Skip to main content
NCBI home page
Microbiology logoLink to Microbiology
. 2013 Feb;159(Pt 2):307–315. doi: 10.1099/mic.0.060194-0

Primers for amplification of nitrous oxide reductase genes associated with Firmicutes and Bacteroidetes in organic-compound-rich soils

Jaejoon Jung 1, Sungjong Choi 1, Hoon Jung 1, Kate M Scow 2, Woojun Park 1,✉
Editor: E L Madsen
PMCID: PMC3709563  PMID: 23197174

Abstract

The nosZ gene encodes nitrous oxide reductase, a key enzyme in the nitrous oxide reduction that occurs during complete denitrification. Many conventional approaches have used Proteobacteria-based primers to detect nosZ in environmental samples. However, these primers often fail to detect nosZ in non-Proteobacteria strains, including Firmicutes (Gram-positive) and Bacteroidetes. In this study, newly designed nosZ primers successfully amplified this gene from five Geobacillus species (Firmicutes). The primers were used to construct nosZ clone libraries from DNA extracted from sludge and domestic animal feedlot soils, all with high organic carbon contents. After DNA sequencing, phylogenetic analysis identified many new nosZ sequences with high levels of homology to nosZ from Bacteroidetes, probably because of the high sequence similarity of nosZ from Firmicutes and Bacteroidetes, and a predominance of Bacteroidetes in feedlot environments. Three sets of new quantitative real-time PCR (qPCR) primers based on our clone library sequences were designed and tested for their specificities. Our data showed that only Bacteroidetes-related nosZ sequences were amplified, whereas conventional Proteobacteria-based primers amplified only Proteobacteria-related nosZ. Quantitative analysis of nosZ with the new qPCR primers recovered ~104 copies per 100 ng DNA. Thus, it appears that amplification with conventional primers is insufficient for developing an understanding of the diversity and abundance of nosZ genes in the environment.

Introduction

Denitrification is a series of reactions in which oxidized nitrogen is reduced to dinitrogen gas. Four microbial enzymes are required for this process, including nitrate reductase (NO3−→NO2−), nitrite reductase (NO2−→NO), nitric oxide reductase (NO→N2O) and nitrous oxide reductase (N2O→N2). Denitrification is a route of nitrogen loss in agricultural fields (Freney et al., 1990) and is involved in bioremediation of nitrate contamination (Smith et al., 1994). Nitrous oxide gas produced during denitrification is a well-known greenhouse gas (Singh et al., 2010) and is associated with the destruction of the ozone layer (Ravishankara et al., 2009). Since this process is of biogeochemical, agricultural and environmental importance, it has been studied extensively by isolation of denitrifying bacteria (Heylen et al., 2006), characterization of protein structure (Coelho et al., 2011), and PCR-based detection of nitrogen cycle genes from denitrifying bacteria and environmental samples (Hallin & Lindgren, 1999).

Although many Firmicutes and Bacteroidetes strains have been identified as denitrifiers (Liu et al., 2008), PCR primers have only been designed against denitrification genes from Proteobacteria; other groups of bacteria have not been considered during the efforts to reassess PCR primers for denitrification gene diversity surveys (Smith et al., 1994; Scala & Kerkhof, 1998; Nogales et al., 2002; Throbäck et al., 2004). Thus, the sequences and diversity of denitrification genes remain poorly explored. Recently, all the genes required for denitrification were identified in the genome of Geobacillus thermodenitrificans NG80-2, and it was in this species that nosZ functionality was first proven experimentally for the Gram-positive bacteria (Feng et al., 2007; Liu et al., 2008).

Along with an earlier report describing primer mismatches for amplifying denitrification genes, the discovery of nosZ sequences from Gram-positive strains gave rise to questions about the ability of previously designed primers to detect diverse nosZ genes (Green et al., 2010). Since Firmicutes and Bacillus species represent a significant proportion of soil micro-organisms, it is clear that a thorough understanding of nosZ diversity and abundance will require reassessment of nosZ primer design (Chen et al., 2012; Felske et al., 1998; Guo et al., 2011; Janssen, 2006). In this study, Geobacillus-based nosZ primers were designed and used to detect nosZ genes from 15 Geobacillus strains (G. thermodenitrificans was used a positive control), sludge, and domestic animal feeding facilities. Three quantitative real-time PCR (qPCR) primers based on clone library sequences were designed and used to quantify nosZ in soil environments. These results were compared with the results of amplification reactions using conventional nosZ primers.

Methods

Bacterial strains and culture conditions.

Fifteen Geobacillus species were used in this study: G. thermodenitrificans KACC 11363T (DSM 465T), Geobacillus debilis KACC 12204T (DSM 16016T), Geobacillus thermoleovorans KACC 11374T (ATCC 43513T), Geobacillus thermocatenulatus KACC 11364T (DSM 730T), Geobacillus subterraneus KACC 11369T (DSM 13552T), Geobacillus vulcani KACC 11367T (DSM 13734T), Geobacillus pallidus KACC 11365T (ATCC 51176T), Geobacillus caldoxylosilyticus KACC 11366T (ATCC 700356T), Geobacillus jurassicus KACC 12202T (DSM 15726T), Geobacillus sp. KACC 11425, Geobacillus gargensis KACC 11844T (DSM 15378T), Geobacillus tepidamans KACC 11371T (DSM 16325T), Geobacillus uzenensis KACC 11368T (DSM 13551T), Geobacillus zalihae KACC 14512T (DSM 18318T) and Geobacillus zalihae KACC 11510T (DSM 15325T); G. pallidus has been reclassified as Aeribacillus pallidus (Miñana-Galbis et al., 2010). All the strains were purchased from the Korean Agricultural Culture Collection (KACC) and grown on nutrient agar at 55 °C. Pseudomonas aeruginosa PAO1 and Escherichia coli were grown in Luria–Bertani medium at 37 °C.

