence types (STs), with ST3, ST31, ST77, and ST137 for VNI and ST40, ST42, ST43 and ST172 for VNII (Table 3, Table S1 and Figure 1), were identified amongst the studied C. neoformans isolates when compared with a previous report, which had identified the following STs: ST4, ST5, ST6, ST81, ST82, ST83, ST85, ST93 and ST141 for VNI; and ST173 for VNII [33]. Network analysis showed that the Thai C. neoformans isolates are an integral part of the global population structure of this species, with nine ST's being unique to Thailand, but closely related to other global isolates (Figure 2).

Table 3. Allele types and sequence types of selected Thai cryptococcal isolates.

Strain name Mol. type Source M13 type CAP59 GPD1 IGS1 LAC1 PLB1 SOD1 URA5 ST
47-2158 VGII Human ND 2 6 10 4 2 15 2 7
47-4995 VGII Human ND 2 6 10 4 2 15 2 7
47-5055 VGII Human ND 2 6 10 4 2 15 2 7
47-5061 VGII Human ND 2 6 10 4 2 15 2 7
DMST20763 VGII Human ND 2 6 10 4 2 15 2 7
DMST20764 VGII Human ND 2 6 10 4 2 15 2 7
DMST20765 VGII Human ND 2 6 10 4 2 15 2 7
DMST20766 VGII Human ND 2 6 10 4 2 15 2 7
DMST20767 VGII Human ND 2 6 10 4 2 15 2 7
DMST20768 VGII Human ND 2 6 10 4 2 15 2 7
MC-S-265 VGII Human ND 2 6 10 4 2 15 2 7
MC-S-115 VGII Human ND 2 6 32 4 2 15 2 30
A13 VNI Animal A 1 1 1 4 2 1 5 4
B1 VNI Human A 1 1 1 4 2 1 5 4
C110 VNI Human A 1 1 1 4 2 1 5 4
C121 VNI Human A 1 1 1 4 2 1 5 4
E1 VNI Environment A 1 1 1 4 2 1 5 4
P17 VNI Human A 1 1 1 4 2 1 5 4
P4 VNI Human A 1 1 1 4 2 1 5 4
A25 VNI Animal A 1 1 1 3 2 1 5 6
B59 VNI Human A 1 1 1 3 2 1 5 6
CM1 VNI Human A 1 1 1 3 2 1 5 6
CM19 VNI Environment A 1 1 1 3 2 1 5 6
S24 VNI Human A 1 1 1 3 2 1 5 6
T28 VNI Environment A 1 1 1 3 2 1 5 6
C146 VNI Human A 1 3 1 4 2 1 5 137
A19 VNI Animal B 1 1 10 3 2 1 1 31
A17 VNI Animal C 1 1 10 3 2 1 1 31
A18 VNI Animal C 1 1 10 3 2 1 1 31
S87 VNI Human D 1 1 1 3 4 1 1 3
E12 VNI Environment D 1 1 25 3 2 1 1 77
B31 VNI Human E 1 1 1 4 2 1 5 4
B2 VNI Human F 1 3 1 5 2 1 1 5
CM17 VNI Human F 1 3 1 5 2 1 1 5
E38 VNI Environment F 1 3 1 5 2 1 1 5
C140 VNI Human F 1 1 1 5 2 1 1 81
47-1104 VNII Human ND 2 9 14 8 11 12 4 40
47-7559 VNII Human ND 2 9 14 8 11 12 4 40
48-1350 VNII Human ND 2 9 14 8 11 12 4 40
48-1398 VNII Human ND 2 9 14 8 11 12 4 40
48-1643 VNII Human ND 2 9 14 8 11 12 4 40
48-1663 VNII Human ND 2 9 14 8 11 12 4 40
46-2852 VNII Human ND 8 10 15 8 12 3 11 42
48-2323 VNII Human ND 2 9 14 8 11 11 4 43
A10 VNII Animal ND 2 9 14 8 11 11 4 43
A11 VNII Animal ND 2 9 14 8 11 11 4 43
A5 VNII Animal ND 2 9 14 11 11 16 15 172
A6 VNII Animal ND 2 9 14 11 11 16 15 172
CBS7816 VNIV Environment ND 17 21 28 19 14 1 20 126

ND = not done, ST = sequence type, Mol. = molecular, bold = new ST types of Thai isolates identified in this study.

Figure 1. Phylogram of the ThaiC. neoformans isolates.

Figure 1

Phylogram depicting the genetic relationships between the Thai C. neoformans isolates based on neighbor joining analysis of the concatenated seven ISHAM consensus MLST loci using the program MEGA 5.03. Bold numbers on the branches indicate bootstrap support above 75%. Underlined strain numbers indicate STs identified in a previous study [33]. C = clinical, E = environmental, V = veterinary.

Figure 2. Gene network placing the ThaiC. neoformans isolates in global context.

Figure 2

Gene network constructed from all C. neoformans ST types identified by MLST analysis in the current study in-cooperating the STs previously obtained from Thai cryptococcal isolates [33] and standard strains based on the combined seven ISHAM consensus MLST loci using the program Network 4.5.1.6, showing the close relationships between STs present in Thailand and globally.

Almost all clinical VGII isolates belong to the same ST as the low virulent Vancouver Island outbreak strain

As VGII isolates are the causative agent of the ongoing outbreaks on Vancouver Island, Canada and Pacific Northwest region of USA [35], [44], MLST analysis was performed to determine the relationship of the Thai VGII isolates to the outbreak strains. Surprisingly, 11 out of the 12 VGII isolates were identical to the genotype of the low virulent Vancouver Island outbreak strains, VGIIb/ST7 (Figure 3). One isolate had a ST, which was unique to Thailand (ST30) (see Tables 3 and S1 and Figure 3).

Figure 3. Phylogram of the ThaiC. gattii isolates.

Figure 3

Phylogram depicting the genetic relationships between the Thai C. gattii isolates based on neighbor joining analysis of the concatenated seven ISHAM consensus MLST loci using the program MEGA 5.03. Bold numbers on the branches indicate bootstrap support above 75%. C = clinical, E = environmental.

Discussion

The obtained data concerning the demographics and the HIV status of the patients were in line with previous reports of cryptococcosis from Thailand [25], [31]. Besides some missing demographic data it is clear from the available data that C. neoformans was the most common species identified among HIV positive patients, while C. gattii was mainly a primary pathogen in immunocompetent patients, which is in accordance with a previous global study [18]. The fact that most isolates were recovered from male HIV positive patients with an average age of infection of 37.97 years represents the HIV demography in Thailand, with 60% of the HIV infected patients being male with an average age of 30–34 years [45].

C. neoformans has been found worldwide, with VNI being the most common molecular type, including recent reports from Thailand [33]. The molecular typing in the current study confirmed this paradigm, where VNI is predominant regardless of the isolate source. Moreover, the rare molecular type VNII, for which only one isolate had been reported previously from Thailand [33], has now been identified from several strains from both humans and animals. As the natural reservoir of VNII has never been reported, the herein presented data allow to suggest: that a close relationship between animal and human VNII isolates may exist, as strains from humans and animals share the same genotype, ST43 (Figure 1 and Table 3). However, further studies are needed to draw a definite conclusion as the numbers of the studied VNII strains are very small and other human VNII strains showed no relationships with animal strains. On the other hand, a strong relationship between VNI clinical and environmental strains is evident, as they share the same STs (Figure 1 and Table 3).

The correlation between C. neoformans and HIV in Thailand is supported by the low prevalence of the genotype VNIc/M5, corresponding to M13 type F in the current study, which is known to be associated with non-HIV patients in China [46], Korea [37] and Japan [36]. In fact, only 6% (23 out of 386 isolates) of the clinical cases were of M13 type F (VNIc/M5) (Figure S1) and only one of them (P21) had been isolated from a HIV positive patient. All other cryptococcal isolates form HIV positive patients had either the M13 type A or D (Table S1).

The herein obtained MLST data when combined with data previously reported [33] showed clearly, that the STs present in Thailand are an integral part of the global population genetic structure, and are not as unique as previously reported [33]. For the C. neoformans molecular type VNI, seven of the STs are shared with global strains and six are unique for Thailand (Figure 2). All of the isolates form a close network with a number of Thai specific STs and are directly linked to other globally present STs (Figure 2).

The current study describes for the first time molecular typing of C. gattii isolates from Thailand, taken into account the literature since the 1990's [30], [31]. The high percentage of the VGII molecular type (92.3%) amongst the studied C. gattii isolates is in contrast to a report from a neighboring country, Malaysia, where 76.5% of the C. gattii isolates belonged to the molecular type VGI [47]. No VGIII or VGIV isolates have been found in the current study and the fact that they have never been reported from this region may suggest that those molecular types are not endemic in this area. The geographically closest related place from which VGIII and VGIV isolates have been reported is India [43], [48].