PCR amplification and primer design.

Primers are listed in Table 1. PCRs were conducted at 95 °C for 90 s, followed by 35 cycles at 95 °C for 24 s, at 56 °C for 24 s, 58 °C for 24 s, and a final extension step at 72 °C for 5 min using a Mastercycler PCR machine (Eppendorf). The primer design was based on an alignment of nosZ genes from G. thermodenitrificans NG80-2 and 13 Bacteroidetes species (Salinibacter ruber DSM 13855, Marivirga tractuosa DSM 4126, Capnocytophaga gingivalis JCVIHMP016, Psychroflexus torquis ATCC 700755, Cellulophaga algicola DSM 14237, Gramella forsetii KT0803, Robiginitalea biformata HTCC 2501, Maribacter sp. HTC C2170, Dyadobacter fermentans DSM 18053, Flavobacteriaceae bacterium 3519-10, Riemerella anatipestifer DSM 15868, Pedobacter saltans DSM 12145 and Rumella slithyformis DSM 19594), as shown in Figs 1 and 2. Nitrous oxide reductase contains a conserved COX2 (cytochrome c oxidase subunit II) domain, and these primers amplify the N terminus of this domain and the flanking regions.

Table 1. Primers used in this study.
Primer Sequence (5′–3′) Product size (bp) Reference or source
nosZ-F CGYTGTTCMTCGACAGCCAG 453 Kloos et al. (2001)
nosZ-R CGSACCTTSTTGCCSTYGCG
nosZGeoF TCRTCTGAAGTYGTRAAATGG 654 This study
nosZGeoR CTTGRTGCARCGCVGAACAGA
nosZF478 TGTGCCGCGTTTGTGACTGAGAAT 437 This study
nosZR915 GGCGACCGGTACCAAATAAATG
nosZ1F WCSYTGTTCMTCGACAGCCAG 259 Henry et al. (2006)
nosZ1R ATGTCGATCARCTGVKCRTTYTC
nosZ2F CGCRACGGCAASAAGGTSMSSGT 267 Henry et al. (2006)
nosZ2R CAKRTGCAKSGCRTGGCAGAA
nosZqPCRF1* TCGARCAGGAYTGGRACATYCT 162 This study
nosZqPCRF2* ACAGGAYTATGATGTRCCGCACGGA 158 This study
nosZqPCRF3* TGACYGCCATYCGTTCWCACYTT 246 This study
Open in a new tab
*

nosZGeoR was used as a reverse primer.

Fig. 1.

Fig. 1.

Open in a new tab

Detecting nosZ sequences in Geobacillus species by using new primers. (a) Annealing positions and PCR product sizes. nosZGeoF and nosZGeoR primers were designed based on the alignment of nosZ genes from G. thermodenitrificans and 13 Bacteroidetes species. The presence of nosZ in Geobacillus species was determined using nosZGeoF/nosZGeoR and nosZF478/nosZR915. A nosZ clone library was constructed from soil DNA using nosZGeoF/nosZGeoR. Quantitative analysis of nosZ in soil DNA was performed using nosZqPCR1–3 (forward) and nosZGeoR (reverse). PCR products used in the clone library and qPCR analysis contained the cytochrome c conserved domain (COX). (b) PCR amplification of nosZ from Geobacillus species using nosZ primers designed against G. thermodenitrificans NG80-2 nosZ. PCR products of the expected size were amplified from G. thermodenitrificans as a positive control and four other Geobacillus species. M, 1 kb DNA ladder; P, positive control, G. thermodenitrificans KACC 11363T (DSM 465T); N, negative control, P. aeruginosa PAO1; 1, G. debilis KACC 12204T (DSM 16016T); 2, G. thermoleovorans KACC 11374T (ATCC 43513T); 3, G. thermocatenulatus KACC 11364T (DSM 730T); 4, G. subterraneus KACC 11369T (DSM 13552T); 5, G. vulcani KACC 11367T (DSM 13734T); 6, G. pallidus KACC 11365T (ATCC 51176T); 7, G. caldoxylosilyticus KACC 11366T (ATCC 700356T); 8, G. jurassicus KACC 11202T (DSM 15726T); 9, Geobacillus sp. KACC 12202; 10, G. gargensis KACC 13844T (DSM 15387T); 11, G. tepidamans KACC 11371T (DSM 16325T); 12, G. uzenensis KACC 11368T (DSM 13551T); 13, G. zalihae KACC 14512T (DSM 18318T); and 14, G. lituanicus KACC 11510T (DSM 15325T). Currently, G. pallidus is reclassified as Aeribacillus pallidus.