Before the AIDS epidemic, a predominance of C. gattii as the causative agent of cryptococcosis was found in Thailand, which was possibly related to non-HIV immunocompromised conditions [25], [26]. A recent study on non-HIV cryptococcosis cases suggested that the disease was not such a rare event in HIV negative patients and is also associated with high mortality rates [49], [50], a fact also seen with the cases of C. gattii infection investigated in the current study.

Moreover, the predominance of the VGII molecular type in this tropical region revealed in the current study is of special interest, as a similar situation was only described form the northern part of Brazil [51], which is in contrast to most of the described isolations which are associated mainly with areas of temperate climate or in the high mountain regions of Colombia [24], [52], [53]. In addition, the fact that several strains (the DMST strains) were isolated more than 10 years ago (Table S1), [30], [54] suggests that this molecular type is prevalent in Thailand, as it is in South America [19], but unlike Australia [55] or Europe [56] where the molecular type VGI is predominant.

The fact that 11 out of the 12 C. gattii strains studied showed an identical ST type to the one of the Vancouver Island outbreak strain, VGIIb = ST7 is remarkable. It reveals the high clonality that this VGIIb C. gattii population has in Thailand, which is similar to the situation described in Australia [35]. It confirms the point previously made, that this low virulent outbreak strain is globally present, with Australia and Thailand being important stepping-stones in the global spread of this outbreak strain, linking South America, via Australia with North America and Europe.

In summary, as in other worldwide studies, the same distribution of cryptococcal genotypes has been found in Thailand, with a predominance of C. neoformans var. grubii, molecular type VNI, isolated from HIV positive patients. Our study suggests a greater genetic diversity among Thai cryptococcal isolates especially amongst VNI strains with 13 different STs than reported previously [33]. The majority of Thai C. gattii isolates are clonal and identical to the Vancouver Island outbreak strain with VGIIb = ST7, identifying Thailand as a stepping-stone in its global spread. In addition, a strong linkage between environmental and clinical strains was found for the VNI isolates. A connection between other rare molecular types, such as VNII for C. neoformans or VGI and VGII for C. gattii and the environment in Thailand could still not be found and needs further investigation. Extensive environmental and veterinary sampling would be of great help to fill this gap. Moreover, despite an advanced development of HIV treatment, cryptococcosis is still a major problem as an opportunistic infection in Thailand, making further studies, concerning the epidemiology and virulence of the Cryptococcus neoformans/C. gattii species complex mandatory for a proper management of the disease in the future.

Supporting Information

Figure S1

Phylogram correlating the newly identified Thai C. neoformans sequence types with previously reported types. Phylogram depicting the genetic relationships between the Thai VNI isolates studied herein in combination with previously published data representing the following M13 PCR-fingerprinting patterns VNIa, VNIb, VNIc/M5 and VNId (32) based on neighbor joining analysis of the concatenated seven ISHAM consensus MLST loci. Bold numbers on the branches indicate bootstrap support above 75%. Letters in brackets indicate the M13 type. WM148 = VNI standard, WM626 = VNII standard.

(TIF)

Table S1

Strains used in this study and associated demographic and molecular data.

(DOC)

Table S2

Correlation between old and new allele and sequence type numbering from the Simwami et al. 2011 (28) publication and the new C. gattii MLST database at mlst.mycologylab.com for the MLST data used in the current study.

(DOC)

Table S3

MLST data for the additional published C. neoformans strains used in this study.

(DOC)

Table S4

GenBank accession numbers for all sequences of the MLST alleles obtained from Thai C. neoformans and C. gattii isolates used in this study.

(DOC)

Acknowledgments

The authors would like to thank the staff and students of the Molecular Mycology and Mycobacteriology Laboratory, Faculty of Medicine Siriraj Hospital, Mahidol University and the Mycology Unit Laboratory, Faculty of Medicine, King Chulalongkorn Memorial Hospital for the preparation of the strains and providing the patient demographic data for this study and the Mycology Laboratory, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand for kindly providing the two environmental strains.

Funding Statement

S. Kaocharoen was supported by Chulalongkorn University Graduate Scholarship to commemorate the 72nd Anniversary of His Majesty King Bhumibol Adulyadej. This work was also supported by the 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund) #2/2551 to A. Chindamporn and S. Kaocharoen, a New Researcher Scholarship of CSTS, NSTDA Ministry of Science and Technology, to P. Ngamskulrungroj and an NH&MRC project grants #352303 and APP1031943 to W. Meyer. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Casadevall A, Perfect JR (1998) Cryptococcus neoformans. Washington, DC: ASM press. [Google Scholar]
  • 2. Krockenberger MB, Canfield PJ, Malik R (2003) Cryptococcus neoformans var. gattii in the koala (Phascolarctos cinereus): a review of 43 cases of cryptococcosis. Med Mycol 41: 225–234. [DOI] [PubMed] [Google Scholar]
  • 3. Kwon-Chung KJ, Boekhout T, Fell JW, Diaz M (2002) (1557) Proposal to conserve the name Cryptococcus gattii against C.hondurianus and C.basillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804–806. [Google Scholar]
  • 4. Stephen C, Lester S, Black W, Fyfe M, Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can Vet J 43: 792–794. [PMC free article] [PubMed] [Google Scholar]
  • 5. Lazera MS, Pires FD, Camillo-Coura L, Nishikawa MM, Bezerra CC, et al. (1996) Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees. J Med Vet Mycol 34: 127–131. [PubMed] [Google Scholar]
  • 6. Emmons CW (1951) Isolation of Cryptococcus neoformans from soil. J Bacteriol 62: 685–690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Ellis D, Pfeiffer T (1992) The ecology of Cryptococcus neoformans . Eur J Epidemiol 8: 321–325. [DOI] [PubMed] [Google Scholar]
  • 8. Kwon-Chung KJ, Bennett JE (1984) High prevalence of Cryptococcus neoformans var. gattii in tropical and subtropical regions. Zentralbl Bakteriol Mikrobiol Hyg [A] 257: 213–218. [PubMed] [Google Scholar]
  • 9. Sorrell TC (2001) Cryptococcus neoformans variety gattii. Med Mycol 39: 155–168. [PubMed] [Google Scholar]
  • 10. Granados DP, Castaneda E (2006) Influence of climatic conditions on the isolation of members of the Cryptococcus neoformans species complex from trees in Colombia from 1992–2004. FEMS Yeast Res 6: 636–644. [DOI] [PubMed] [Google Scholar]
  • 11. Lazera MS, Cavalcanti MA, Trilles L, Nishikawa MM, Wanke B (1998) Cryptococcus neoformans var. gattii–evidence for a natural habitat related to decaying wood in a pottery tree hollow. Med Mycol 36: 119–122. [PubMed] [Google Scholar]
  • 12. Randhawa HS, Kowshik T, Preeti Sinha K, Chowdhary A, Khan ZU, et al. (2006) Distribution of Cryptococcus gattii and Cryptococcus neoformans in decayed trunk wood of Syzygium cumini trees in north-western India. Med Mycol 44: 623–630. [DOI] [PubMed] [Google Scholar]
  • 13. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, et al. (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A 101: 17258–17263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Perfect JR, Ketabchi N, Cox GM, Ingram CW, Beiser CL (1993) Karyotyping of Cryptococcus neoformans as an epidemiological tool. J Clin Microbiol 31: 3305–3309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Sorrell TC, Chen SC, Ruma P, Meyer W, Pfeiffer TJ, et al. (1996) Concordance of clinical and environmental isolates of Cryptococcus neoformans var. gattii by random amplification of polymorphic DNA analysis and PCR fingerprinting. J Clin Microbiol 34: 1253–1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, et al. (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans . Microbiology 147: 891–907. [DOI] [PubMed] [Google Scholar]
  • 17. Hanafy A, Kaocharoen S, Jover-Botella A, Katsu M, Iida S, et al. (2008) Multilocus microsatellite typing for Cryptococcus neoformans var. grubii . Med Mycol 46: 685–696. [DOI] [PubMed] [Google Scholar]
  • 18. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, et al. (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA-a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790–1799. [DOI] [PubMed] [Google Scholar]