Fig. 2.

Fig. 2.

Open in a new tab

Phylogenetic analysis of nosZ clone libraries constructed with PCR products amplified by nosZGeoF and nosZGeoR primers. After alignment and trimming of unaligned sequence, 200 amino acids (600 bp) were used for phylogenetic analysis. A neighbour-joining phylogenetic tree is shown of NosZ sequences available from GenBank, including Proteobacteria, Firmicutes, Bacteroidetes and translated sequences of the clone libraries. Black triangles indicate a collapsed subtree of the monophyletic Proteobacteria group, and the number of sequences in a subtree is in parentheses. Most clone library sequences were associated with Bacteroidetes NosZ. Bootstrap values above 70 % are labelled at the nodes (n = 1000). Sequences from this study are shown in bold type. The numbers of clone library sequences with the same RFLP pattern are shown in parentheses. Scale bar, 0.1 amino acid change per sequence position.

Primers were designated nosZGeoF and nosZGeoR (654 bp predicted product size). These primers were used to detect nosZ genes from Geobacillus species and to construct a clone library. The presence of nosZ in Geobacillus was reconfirmed using another primer set, nosZF478 and nosZR915 (437 bp amplification product). The design of nosZF478 and nosZ915 was based on the nosZ gene of G. thermodenitrificans.

Quantification of nosZ in the soil environment was performed via qPCR. It was not possible to develop a qPCR primer to cover all the cloned sequences due to low sequence similarities and a lack of conserved regions in the forward primer regions. Therefore, clone libraries were divided into groups based on phylogenetic clades and designated groups A, B and C (Fig. 2). Sequence alignment within each group revealed a region sufficiently conserved to enable primer design. For qPCR amplification, only three new forward primers were designed using the conserved regions found in each group (A, B and C in Fig. 2). We reused our reverse primer (nosZGeoR primer) used in clone library construction because it could bind to all three groups. Primers were chosen using Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast) and specificity was tested by performing PCR. The reactions contained 12.5 µl of iQ SYBR Green Supermix (Bio-Rad), 0.5 µM of each primer and 50 ng soil DNA in a total volume of 25 µl. The PCR conditions were 95 °C for 3 min, followed by 40 cycles of 24 s at 95 °C, 24 s at 60 °C, and 24 s at 72 °C (iCycler iQ, Bio-Rad). Melting curve analysis supported the specificity of the qPCR primers (see Fig. S1 available with the online version of this paper). To generate a standard curve for nosZ1F-nosZ1R and nosZ2F-nosZ2R, the PCR product from P. aeruginosa PAO1 was cloned into the pGEM-T Easy vector system (Promega) and transformed into E. coli Top10. Isolated plasmid DNA was digested with SphI and used as a template for amplification. Standard curves of nosZqPCRF1 (group A), nosZqPCRF2 (group B) and nosZqPCRF3 (group C) with nosZGeoR were generated using linearized plasmids isolated from clone libraries UR11, WD07 and SL01, respectively. The following are the equations for the standard curves for the qPCR primers used in this study: nosZ1F and nosZ1R, y = −1.503ln(x)+41.456 (R2 = 0.9923); nosZ2F and nosZ2R, y = −1.623ln(x)+40.497 (R2 = 0.9925), nosZqPCRF1 and nosZGeoR, y = −2.00ln(x)+46.28 (R2 = 0.9949); nosZqPCRF2 and nosZGeoR, y = −1.51ln(x)+35.86 (R2 = 0.9802); and nosZqPCRF3 and nosZGeoR, y = −1.58ln(x)+36.81 (R2 = 0.9925; y = Ct, x = copy number per microlitre). We attempted to design a qPCR primer (nosZqPCRF3/ nosZGeoR pair) for group C with a product size of less than 200 bp; however, the primers failed to amplify a clear PCR band. The mean copy number and standard deviations were calculated from experiments performed in triplicate.

Soil samples and DNA extraction.

Twelve environmental samples were collected from different sources, including one sludge sample from a wastewater treatment plant (Jungnang water-recycling centre, Seoul, Korea), one sample from playground soil (Korea University, Seoul, Korea), one sample from an abandoned mine soil (Gahak mine, Gwangmyeong, Korea), five soil samples from domestic animal feeding facilities (designated WD, UR, HD, YM and SJ, all located in Gyeonggi province of Korea), three samples from Antarctic soil (King Sejong Station, 62° 13′ 25.1S, 58° 47′ 10.4E; Cape Burk 1, 74° 45′ 32.6N, 136° 48′ 743E; and Cape Burk 2, 74° 45′ 99.9N, 136° 47′ 974E), and one sample from forest soil (37° 37′ 13N, 126° 58′ 54E). The samples were stored in a freezer (<−80 °C) prior to DNA extraction. Soil DNA was extracted from 250 mg of soil using a NucleoSpin Soil kit (Machery-Nagel) according to the manufacturer’s instructions. Soil DNA concentrations were measured using a NanoDrop Spectrophotometer ND-1000 (Thermo Fisher Scientific). PCR amplifications were performed under the same conditions described for the bacterial strains. The absence of PCR inhibitor was tested according to Nõlvak et al. (2012). The PCR recovery rate was tested using pGEM-nosZPAO1 or a mixture of 1 µl soil DNA and a known concentration of pGEM-nosZPAO1. T7 and nosZ1R primers were used to amplify the PCR product only from pGEM-nosZPAO1.

nosZ library construction.

PCR products amplified by nosZGeoF and nosZGeoR from the soil DNA of four environmental samples were cloned into pGEM-T Easy, and 100 clone libraries (25 from each sample) were constructed. RFLP analyses were conducted on PCR products digested with HaeIII. RFLP patterns were observed after 0.8 % agarose gel electrophoresis (100 V, 30 min). Eighteen clones that exhibited differing RFLP patterns were chosen for sequencing with the T7 primer (5′-TAATACGACTCACTATAGGG-3′). Nucleotide sequences were translated by using the Translate tool (http://web.expasy.org/translate/), and NosZ sequences from the GenBank database were aligned and analysed with mega 5.05 software using clustal w and the neighbour-joining algorithm. For phylogenetic analysis, 200 amino acid sequences were used after alignment and trimming of unaligned sequences from 218 amino acids translated from 654 bp. Sequences from WD01 and WD04 were omitted because of internal stop codons and the absence of blast matches, respectively. To confirm the fidelity of the new nosZ qPCR primers, additional clone libraries were constructed using the three qPCR primer pair sets and conventional nosZ qPCR primers, nosZ1F, nosZ1R, nosZ2F and nosZ2R, for comparison (Table 1) (Henry et al., 2006). All the procedures and conditions for PCR, cloning, RFLP and sequencing were identical to those for the nosZGeoF/nosZGeoR libraries except the restriction enzyme used, which was MspI. All the sequencing results were checked manually to ensure high quality. The clone libraries of nosZ nucleotide sequences from Geobacillus species are shown in Fig. 2 (GenBank accession nos JN255388–JN 255409). Nucleotide sequences of qPCR products were not deposited, because GenBank does not accept nucleotide sequences less than 200 bp.

Results and Discussion

Primer mismatches

To investigate the specificity of previously published conventional nosZ primers for Gram-positive nosZ genes, 13 primers were chosen from six references (Chèneby et al., 1998; Scala & Kerkhof, 1998; Kloos et al., 2001; Nogales et al., 2002; Throbäck et al., 2004; Pujol Pereira et al., 2011). These primers were aligned with the nosZ sequence from G. thermodenitrificans NG80-2 by using mega 5.05. A significant number of mismatches were detected, as the annealing sequences were different in the Gram-positive bacteria. The number and percentage (mismatches/total length of primer regardless of degeneracy) of mismatches for nos661F, nosZ661b, nosLb, nos1527F, nosZ-F, nos1527R, nos1773R, nosZ1773b, nosRb, nosZ1622R, nosZ-R, nosZ2F and nosZ2R were 9 (50 %), 7 (39 %), 8 (38 %), 10 (53 %), 6 (30 %), 6 (33 %), 4 (20 %), 7 (21 %), 7 (33 %), 8 (40 %), 10 (48 %), 9 (39 %) and 7 (33 %), respectively. If any nucleotide of degenerate code was present, it was considered as matching sequences. Given primer lengths of 18–21 bp, these mismatches precluded specific amplification of nosZ from G. thermodenitrificans NG80-2.

Detection of nosZ from Geobacillus species

Primer mismatches observed in in silico analysis prompted us to experimentally confirm whether conventional primers could amplify the nosZ gene from non-Proteobacteria species. Primer specificity testing was performed with a conventional primer set, nosZ-F and nosZ-R (Kloos et al., 2001). This primer set was chosen because it had been used by many researchers to study denitrifying bacteria in diverse environments such as soils, activated sludge and wetlands (Jung et al., 2011). Amplification with nosZ-F and nosZ-R was unsuccessful for 15 of the tested Geobacillus species. Although amplification reactions using G. thermocatenulatus, G. subterraneus and G. pallidus templates generated PCR products of the expected size, many non-specific bands were also observed (data not shown). The lack of amplicons from G. thermodenitrificans indicates that conventional nosZ primers are inappropriate for detecting nosZ genes from a particular group of bacteria such as the Geobacillus species.

Detection of nosZ with a newly designed Geobacillus-based primer pair (nosZGeoF and nosZGeoR) was performed. Among the 15 Geobacillus species examined, products of the expected size were amplified from G. subterraneus, G. caldoxylosilyticus, G. uzenensis and G. lituanicus (Fig. 1b). The presence of the nosZ gene in these Geobacillus species was reconfirmed by using a second primer set (nosZF478, nosZR915), which generated results consistent with those obtained for nosZGeo primers (data not shown). Amino acid sequences of the four Geobacillus species (G. subterraneus, G. caldoxylosilyticus, G. uzenensis and G. lituanicus) exhibited 94.0–96.5 % sequence similarity to G. thermodenitrificans NG80-2 NosZ, suggesting that these sequences are closely related (Fig. 2). Over the course of the study, genomes of several Geobacillus species were sequenced, and currently a total of 14 genomes are available and 14 additional Geobacillus strains are registered to the NCBI Bioproject for genome sequencing. A search of NosZ according to the predicted function and blastp demonstrated the absence of NosZ from Geobacillus kaustophilus HTA426, G. thermoleovorans CCB_US3_UF5, Geobacillus thermoglucosidasius C56-YS93, Geobacillus thermoglucosidans TNO-09.020 and five unnamed Geobacillus strains, which is consistent with our data (Figs 1 and 2). P. aeruginosa PAO1 and several Flavobacterium species are also known to contain nosZ genes; however, they were not detected by the nosZ primers designed in this study (data not shown).

Diversity of nosZ in soils

PCR amplification with nosZGeoF and nosZGeoR primers was performed on 12 soil samples, including a sludge from a wastewater treatment plant, a playground soil, an abandoned mine soil, five domestic animal feeding facilities soil, three Antarctic soils and a forest soil. nosZ PCR products of the expected size were amplified from only four samples: a sludge sample (SL) and three domestic animal feedlot soils (designated SJ, UR and WD; data not shown). Clone libraries were constructed using the PCR product of nosZGeoF and nosZGeoR primers from the SJ, SL, UR and WD samples. Most clone library sequences were associated with nitrous oxide reductases from the Bacteroidetes, probably because all the Bacteroidetes species shown in Fig. 2 share nucleotide sequences to which nosZGeoF and nosZGeoR primers can anneal. One of the clone libraries, SL11, contained the nosZ sequence, which is more closely related to Proteobacteria nosZ genes. We assumed that the nosZ gene of SL11 differs from that of P. aeruginosa, which we used as a negative control in the Fig. 1. Our data also suggested that a previously known conventional Proteobacteria-based nosZ primer could not cover all Proteobacteria nosZ genes. The predominance of Bacteroidetes in animal faeces may have enriched the soil samples with Bacteroidetes and Firmicutes (Durso et al., 2011). The sludge and feedlot soils which produced a PCR product amplified by nosZGeoF and nosZGeoR primers have higher total organic carbon [TOC; (24253.6–50260.4 mg kg−1)] than other soils (416.2–5641.1 mg kg−1). Therefore, the nosZ primers designed in this study were able to amplify the nosZ sequence from Firmicutes and Bacteroidetes.

nosZ PCR detection with conventional nosZ qPCR primers

On the basis of the phylogenetic analysis of Geobacillus species’ nosZ and clone libraries from environmental samples, it appears that the use of conventional primers may have resulted in a significant underestimation of environmental nosZ diversity (Henry et al., 2006). To confirm that diverse nosZ sequences were detected in qPCR analysis with conventional qPCR primers, we constructed two clone libraries using nosZ1F-nosZ1R and nosZ2F-nosZ2R primers targeting different regions of nosZ sequences. Sequencing and phylogenetic analysis of clone libraries demonstrated that only Proteobacteria nosZ sequences were amplified (Fig. S2), even though the presence of Bacteriodetes-associated nosZ was confirmed via the nosZGeoF-nosZGeoR primer clone library (Fig. 2). These results strongly suggest that a certain portion of nosZ gene abundance may have been neglected in gene abundance and diversity surveys performed with conventional primers.

Primer specificity of a new Bacteroidetes-based qPCR primer

Recognizing the inadequacy of conventional nosZ primers, we sought to design new qPCR primers to detect Bacteroidetes-associated nosZ sequences. A qPCR primer covering all Bacteroidetes-associated nosZ was not feasible because nosZ sequences are too divergent and there are no conserved nucleotide sequences for primer annealing. Based on phylogenetic analysis, we divided the nosZ sequences into the groups designated A, B and C, as shown in Fig. 2. Alignment of nosZ sequences within each group revealed highly conserved nucleotide sequences for primer annealing. Three forward primers, nosZqPCRF1, nosZqPCRF2 and nosZqPCRF3, were designed, and nosZGeoR was used as a reverse primer (Fig. 1). nosZ of G. thermodenitrificans could not be used for designing our qPCR forward primer because a short DNA region must be used for qPCR and the nosZ forward primer region of G. thermodenitrificans differs from those of groups A, B and C shown in Fig. 2. An in silico primer specificity check using primer-BLAST predicted that nosZqPCRF2 and nosZqPCR3 could bind to the nitrous oxide reductase genes of D. fermentans DSM 18053 and Haliscomenobacter hydrossis DSM 1100, respectively. However, there was no sequence at which the nosZqPCRF1 and nosZGeoR primers could amplify in GenBank. This may reflect the absence of closely related nosZ sequences within group A in GenBank, as shown in Fig. 2. To test qPCR primer specificity, non-nosZ-containing strain E. coli, nosZ-containing Gram-negative strain P. aeruginosa PAO1, and nosZ-containing Gram-positive strain G. thermodenitrificans were used as negative controls. As shown in Fig. 3, the new qPCR primers successfully amplified nosZ from representatives of clone libraries (group A, UR11; group B, WD07; group C, SL01). PCR with soil DNA using the new qPCR primers also generated PCR products of the desired length (Fig. 3). These specificity tests lend support to the suitability of the new qPCR primers for quantitative analysis of nosZ associated with Bacteroidetes.

Fig. 3.

Fig. 3.

Open in a new tab

Specificity tests of the qPCR primers. nosZqPCRF1, nosZqPCRF2 and nosZqPCRF3 were designed to specifically amplify nosZ genes affiliated with groups A, B and C, as shown in Fig. 2. For specificity tests with cells, (lane 1) E. coli Top10 (pGEM-T easy) (host cell of nosZ clone library), (lane 2) P. aeruginosa PAO1 (nosZ-containing Proteobacteria) and (lane 3) G. thermodenitrificans (nosZ-containing Firmicutes) were used as negative controls. Lane 4: clone libraries UR11, WD07 and SL01 were positive controls for nosZqPCRF1, nosZqPCRF2 and nosZqPCRF3, representing groups A, B and C, respectively. For specificity tests with soil DNA, four soil samples were used: SJ, SL, UR and WD. Arrows indicate the expected PCR product size. All the PCR results show a PCR product of the desired size, indicating that the new qPCR primers specifically amplify nosZ genes from cells and soil DNA. M, 1 kb ladder.

nosZ PCR detection with new Bacteroidetes-based nosZ qPCR primers

To confirm that our new qPCR primers actually amplified nosZ genes from soil DNA, clone libraries were constructed with nosZqPCR1, nosZqPCR2 and nosZqPCR3. Fifty-eight clones were constructed from qPCR products and were subjected to RFLP analysis. Two clones could not be analysed in the phylogenetic tree because they had no database match after sequencing. After DNA sequencing of the clone with the different RFLP patterns, phylogenetic analysis of the amino acid sequences of the qPCR clone libraries showed that most qPCR products were associated with previously known Bacteroidetes nosZ genes (Fig. 4). Phylogenetic analyses revealed that qPCR products amplified by different sets of primers were not distinguishable from each other. Because only a short sequence fragment (50 amino acids after translation and alignment) of the qPCR product was used for the phylogenetic analysis shown in Fig. 4, the phylogenetic information used in grouping in Fig. 2 was not used.

Fig. 4.

Fig. 4.

Open in a new tab

Neighbour-joining phylogenetic tree of nosZ amplified by qPCR. To confirm that the new qPCR primers amplified nosZ genes from soil DNA, clone libraries were prepared with the qPCR products shown in bold type. Clone names contained six letters indicating the sources of DNA (SJ, SL, UR, WD), PCR products (q, qPCR), PCR primer (A, nosZqPCRF1; B, nosZqPCRF2; C, nosZqPCRF3), and a two-digit serial number. The number of identical RFLP patterns and GenBank accession number are shown in brackets and parentheses, respectively. After alignment and trimming of unaligned sequence, 50 amino acids (150 bp) were used for phylogenetic analysis. S. ruber DSM 13855 was used as an outgroup. Bootstrap values greater than 70 are shown at nodes. Scale bar, 0.2 substitutions per amino acid sequence.

Quantification of nosZ in soils with new Bacteroidetes-based primers

To compare the amplification characteristics of five qPCR primers (two conventional primers: nosZ1F-nosZ1R and nosZ2F-nosZ2R; three new primers: nosZqPCR1F, nosZqPCR2F and nosZqPCR as forward primers, and nosZGeoR alone as a reverse primer) qPCR analyses were performed on the same soil DNA (four samples: SJ, SL, UR and WD) used for nosZ library construction shown in Fig. 2. As shown in Fig. 5, the conventional qPCR nosZ primers (Henry et al., 2006) nosZ1F-nosZ1R and nosZ2F-nosZ2R amplified substantial amounts of nosZ from the environmental samples SL, SJ, UR and WD (nosZ1F-nosZ1R: 1.27±0.12×106, 2.16±0.20×106, 1.69±0.13×106 and 5.24±0.54×105 copies per 100 ng DNA, respectively; nosZ2F-nosZ2R: 2.33±0.60×105, 1.33±0.17×106, 1.25±0.05×106 and 4.68±0.61×105 copies per 100 ng DNA, respectively).

Fig. 5.

Fig. 5.

Open in a new tab

Quantification of nosZ from diverse environments using the conventional (nosZ1F-nosZ1R and nosZ2F-nosZ2R) and new qPCR primers (forward primers nosZqPCRF1, nosZqPCRF2 and nosZqPCRF3, corresponding to groups A, B and C, respectively; nosZGeoR alone was used as a reverse primer) designed in this study. Primers were intended to amplify nosZ associated with Bacteroidetes based on the clone library sequences (see Fig. 2). When the new primers were utilized, 2–5 % of the copy number was obtained compared with the results of conventional qPCR primers. Means and standard deviations are shown for triplicate experiments. SL, sludge sample; SJ, UR and WD, soil samples.

Quantification of nosZ with the new qPCR primers revealed a significant amount of Bacteroidetes nosZ genes in soils (Fig. 5). Group A nosZ sequences were the most abundant in all the four soil DNAs [1.13×104, 2.58×104, 3.29×104 and 4.55×103 copies (g dry soil)−1 in SJ, SL, UR and WD, respectively]. Copy numbers of the other types of nosZ sequences were relatively low in samples SJ [5.81 and 3.68×102 copies (g dry soil)−1, groups B and C]. SL (sludge sample) contained the greatest amount of nosZ genes [2.43×103 and 2.52×104 copies (g dry soil)−1, groups B and C]. When the new primers were utilized, 2–5 % of the copy number was obtained compared with the results for the conventional qPCR primers nosZ1F-nosZ1R and nosZ2F-nosZ2R.

In this study, new qPCR primers targeting Bacteroidetes were designed and proven valuable for nosZ detection and quantification. In a related study, using nosZ primers designed against Desulfitobacterium hafniense Y-51 and G. thermodenitrificans NG80-2, Jones et al. (2011) identified nosZ genes from 14 nitrogen- and nitrous oxide-producing Bacillus soil isolates. Those primers may be useful for amplification of closely related nosZ sequences; however, the large PCR product size (1502 bp) may have impeded the quantitative analyses. Nitrous oxide reductase is a good genetic marker for nitrous oxide reduction, since its function is specific to that process, while other denitrification reductases participate in additional pathways (Zumft, 1997; Suharti & de Vries, 2005; Basaglia et al., 2007; Zumft & Bothe, 2007). Therefore, improvements to the nosZ primer design will continue to assist in developing a better understanding of the abundance and diversity of genes underlying the denitrification process.

Acknowledgements

This study was supported by a grant from the Polar Academy Program (PAP) of the Korean Polar Research Institute (KOPRI). W. P.’s work was supported by the LG Yonam Foundation, Seoul, South Korea. This work was also supported by the National Institute of Environmental Health Sciences of the National Institutes of Health under award number P42ES004699. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Abbreviations:

qPCR

quantitative real-time PCR

Footnotes

Two supplementary figures are available with the online version of this paper.

References

  1. Basaglia M., Toffanin A., Baldan E., Bottegal M., Shapleigh J. P., Casella S. (2007). Selenite-reducing capacity of the copper-containing nitrite reductase of Rhizobium sullae. FEMS Microbiol Lett 269, 124–130. 10.1111/j.1574-6968.2006.00617.x [DOI] [PubMed] [Google Scholar]
  2. Chen Z., Liu J., Wu M., Xie X., Wu J., Wei W. (2012). Differentiated response of denitrifying communities to fertilization regime in paddy soil. Microb Ecol 63, 446–459. 10.1007/s00248-011-9909-5 [DOI] [PubMed] [Google Scholar]
  3. Chèneby D., Hartmann A., Henault C., Topp E., Germon J. C. (1998). Diversity of denitrifying microflora and ability to reduce N2O in 2 soils. Biol Fertil Soils 28, 19–26. 10.1007/s003740050458 [DOI] [Google Scholar]
  4. Coelho C., González P. J., Moura J. G., Moura I., Trincão J., João Romão M. (2011). The crystal structure of Cupriavidus necator nitrate reductase in oxidized and partially reduced states. J Mol Biol 408, 932–948. 10.1016/j.jmb.2011.03.016 [DOI] [PubMed] [Google Scholar]
  5. Durso L. M., Harhay G. P., Smith T. P., Bono J. L., DeSantis T. Z., Clawson M. L. (2011). Bacterial community analysis of beef cattle feedlots reveals that pen surface is distinct from feces. Foodborne Pathog Dis 8, 647–649. 10.1089/fpd.2010.0774 [DOI] [PubMed] [Google Scholar]
  6. Felske A., Wolterink A., Van Lis R., Akkermans A. D. (1998). Phylogeny of the main bacterial 16S rRNA sequences in Drentse A grassland soils (The Netherlands). Appl Environ Microbiol 64, 871–879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Feng L., Wang W., Cheng J., Ren Y., Zhao G., Gao C., Tang Y., Liu X., Han W. & other authors (2007). Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc Natl Acad Sci U S A 104, 5602–5607. 10.1073/pnas.0609650104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Freney J. R., Trevitt A. C. F., De Datta S. K., Obcemea W. N., Real J. G. (1990). The interdependence of ammonia volatilization and denitrification as nitrogen loss processes in flooded rice fields in the Philippines. Biol Fertil Soils 9, 31–36. 10.1007/BF00335858 [DOI] [Google Scholar]
  9. Green S. J., Prakash O., Gihring T. M., Akob D. M., Jasrotia P., Jardine P. M., Watson D. B., Brown S. D., Palumbo A. V., Kostka J. E. (2010). Denitrifying bacteria isolated from terrestrial subsurface sediments exposed to mixed-waste contamination. Appl Environ Microbiol 76, 3244–3254. 10.1128/AEM.03069-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Guo G. X., Deng H., Qiao M., Mu Y. J., Zhu Y. G. (2011). Effect of pyrene on denitrification activity and abundance and composition of denitrifying community in an agricultural soil. Environ Pollut 159, 1886–1895. 10.1016/j.envpol.2011.03.035 [DOI] [PubMed] [Google Scholar]
  11. Hallin S., Lindgren P. E. (1999). PCR detection of genes encoding nitrite reductase in denitrifying bacteria. Appl Environ Microbiol 65, 1652–1657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Henry S., Bru D., Stres B., Hallet S., Philippot L. (2006). Quantitative detection of the nosZ gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S rRNA, narG, nirK, and nosZ genes in soils. Appl Environ Microbiol 72, 5181–5189. 10.1128/AEM.00231-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Heylen K., Vanparys B., Wittebolle L., Verstraete W., Boon N., De Vos P. (2006). Cultivation of denitrifying bacteria: optimization of isolation condition and diversity study. Appl Environ Microbiol 72, 2637–2643. 10.1128/AEM.72.4.2637-2643.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Janssen P. H. (2006). Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Appl Environ Microbiol 72, 1719–1728. 10.1128/AEM.72.3.1719-1728.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jones C. M., Welsh A., Throbäck I. N., Dörsch P., Bakken L. R., Hallin S. (2011). Phenotypic and genotypic heterogeneity among closely related soil-borne N2- and N2O-producing Bacillus isolates harboring the nosZ gene. FEMS Microbiol Ecol 76, 541–552. 10.1111/j.1574-6941.2011.01071.x [DOI] [PubMed] [Google Scholar]
  16. Jung J., Yeom J., Kim J., Han J., Lim H. S., Park H., Hyun S., Park W. (2011). Change in gene abundance in the nitrogen biogeochemical cycle with temperature and nitrogen addition in Antarctic soils. Res Microbiol 162, 1018–1026. 10.1016/j.resmic.2011.07.007 [DOI] [PubMed] [Google Scholar]
  17. Kloos K., Mergel A., Rosch C., Bothe H. (2001). Denitrification within the genus Azospirillum and other associative bacteria. Aust J Plant Physiol 28, 991–998. [Google Scholar]
  18. Liu X., Gao C., Zhang A., Jin P., Wang L., Feng L. (2008). The nos gene cluster from Gram-positive bacterium Geobacillus thermodenitrificans NG80-2 and functional characterization of the recombinant NosZ. FEMS Microbiol Lett 289, 46–52. 10.1111/j.1574-6968.2008.01362.x [DOI] [PubMed] [Google Scholar]
  19. Miñana-Galbis D., Pinzón D. L., Lorén J. G., Manresa A., Oliart-Ros R. M. (2010). Reclassification of Geobacillus pallidus (Scholz et al. 1988) Banat et al. 2004 as Aeribacillus pallidus gen. nov., comb. nov. Int J Syst Evol Microbiol 60, 1600–1604. 10.1111/j.1574-6968.2008.01362.x [DOI] [PubMed] [Google Scholar]
  20. Nogales B., Timmis K. N., Nedwell D. B., Osborn A. M. (2002). Detection and diversity of expressed denitrification genes in estuarine sediments after reverse transcription-PCR amplification from mRNA. Appl Environ Microbiol 68, 5017–5025. 10.1128/AEM.68.10.5017-5025.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Nõlvak H., Truu M., Truu J. (2012). Evaluation of quantitative real-time PCR workflow modifications on 16S rRNA and tetA gene quantification in environmental samples. Sci Total Environ 426, 351–358. 10.1016/j.scitotenv.2012.03.054 [DOI] [PubMed] [Google Scholar]
  22. Pujol Pereira E. I., Chung H., Scow K., Sadowsky M. J., van Kessel C., Six J. (2011). Soil nitrogen transformations under elevated atmospheric CO2 and O3 during the soybean growing season. Environ Pollut 159, 401–407. 10.1016/j.envpol.2010.10.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ravishankara A. R., Daniel J. S., Portmann R. W. (2009). Nitrous oxide (N2O): the dominant ozone-depleting substance emitted in the 21st century. Science 326, 123–125. 10.1126/science.1176985 [DOI] [PubMed] [Google Scholar]
  24. Scala D. J., Kerkhof L. J. (1998). Nitrous oxide reductase (nosZ) gene-specific PCR primers for detection of denitrifiers and three nosZ genes from marine sediments. FEMS Microbiol Lett 162, 61–68. 10.1111/j.1574-6968.1998.tb12979.x [DOI] [PubMed] [Google Scholar]
  25. Singh B. K., Bardgett R. D., Smith P., Reay D. S. (2010). Microorganisms and climate change: terrestrial feedbacks and mitigation options. Nat Rev Microbiol 8, 779–790. 10.1038/nrmicro2439 [DOI] [PubMed] [Google Scholar]
  26. Smith R. L., Ceazan M. L., Brooks M. H. (1994). Autotrophic, hydrogen-oxidizing, denitrifying bacteria in groundwater, potential agents for bioremediation of nitrate contamination. Appl Environ Microbiol 60, 1949–1955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Suharti, de Vries S. (2005). Membrane-bound denitrification in the Gram-positive bacterium Bacillus azotoformans. Biochem Soc Trans 33, 130–133. 10.1042/BST0330130 [DOI] [PubMed] [Google Scholar]
  28. Throbäck I. N., Enwall K., Jarvis Å., Hallin S. (2004). Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. FEMS Microbiol Ecol 49, 401–417. 10.1016/j.femsec.2004.04.011 [DOI] [PubMed] [Google Scholar]
  29. Zumft W. G. (1997). Cell biology and molecular basis of denitrification. Microbiol Mol Biol Rev 61, 533–616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zumft W. G., Bothe H. (2007). Nitrous oxides reductases. In Biology of the Nitrogen Cycle, pp. 67–81. Edited by Bothe H., Ferguson S. J., Newton W. E. Amsterdam: Elsevier; 10.1016/B978-044452857-5.50006-0 [DOI] [Google Scholar]

Articles from Microbiology are provided here courtesy of Microbiology Society

RESOURCES