  • 19. Meyer W, Castaneda A, Jackson S, Huynh M, Castaneda E (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis 9: 189–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Latouche GN, Huynh M, Sorrell TC, Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl Environ Microbiol 69: 2080–2086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Meyer W, Aanensen DM, Boekhout T, Cogliati M, Diaz MR, et al. (2009) Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii . Med Mycol 47: 561–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Litvintseva AP, Thakur R, Vilgalys R, Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223–2238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Litvintseva AP, Carbone I, Rossouw J, Thakur R, Govender NP, et al. (2011) Evidence that the human pathogenic fungus Cryptococcus neoformans var. grubii may have evolved in Africa. PLoS One 6: e19688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Escandon P, Sanchez A, Martinez M, Meyer W, Castaneda E (2006) Molecular epidemiology of clinical and environmental isolates of the Cryptococcus neoformans species complex reveals a high genetic diversity and the presence of the molecular type VGII mating type a in Colombia. FEMS Yeast Res 6: 625–635. [DOI] [PubMed] [Google Scholar]
  • 25. Sukroongreung S, Nilakul C, Ruangsomboon O, Chuakul W, Eampokalap B (1996) Serotypes of Cryptococcus neoformans isolated from patients prior to and during the AIDS era in Thailand. Mycopathologia 135: 75–78. [DOI] [PubMed] [Google Scholar]
  • 26. Imwidthaya P, Dithaprasop P, Egtasaeng C (1989) Clinical and environmental isolates of Cryptococcus neoformans in Bangkok (Thailand). Mycopathologia 108: 65–67. [DOI] [PubMed] [Google Scholar]
  • 27. Sriburee P, Khayhan S, Khamwan C, Panjaisee S, Tharavichitkul P (2004) Serotype and PCR-fingerprints of clinical and environmental isolates of Cryptococcus neoformans in Chiang Mai, Thailand. Mycopathologia 158: 25–31. [DOI] [PubMed] [Google Scholar]
  • 28. Imwidthaya P (1994) Systemic fungal infections in Thailand. J Med Vet Mycol 32: 395–399. [DOI] [PubMed] [Google Scholar]
  • 29. Vithayasai P, Vithayasai V (1993) Clinical manifestations of 174 AIDS cases in Maharaj Nakorn Chiang Mai Hospital. J Dermatol 20: 389–393. [DOI] [PubMed] [Google Scholar]
  • 30. Poonwan N, Mikami Y, Poosuwan S, Boon-Long J, Mekha N, et al. (1997) Serotyping of Cryptococcus neoformans strains isolated from clinical specimens in Thailand and their susceptibility to various antifungal agents. Eur J Epidemiol 13: 335–340. [DOI] [PubMed] [Google Scholar]
  • 31. Imwidthaya P, Poungvarin N (2000) Cryptococcosis in AIDS. Postgrad Med J 76: 85–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Ngamwongsatit P, Sukroongreung S, Nilakul C, Prachayasittikul V, Tantimavanich S (2005) Electrophoretic karyotypes of C. neoformans serotype A recovered from Thai patients with AIDS. Mycopathologia 159: 189–197. [DOI] [PubMed] [Google Scholar]
  • 33. Simwami SP, Khayhan K, Henk DA, Aanensen DM, Boekhout T, et al. (2011) Low diversity Cryptococcus neoformans variety grubii multilocus sequence types from Thailand are consistent with an ancestral African origin. PLoS Pathog 7: e1001343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kwon-Chung JK, Bennett JE (1992) Cryptococcosis. In: Kwon-Chung JK, Bennett JE, editors. Medical Mycology. Pennsylvania: Lea & Febiger. pp. 397–446. [Google Scholar]
  • 35. Carriconde F, Gilgado F, Arthur I, Ellis D, Malik R, et al. (2011) Clonality and alpha-a recombination in the Australian Cryptococcus gattii VGII population–an emerging outbreak in Australia. PLoS One 6: e16936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Mihara T, Izumikawa K, Kakeya H, Ngamskulrungroj P, Umeyama T, et al. (2012) Multilocus sequence typing of Cryptococcus neoformans in non-HIV associated cryptococcosis in Nagasaki, Japan. Med Mycol 51: 252–60. [DOI] [PubMed] [Google Scholar]
  • 37. Choi YH, Ngamskulrungroj P, Varma A, Sionov E, Hwang SM, et al. (2010) Prevalence of the VNIc genotype of Cryptococcus neoformans in non-HIV-associated cryptococcosis in the Republic of Korea. FEMS Yeast Res 10: 769–778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position specific gap penalties and weight matrix choice. Nucl Acids Res 22: 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Hall T (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95–98. [Google Scholar]
  • 40. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599. [DOI] [PubMed] [Google Scholar]
  • 41. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. [DOI] [PubMed] [Google Scholar]
  • 42. Felsenstein J (1985) Confidence-Limits on Phylogenies - an Approach Using the Bootstrap. Evolution 39: 783–791. [DOI] [PubMed] [Google Scholar]
  • 43.Meyer W, Gilgado F, Ngamskulrungroj P, Trilles L, Castañeda E, et al.. (2011) Molecular typing of the Cryptococcus neoformans/C. gattii species complex. In: Heitman J, Kozel TR, Kwon-Chung J, Perfect JR, Casadevall A, editors. Cryptococcus: From Human Pathogen to Model Yeast. Washington DC: ASM press. pp. 327–358. [Google Scholar]
  • 44. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, et al. (2005) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360–1364. [DOI] [PubMed] [Google Scholar]
  • 45. Khongphatthanayothin M, Tantipaibulvut S, Nookai S, Chumchee P, Kaldor J, et al. (2006) Demographic predictors of a positive HIV test result among clients attending a large metropolitan voluntary counselling and testing centre in Thailand. HIV Med 7: 281–284. [DOI] [PubMed] [Google Scholar]
  • 46. Chen J, Varma A, Diaz MR, Litvintseva AP, Wollenberg KK, et al. (2008) Cryptococcus neoformans strains and infection in apparently immunocompetent patients, China. Emerg Infect Dis 14: 755–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Tay ST, Lim HC, Tajuddin TH, Rohani MY, Hamimah H, et al. (2006) Determination of molecular types and genetic heterogeneity of Cryptococcus neoformans and C. gattii in Malaysia. Med Mycol 44: 617–622. [DOI] [PubMed] [Google Scholar]
  • 48. Cogliati M, Chandrashekar N, Esposto MC, Chandramuki A, Petrini B, et al. (2012) Cryptococcus gattii serotype-C strains isolated in Bangalore, Karnataka, India. Mycoses 55: 262–268. [DOI] [PubMed] [Google Scholar]
  • 49. Kiertiburanakul S, Wirojtananugoon S, Pracharktam R, Sungkanuparph S (2006) Cryptococcosis in human immunodeficiency virus-negative patients. Int J Infect Dis 10: 72–78. [DOI] [PubMed] [Google Scholar]
  • 50. Jongwutiwes U, Sungkanuparph S, Kiertiburanakul S (2008) Comparison of clinical features and survival between cryptococcosis in human immunodeficiency virus (HIV)-positive and HIV-negative patients. Jpn J Infect Dis 61: 111–115. [PubMed] [Google Scholar]
  • 51. Trilles L, Lazera Mdos S, Wanke B, Oliveira RV, Barbosa GG, et al. (2008) Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz 103: 455–462. [DOI] [PubMed] [Google Scholar]
  • 52. Kidd SE, Chow Y, Mak S, Bach PJ, Chen H, et al. (2007) Characterization of environmental sources of the human and animal pathogen Cryptococcus gattii in British Columbia, Canada, and the Pacific Northwest of the United States. Appl Environ Microbiol 73: 1433–1443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Granados DP, Castaneda E (2005) Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogota, Colombia, and study of ecological conditions in the area. Microb Ecol 49: 282–290. [DOI] [PubMed] [Google Scholar]
  • 54. Ngamskulrungroj P, Sorrell TC, Chindamporn A, Chaiprasert A, Poonwan N, et al. (2008) Association between fertility and molecular sub-type of global isolates of Cryptococcus gattii molecular type VGII. Med Mycol 46: 665–673. [DOI] [PubMed] [Google Scholar]
  • 55. Chen S, Sorrell T, Nimmo G, Speed B, Currie B, et al. (2000) Epidemiology and host- and variety-dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Australasian Cryptococcal Study Group. Clin Infect Dis 31: 499–508. [DOI] [PubMed] [Google Scholar]
  • 56. Viviani MA, Cogliati M, Esposto MC, Lemmer K, Tintelnot K, et al. (2006) Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res 6: 614–619. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Phylogram correlating the newly identified Thai C. neoformans sequence types with previously reported types. Phylogram depicting the genetic relationships between the Thai VNI isolates studied herein in combination with previously published data representing the following M13 PCR-fingerprinting patterns VNIa, VNIb, VNIc/M5 and VNId (32) based on neighbor joining analysis of the concatenated seven ISHAM consensus MLST loci. Bold numbers on the branches indicate bootstrap support above 75%. Letters in brackets indicate the M13 type. WM148 = VNI standard, WM626 = VNII standard.

(TIF)

Table S1

Strains used in this study and associated demographic and molecular data.

(DOC)

Table S2

Correlation between old and new allele and sequence type numbering from the Simwami et al. 2011 (28) publication and the new C. gattii MLST database at mlst.mycologylab.com for the MLST data used in the current study.

(DOC)

Table S3

MLST data for the additional published C. neoformans strains used in this study.

(DOC)

Table S4

GenBank accession numbers for all sequences of the MLST alleles obtained from Thai C. neoformans and C. gattii isolates used in this study.

(DOC)


Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES