Abstract
Ecdysteroids initiate signaling along multiple pathways that regulate various aspects of development, maturation, and reproduction in arthropods. Signaling often involves the induction of downstream transcription factors that either positively or negatively regulate aspects of the pathway. We tested the hypothesis that crustaceans express the nuclear receptors HR3 (ortholog to vertebrate ROR) and E75 (ortholog to vertebrate rev-erb) in response to ecdysteroid signaling. HR3 and E75 cDNAs were cloned from the crustacean Daphnia magna. The DNA binding domain and ligand binding domain of the daphnid HR3 was 95% and 61% identical to those of Drosophila melanogaster. The DNA binding domain and ligand binding domain of the daphnid E75 was 100% and 71% identical to those of D. melanogaster. Both receptors exhibited structural characteristics of binding to DNA as a monomer. The expression of these receptor mRNAs was evaluated through the adult molt cycle and during embryo development. E75 levels were relatively constant throughout the adult molt cycle and through embryo development. HR3 levels were comparable to those of E75 during the initial phases of the adult molt cycle but were elevated ~30-fold at a time in the cycle co-incident with the pre-molt surge in ecdysteroid levels. HR3 mRNA levels in embryos also varied coincident with ecdysteroids levels. To substantiate a role of ecdysteroids in the expression of HR3, daphnids were continuously exposed to 20-hydroxyecdysone and changes in gene expression were measured. HR3 levels were significantly induced by 20-hydroxyecdysone; while E75 levels were minimally affected. These results are consistent with the premise that transcription of HR3 is regulated by ecdysteroids in the crustacean Daphnia magna and that HR3 likely serves as a mediator of ecdysteroid regulatory action in crustaceans. The marginal induction of E75 by 20-hydroxyecdysone may represent limited, tissue or cell-type-specific induction of this transcription factor.
Keywords: nuclear receptor, water flea, molting, ecdysis, endocrine disruption
Introduction
The nuclear receptors comprise an ancient family of transcription factors whose origins predate the emergence of the Cnidaria (Laudet et al., 1992; Thornton, 2003; Bertrand et al., 2004). Seven nuclear receptor subfamilies are currently recognized (0 through VI) and members of all subfamilies have been identified in both deuterostomes and protostomes. Among the fully sequenced insect genomes, the mosquitos (Aedes aegypti, A.gambiae) possess 20 nuclear receptor genes (Holt et al., 2002; Cruz et al., 2009), the fruitfly (Drosophila melanogaster) possesses 21 nuclear receptor genes (Adams et al., 2000), and the honeybee ( Apis mellifera) possesses 22 nuclear receptor genes (Velarde et al., 2006). Recently, the water flea (Daphnia pulex) genome was sequenced (http://wFleaBase.org) representing the first fully sequenced crustacean genome. We identified 25 nuclear receptor genes in the D. pulex genome (Thomson et al., 2009).
Among the approximately two dozen nuclear receptors of arthropods, only one, the ecdysteroid receptor (EcR), has been clearly established to be ligand-activated. Ecdysteroids (e.g., 20-hydroxyecdysone, ponasterone A) bind to and activate the EcR which in heterodimeric association with the nuclear receptor RXR/USP activates transcription of responsive genes (Riddiford et al., 2000). We recently demonstrated that the daphnid RXR is activated by the ligand tributyltin; however, a physiologically relevant ligand to this receptor was not identified (Wang and LeBlanc, 2009). With the exception of EcR and RXR, little is known of the function of the nuclear receptors of crustaceans, despite the tremendous economic value of these organisms.
In insects, ecdysteroid signaling results in the induction of downstream nuclear receptors which expand the breadth of gene networks regulated by the hormone (Thummel, 1995; Thummel, 1996). These downstream receptors are recognized as orphans and may function as ligand-independent transcription factors. Two such downstream receptors HR3 (NR1F) and E75 (NR1D) tend to function reciprocally in mediating ecdysteroid-initiated responses. Both genes are induced in response to ecdysteroids in insects (Palli et al., 1995; Jindra and Riddiford, 1996); however, E75 serves as a repressor of HR3-mediated gene regulation (Swevers et al., 2002). Repression occurs both through heterodimerization of the two receptors and through competitive binding at the response element (Swevers et al., 2002). Both HR3 and E75 have critical roles in oogenesis and embryo development (Carney et al., 1997; Bialecki et al., 2002).
A portion of the HR3 cDNA was reportedly cloned from the American lobster (Homarus americanus) (El Haj et al., 1997) and E75 cDNA has been cloned from the tropical land crab (Gecarcinus lateralis) (Kim et al., 2005). Both nuclear receptor genes were annotated from the water flea (D. pulex) genome (Thomson et al., 2009). Their presence in crustaceans suggests that, as in insects, these nuclear receptors may have important roles in crustacean ecdysteroid signaling. The goals of the present study were: 1) to clone HR3 and E75 from the same crustacean species Daphnia magna, 2) evaluate the expression of these receptors during development and growth, and 3) establish the responsiveness of these receptors to ecdysteroids.
Elucidation of the factors that transduce ecdysteroid signals in crustaceans could have significant impacts on identifying means of enhancing and optimizing ecdysteroid-regulated processes related to growth, development and reproduction in aquaculture applications. Ecdysteroid signal transduction is altered by chemicals that bind to either the EcR or the RXR as agonists or antagonists (Mikitani, 1996; Mu and LeBlanc, 2002, 2004a, b; Mu et al., 2005; Li et al., 2008; Wang and LeBlanc, 2009). While considered orphans, downstream nuclear receptor transcription factors, such as HR3 and E75, possess ligand-binding sites and could thus similarly serve as targets for disruption by environmental chemicals.
Materials and Methods
Water fleas
Water fleas (Daphnia magna) used in this study were obtained from cultures maintained in our laboratory for over 17 years. Daphnids were reared in media reconstituted from deionized water as described previously (Wang et al., 2007). Cultured daphnids were maintained at a density of 40 adults per 800 ml of media and were fed twice daily with 2.0 ml (1.4×108 cells) of a suspension of unicellular green algae, Pseudokirchneriella subcapitata and 1.0 ml (~4 mg dry weight) of Tetrafin™ fish food suspension (Tetra Holding Inc., Blacksburg, VA, USA) per 800 ml of media. All daphnids were housed in incubators set to 20°C with a 16/8 hour light/dark cycle. Daphnids used in the experiments reproduced exclusively by parthenogenesis and were all female.
Full-length E75 cDNA derivation
Adult female daphnids were homogenized with a dounce homogenizer. The SV Total RNA Isolation System (Promega, Madison, WI) was used to isolate RNA from the homogenate. RNA yield was determined by absorbance at 260 nm and its purity was measured by the 260/280 nm absorbance ratio with a Nanodrop ND-100 Spectrophotometer (NanoDrop Technologies, Montchanin, DE). RNA integrity was verified by formaldehyde agarose gel electrophoresis. RNA was reverse transcribed to cDNA with oligo dT primers using the ImProm-II™ Reverse Transcription System (Promega, Madison, WI).
A 210 bp fragment was obtained by degenerate-based PCR. Primers were designed using the COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOP) program with a blocks format sequence alignment (Rose et al, 1998) of E75 from other species (GenBank accession numbers: AAY89587, AF092946, XP_971362, http://www.ncbi.nlm.nih.gov/). The codon usage table was set for Artemia fransicana as the closest related species. The primer sequences were: 5’-TGGTACTACTGTTCTTTGTCGAGTTTGYGGNGAYAA-3’ and 5’- ACAGCAATACACTTTTTAAGTCGACARTAYTGRCA-3’. The PCR product was amplified from 200 ng cDNA using 10 µL PCR Master Mix (Promega) and 0.4 µM of each primer. The first round of PCR cycling followed standard 3-step PCR (denaturation at 95°C for 1 min., annealing at 52°C for 45 sec, and extension at 72°C for 1 min) for 40 cycles. This PCR product was then used as template in a second round of PCR, performed using an annealing temperature of 56°C. The fragment was cloned into the vector pCR®4-TOPO using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). Primer extension sequencing was performed by SeqWright Inc. (Houston, TX).
Rapid amplification of cDNA ends (RACE) was used to obtain full-length cDNA. 5’-RACE was performed using the SMART™ RACE kit (Clonetech, Mountain View, CA) and 3’-RACE was conducted using the GeneRacer™ kit (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. Briefly, gene specific primer (GSP) sequences were: (5’ RACE): 5’-GGACGACCGACTGCATGAGCTGAAC -3’, (5’ nested RACE): 5’-CCAAATCGCACAGCATCACGACTCA -3’, (3’RACE): 5’-CTGCGAAGGTTGCAAGGGTTTCTTC -3’, and (3’ nested RACE): 5’-CAGTGCTCCATTCTTCGCATCAACC -3’. For 5’ RACE, the first strand cDNA synthesis was processed as per the recommendation of the supplier. The cDNA was subsequently used (30 ng) as template for PCR with 21 µL SuperMix High Fidelity reaction solution (Invitrogen), 0.2 µM Universal primer (SMART RACE kit), 0.2 µM GSP in a total volume of 25 µL. The following touchdown PCR cycling protocol was used: denature at 94°C for 30 sec, anneal at 72°C for 3 min for the first 5 cycles, then drop the annealing temperature to 70°C and add an extension step of 72°C for 3 min for the next 5 cycles, and finally drop annealing temperature to 68°C for the remaining 25 cycles. The product from the first round of PCR was used to perform nested PCR, as above, using the 5’ nested race primer at 0.2 µM.
For 3’RACE, mRNA was reverse transcribed using the GeneRacer™ Oligo dT primer. PCR was performed with 22 µI SuperMix High Fidelity reaction solution (Invitrogen), 0.4 µM primers, and 100 ng template cDNA for a total volume of 25 µI, under the following conditions: denature at 94°C for 30 sec, anneal at 64°C and extend at 72°C for 3 min, for a total of 40 cycles. The template from the first round of PCR was re-amplified using the 3’ nested RACE primer in a second round of PCR. Products of both 5’ and 3’ nested RACE were purified from a 1.2% agarose gel using Wizard® SV Gel and PCR Clean-Up System (Promega), and cloned and sequenced as above. The E75 amino acid sequence was determined and the molecular weight of the protein was calculated using ExPASy software (http://www.expasy.org/). Prediction of the DBD and LBD conserved domain locations within the sequence were made using NCBI protein-BLAST (Altschul et al., 1997).
Open-Reading Frame (ORF) HR3 cDNA derivation
A 148 bp fragment with identity to HR3 of other species (GenBank accession numbers: AAF36970, P31396, NP_001037012) was obtained by CODEHOP-PCR (as above). The hybrid consensus-degenerate primer sequences were as follows: 5’-TGATCGAGTTAATCGAAATCGATGYCARTAYTG -3’ and 5’-GAGCAGCATCAGATTGAGCTCKCATYTGNGC -3’. One round of standard 3-step PCR was performed, using an annealing temperature of 52°C.
3’ RACE was performed as described for E75, using the GSP primer 5’-AGTCATCACCTGCGAGGGC -3’. Nested PCR was unnecessary. The RACE PCR product was cloned and sequenced. The remainder of the HR3 gene sequence was obtained through PCR using primers designed at the 5’ and 3’ ends of the predicted HR3 sequence derived from the Daphnia pulex genome (Thompson et al 2009). The primers 5’- GGTACCGCCATGGAAGCTCCGGCCGTTCCG -3’ and 5’-CTCGAGATCCACGGAAAAGAGTTCCTTGTG -3’ were used with cDNA derived from adult female daphnid RNA and reagents/cycling parameters as described above for standard 3-step PCR. Conserved nuclear receptor domains were predicted as above.
The products were purified, cloned and sequenced. The amino acids of the HR3 protein were deduced based on the total nucleotide sequence of the ORF and the molecular weight of the protein was calculated based on the amino acid constituency using ExPASy software.
Profiling gene expression over a molt cycle
Three hundred daphnids (<24 hrs old) were reared for 5 days (100 daphnids/1 L media containing food, micronutrients, and salts as described for culture media). On the fifth day, daphnids were divided among six 1-L beakers (50 daphnids/beaker) to accommodate the increased size of the organisms. On the tenth day, daphnids were individually distributed among 50 ml beakers containing 40 ml media. The next morning, any daphnid that had molted during the past day (i.e., an exoskeleton present in the beaker) was discarded and remaining animals were monitored every two hours for the presence of an exoskeleton in the beaker. Upon evidence of molting, the daphnid was designated as being at time 0 in its molt cycle and the animal was targeted for sampling at either time 0, 12, 24, 36, 48, and 60 hours. This process continued until ~30 animals were targeted for sampling at each time point. At sampling, animals were placed in RNALater™ (Qiagen, Valencia, CA, USA) solution in groups of 8–10 individuals (3 replicates consisting of 8–10 animals per replicate for each time point) and stored at 4°C until processed. At processing, RNALater™ solution was removed and replaced with 175 µl of Promega™ lysis buffer (Madison, WI, USA). Samples were homogenized with a dounce homogenizer and RNA was isolated, quantified, assessed for purity and integrity, and reverse transcribed to cDNA as described above. cDNA were quantified by absorbance as described above.
Profiling gene expression during embryo development
Embryos of developmental stages 1 through 6 (Kast-Hutcheson et al., 2001) were excised from the brood chamber of maternal organisms and combined to yield approximately 350 embryos of each developmental stage. These embryo pools represented the combined broods of 15–20 maternal organisms. RNA was isolated and cDNA prepared as described above.
Profiling gene expression in response to 20-hydroxyecdysone
Animals were staged for position in the molt cycle as described above. At 0 hour, daphnids were individually transferred to either control media or media containing 1.0 µM 20-hydroxyecdysone. 20-hydroxyecdysone was delivered to the media dissolved in absolute ethanol and both controls and 20-hydroxyecdsone-containing solution contained 0.001% ethanol. Animals were sampled at designed time intervals and processed for RNA isolation and cDNA preparation as described above.
Real time RT-PCR
Relative targeted mRNA levels were assessed during the time course experiments using real-time RT PCR. Primers were designed based upon the cDNA sequences derived in the present study for HR3 and E75. Primers used to measure EcR-A mRNA levels were based upon the previously published sequence for this cDNA (Wang and LeBlanc, 2009). All primers were designed using ABI Primer Express software (Applied Biosystems, Foster City, CA). Primer sequences were as follows: E75 F: 5’-TCCGGAGAAGTATTCAACAAAAGA-3’, E75 R: 5’-TGCGAAGAATGGAGCACTGT -3’, HR3 F: F 5’- AGTCATCACCTGCGAGGGC-3’, HR3 R: R 5’-GAACTTTGCGACCGCCG -3’, EcR-A F: F 5’- CAGCGCTATGGAAGAATGGT -3’, EcR-A R: R 5’-TCATCGACATGGACGAACTG -3’. Actin (accession number AJ292554) cDNA was also amplified and used in the normalization of transcripts as described previously (David et al., 2003; Zeis et al., 2003; Rider et al., 2005; Wang and LeBlanc, 2009). Amplicons generated ranged from 51 to 72 base pairs. Quantitative real-time PCR was performed on an ABI Prism 7000 Sequence Detection System (Applied Biosystems) using default parameters. Amplification mixtures consisted of 12.5 µl SYBR Green PCR Master Mix (Applied Biosystems), 300 nM primers, 250 ng template cDNA in a total volume of 25 µl. Primer concentrations were optimized following the manufacturer’s recommendations. The reaction mixtures were first kept at 95°C for 10 minutes, followed by 40 cycles with each cycle consisting of a temperature of 95°C for 15 sec followed by 60°C for 1 min. After the PCR reactions, the melting temperature of PCR product was determined using the dissociation protocol provided by the instrument manufacturer. A single melting peak was detected for all samples indicating no amplification of non-target DNA. Furthermore, only a single amplification product was detected following electrophoresis in a 2% agarose gel and staining with ethidium bromide. The comparative Ct method (2−ΔΔCT) was used to assess the relative levels of EcR-A, HR3 or E75 mRNA normalized to mRNA levels of actin measured with the same cDNA sample. Results in Fig. 5 and Fig. 6 represent absolute abundance of gene products. Results in Fig. 7 are presented relative to mRNA levels measured at time 0. The time 0 levels were arbitrarily set at 1.0. Validation experiments, as described by the instrument manufacturer, confirmed that the efficiencies of the target and endogenous control (actin) amplifications were approximately equal (Applied Biosystems).
Figure 5.
Absolute expression of HR3 (closed squares) and E75 (open circles) mRNA levels through the molt cycle of D. magna. Data are presented as mean and standard deviation (n=3). An asterisk denotes significant difference from the respective control for each gene at P≤0.05 (ANOVA, Dunnett’s test).
Figure 6.
Absolute expression of HR3 (closed squares) and E75 (open circles) mRNA levels during six stages of embryo development. Data are presented as mean and standard deviation (n=3). An asterisk denotes significant difference from the respective Stage 1 level for each gene at P≤0.05 (ANOVA, Dunnett’s test).
Figure 7.
Relative expression of EcR-A (A), HR3 (B), and E75 (C) mRNA in untreated daphnids (circles) and in response to I.0 µM 20-hydroxyecdysone (squares). Data are presented relative to mRNA levels at time 0 which was set at 1.0. Data are presented as mean and standard deviation (n=3). An asterisk denotes significant difference from the respective control value at each time point at P≤0.05 (Student’s t-test).
Statistical Analysis
Significant differences in gene expression over a molting cycle and were determined for each gene compared with the respective “time 0” by ANOVA and Dunnett’s test using JMP software (SAS Institue, Cary, NC). Significant differences in gene expression at each embryo stage compared with the respective Stage 1 also were evaluated using ANOVA and Dunnett’s test. Significant induction of genes from 20-hydroxyecdysone exposure was evaluated using Student’s t-test.
Results
HR3 cDNA
Using RACE PCR, the full length open reading frame cDNA for D. magna HR3 was obtained (GenBank accession # FJ755466) (Fig. 1). The cDNA was 1866 nucleotides in length and coded for a protein having a molecular weight of 67,935. The D. magna HR3 protein has the typical domain structure of the nuclear receptors (domains A through E), but lacks the F domain associated with some nuclear receptors. The protein possesses a highly conserved DNA-binding C domain with 95% and 80% identity to the Drosophila melanogaster and Homo sapiens orthologs, respectively (Fig. 2). Adjacent to the C domain is a highly conserved 32 amino acid C-terminal extension with 97% and 62% identity to the D. melanogaster and H. sapiens orthologs, respectively. This extension of the DNA-binding domain has been implicated in monomeric DNA binding in other nuclear receptors (Wilson et al., 1993; Gearhart et al., 2003). The ligand binding E domain of the D. magna HR3 is 61% and 35% identical to the D. melanogaster and H. sapiens orthologs, respectively. These results indicate that daphnids, and perhaps crustaceans in general, express the nuclear receptor HR3. The receptor possesses a high degree of similarity to HR3 in Drosophila and likely binds DNA as a monomer to regulate gene transcription.
Figure 1.
Nucleotide (lower case) and deduced amino acid (upper case) sequences of the D. magna HR3 open reading frame cDNA. Shaded regions correspond to the location of primers used for Real Time RT-PCR.
Figure 2.
Comparison of the D. magna HR3 amino acid sequence to those of Drosophila melanogaster (DmHR3, ABN49269.2) and Homo sapiens (ROR, NP_599022). GenBank accession number follows gene name in parentheses. The putative DNA-binding C domain and ligand-binding E domain are underlined in the D. magna sequence. Shaded areas denote amino acid identity with D. magna.
E75 cDNA
The nuclear receptor E75 also was successfully cloned from D. magna (GenBank accession # EF369510.1). This cDNA was considerably larger than that of HR3 and consisted of an open reading frame of 2,826 nucleotides that coded for a protein having a molecular weight of 102,407 (Fig. 3). Daphnid E75 possessed a highly conserved DNA binding C domain that was 100%, 100%, and 81% identical to those of orthologous receptor proteins in the tropical land crab Gecarcinus lateralis, the fruitfly D. melanogaster, and the human H. sapiens, respectively (Fig. 4). The C domain possessed two zinc finger domains and a highly conserved C-terminal extension suggesting that unlike some E75 forms (Segraves and Hogness, 1990; Jindra et al., 2005), the cloned daphnid E75 possesses DNA-binding characteristics. The hinge region (domain D) of the daphnid E75 was comparable in length to those of G. lateralis and D.melanogaster, but was considerably shorter than that of the human ortholog rev-erb-α. The ligand-binding domain for daphnid E75 was 71%, 52%, and 42% identical to domain E of E75 from G. lateralis, D. melanogaster, and H. sapiens, respectively. The daphnid E75 ligand-binding domain contained all of the key histidine and cysteine residues that have been shown to function in the binding of a heme moiety (Reinking et al., 2005; de Rosny et al., 2006). In contrast to daphnid HR3 which possessed no F domain, daphnid E75 possesses an extensive F domain that was largely responsible for the increased molecular mass of the receptor as compared to HR3 (Fig. 4). G. lateralis and D. melanogaster also possess extended F domains, though the degree of similarity among the F domains among the three species was low. The H. sapiens ortholog reverb-α possesses no F domain.
Figure 3.
Nucleotide (lower case) and deduced amino acid (upper case) sequences of the D. magna E75 cDNA. Shaded regions correspond to the location of primers used for Real Time RT-PCR.
Figure 4.
Comparison of the D. magna E75 amino acid sequence to those of the tropical land crab Gecarcinus lateralis (AAY89587.2), Drosophila melanogaster (E75A, AAF49282) and Homo sapiens (rev-erb α, CAB53540). GenBank accession number follows gene name in parentheses. The putative DNA-binding C domain and ligand-binding E domain are underlined in the D. magna sequence. Boxed amino acids correspond to the zinc fingers. Shaded areas denote amino acid identity with D. magna. Darker shaded areas correspond to conserved histidine (H) and cysteine (C) residues implicated with heme moiety binding. GenBank accession number follows gene name in parentheses.
Receptor expression
Experiments were performed to determine whether the HR3 and E75 receptor genes are expressed in daphnids and whether levels of expression vary over the molt cycle of the organism. mRNAs from both receptor genes were detected throughout the molt cycle. HR3 and E75 mRNA levels were comparable early in the molt cycle. HR3 mRNA levels increased over time with an ~30-fold elevation in mRNA levels 48-hours into the molt cycle. This increase in HR3 levels corresponded to the temporal increase in ecdysteroid levels during the cycle (Martin-Creuzburg et al., 2007). Levels decreased significantly following this peak (Fig. 5). In contrast, E75 mRNA levels were relatively constant through the molt cycle (Fig. 5).
Previous studies have shown that ecdysteroid levels are greatest early in embryo development (Mu and LeBlanc, 2004b). Daphnid embryos were evaluated at six stages of development (as described by (Kast-Hutcheson et al., 2001)) for relative levels of HR3 and E75 mRNA. HR3 mRNA levels were greatest early in embryo development and significantly declined to approximately 30% of maximum levels by stage 4 (Fig. 6). E75 mRNA levels were appreciably lower than those of HR3 throughout embryo development. E75 levels also declined significantly by stage 5 of embryo development (Fig. 6). Thus, both HR3 and E75 levels were co-elevated when ecdysteroid levels are reportedly highest in embryos, though expression of HR3 is appreciably greater.
The apparent coordinated expression of HR3 with ecdysteroids levels during both the molt cycle and during embryo development prompted the evaluation of changes in HR3 and E75 levels in response to exposure to exogenous 20-hydroxyecdysone. The ecdysteroid receptor EcR-A also was evaluated as a positive control for 20-hydroxyecdysone exposure. As described previously with insect EcR (Roesijadi et al., 2007), EcR-A mRNA levels increased rapidly with exposure to 20-hydroxyecdysone (Fig. 7A). After 24 hrs exposure, EcR-A mRNA levels decreased and, by 48 hrs, approached levels measured at time 0. HR3 mRNA levels also increased in response to 20-hydroxyecdysone exposure (Fig. 7B); however, elevated mRNA levels were evident later than was observed for EcR-A (12 hrs versus 6 hrs). Untreated (control) daphnids also experienced an increase in HR3 mRNA levels (presumably due to increases in endogenous ecdysteroid levels associated with molting); however, induction occurred sooner and was greater among 20-hydroxyecdysone exposed organisms. E75 mRNA levels were slightly elevated among 20-hydroxyecdysone–treated daphnids by 48 hours following exposure (Fig. 7C). These results demonstrate that the daphnid HR3 gene is ecdysteroid activated resulting in a significant elevation in HR3 levels just prior to molting. In contrast, E75 levels are relatively unresponsive to 20-hydroxyecdysone.
Discussion
20-Hydroxyecdysone mediates a cascade of gene regulatory events leading to the control of various aspects of development, growth, and reproduction. In insects, transregulatory elements along the 20-hydroxyecdysone signaling cascade are often characterized as early, early-late, and late genes. Early genes are activated in direct response to the 20-hydroxyecdysone/EcR complex; whereas, early-late and late genes are activated in response to protein products produced earlier in the cascade. HR3 and E75 are two regulatory proteins that contribute to ecdysteroid signaling cascades in insects. HR3 is recognized as an early- late gene and E75 as an early gene in the ecdysteroid signaling cascade (Segraves and Hogness, 1990; Horner et al., 1995; White et al., 1997). HR3 binds to the RORE motif of responsive genes to function as a constitutive activator to gene transcription (Swevers et al., 2002; Reinking et al., 2005). In contrast, E75 is viewed as a negative regulator of HR3 mediated transcription (Swevers et al., 2002; Reinking et al., 2005). E75 has been shown to suppress the action of HR3 by either binding to HR3 or by competing with HR3 for DNA binding (White et al., 1997; Swevers et al., 2002; Reinking et al., 2005). Nitric oxide has been shown to be a ligand for E75 in Drosophila and ligand binding to E75 relieves it of its suppressive action towards HR3 (Reinking et al., 2005).
Despite the rather extensive characterization of the actions of HR3 and E75 in insect ecdysteroid signaling, little is known of the role of these proteins in crustaceans. A cDNA identified as HR3 was partially cloned from the lobster Homarus americanus (El Haj et al., 1997). This mRNA was expressed in muscle, epidermis, and eye stalk and was shown to be ecdysteroid-inducible in muscle. E75 was cloned from the shrimp Metapenaeus ensis (Chan, 1998) and the tropical land crab Gecarcinus lateralis (Kim et al., 2005). E75 mRNA was measured in all tissues examined from both species. Whether E75 is ecdysteroid-inducible in decapods crustaceans, as in insects, was not determined in these studies. These efforts demonstrate that HR3 and E75 are expressed in decapods crustaceans but provide little information on their role in crustacean ecdysteroid signaling.
We recently identified genes for HR3 and E75 in the fully sequenced genome of Daphnia pulex (Thomson et al., 2009). Presently, we show that HR3 is differentially expressed during the molt cycle of the related species Daphnia magna and that this differential expression is due to the elevated HR3 mRNA levels in response to ecdysteroids. Thus, the expression and hormonal responsiveness of daphnid HR3 is consistent with its role as a down-stream mediator of ecdysteroid signaling. The DNA binding domain of the daphnid HR3 is 95% and 80% identical to the DNA-binding domains of Drosophila HR3 and human ROR. These latter receptors transactivate gene expression through recognition of the half-site: AGGTCA (Horner et al., 1995). The high degree of similarity between the daphnid HR3 and these orthologs suggests that the daphnid receptor also binds to this response element to activate gene expression. The DNA binding domain is flanked by a highly conserved C-terminal extension that provides stability, particularly to monomeric receptors, to the binding interaction between receptor protein and its cognate DNA binding site (Wilson et al., 1993; Peters and Khan, 1999). Thus like its orthologs, the daphnid HR3 likely transactivates gene expression as a monomeric transcription factor.
The daphnid E75 cDNA also shares many common structural features with its orthologs. The daphnid E75 DNA-binding domain possesses two complete zinc finger motifs which implicates it as a DNA-binding protein and differentiates it from Drosophila and Galleria E75B which lack one zinc finger (Segraves and Hogness, 1990; Jindra et al., 2005). The C-terminal extension flanking the DNA-binding domain indicates that, like HR3, daphnid E75 can bind DNA response elements as a monomer. The 100% identity of the daphnid E75 DNA binding domain with that of Drosophila E75A indicates that, like Drosophila E75A and HR3, daphnid E75 is capable of binding the AGGTCA half-site. Studies with Drosophila receptors indicate that heme can bind to the ligand-binding domain of the E75 receptor and that nitric oxide and carbon monoxide are capable of modifying the function of E75 by binding to the heme moiety (Reinking et al., 2005). The daphnid E75 ligand-binding domain contains all of the cysteine and histidine residues that are critical to heme binding (Reinking et al., 2005; de Rosny et al., 2006). Thus, the daphnid E75 is also likely to be a heme binding protein and may be regulated by nitric oxide and carbon monoxide.
Two mechanisms have been identified in insects by which E75 may suppress the transcriptional activity of HR3. E75 has been shown to bind and competitively displace HR3 from its DNA binding site (Swevers et al., 2002). HR3 and E75 have also been shown to form a heterodimeric complex (Reinking et al., 2005). This dimer is capable of binding to the DNA binding site via HR3-DNA interaction (White et al., 1997). This complex suppresses gene activation in a manner that is dependent upon the E75 F-domain (Swevers et al., 2002). The function of the F-domain on some nuclear receptors is equivocal; however, evidence indicates that this domain serves to modulate the interaction of co-activators with the E-domain (Peters and Khan, 1999; Sladek et al., 1999). The binding of nitric oxide to the heme moiety lodged within the ligand-binding pocket of E75 apparently prevents association of E75 with HR3 resulting in the restoration of HR3 transcriptional activity (Reinking et al., 2005). The structure of the daphnid E75 indicates that it has DNA binding capability, heme binding capability, and suppressive activity associated with an extended F-domain and may thus regulate the action of HR3 through both mechanisms.
HR3 mRNA levels were significantly induced during the molt cycle of the organisms with an ~30-fold elevation in mRNA levels measured 48 hours into the molt cycle. 20-hydroxyecdysone levels reach their pre-molt apex at ~44 hours (Martin-Creuzburg et al., 2007) suggesting that the increase in HR3 was due to elevated 20-hydroxyecdysone levels. Embryonic levels of HR3 mRNA were greatest early in embryo development which also corresponds to the time of greatest ecdysteroid levels (Mu and LeBlanc, 2004b). Direct exposure of daphnids to exogenous 20-hydroxyecdysone confirmed that the pre-molt and early embryonic increases in HR3 levels was due to 20-hydroxyecdysone. We also observed that the ecdysteroid receptor (EcR-A) mRNA levels were significantly elevated by 20-hydroxyecdysone. However, while significant induction of EcR-A mRNA levels occurred within 6 hours of 20-hydroxyecdysone exposure, increased HR3 mRNA levels were evident beginning at 12 hours of exposure. These temporal differences in expression of these genes suggests that activation of the HR3 gene occurs subsequent to the immediate early gene responses to ecdysteroid/EcR/RXR signaling such as the induction of EcR-A. Interestingly, EcR-A was not induced over the molt cycle of the daphnids (Fig. 7A), which is similar to previous evaluations of EcR-A in D. magna (Kato et al., 2007). This lack of responsiveness to increased endogenous ecdysteroid levels suggests that the sensitivity of EcR-A to the pre-molt increase in endogenous ecdysteroid levels may be attenuated by other regulatory factors.
In contrast to HR3, E75 mRNA levels were relatively constant with little responsiveness to 20-hydroxyecdysone. HR3 mRNA levels were in appreciable excess, relative to E75, early in embryonic development and immediately prior to molting. However, at other times HR3 and E75 mRNA levels were rather comparable. These assessments of relative abundance suggest that E75 may negatively regulate HR3 activity during some periods of development and growth, but may be sufficiently low to be permissive of HR3 activity during other periods.
In conclusion, the crustacean Daphnia magna expresses the nuclear receptors HR3 and E75 in a fashion that implicates these transcription factors in crustacean ecdysteroid signaling. The receptor proteins show a high degree of structural similarity with those of Drosophila suggesting that, as in Drosophila and other insects, these receptors function coordinately to both positively and negatively regulate gene transcription.
Acknowledgement
The authors acknowledge Ms. Gwijun Kwon for her assistance with the PCR analyses and Dr. Helen Wang for her assistance in the cloning of the gene products. This research was supported by US Environmental Protection Agency STAR grant RD- 83273901 and NSF grant IOS-0744210 to GAL. BRH was supported by NIEHS training grant # ES7046 and an EPA STAR fellowship.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, et al. The genome sequence of Drosophila melanogaster . Science. 2000;287:2185–2195. doi: 10.1126/science.287.5461.2185. [DOI] [PubMed] [Google Scholar]
- Altschul SF, Madden TL, Schäffer AA, Zhang ZZ, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acid Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bertrand S, Brunet FG, Escriva H, Parmentier G, Laudet V, Robinson-Rechava M. Evolutionary genomics of nuclear receptors: from twenty-five ancestral genes to derived endocrine systems. Mol. Biol. Evol. 2004;21:1923–1937. doi: 10.1093/molbev/msh200. [DOI] [PubMed] [Google Scholar]
- Bialecki M, Shilton A, Fichtenberg C, Segraves WA, Thummel CS. Loss of the ecdysteroid-inducible E75A orphan nuclear receptor uncouples molting from metamorphosis in Drosophila . Dev. Cell. 2002;3:209–220. doi: 10.1016/s1534-5807(02)00204-6. [DOI] [PubMed] [Google Scholar]
- Carney GE, Wade AA, Sapra R, Goldstein ES, Bender M. DHR3, an ecdysone-inducible early-late gene encoding a Drosophila nuclear receptor, is required for embryogenesis. Proc. Natl. Acad. Sci. USA. 1997;94:12024–12029. doi: 10.1073/pnas.94.22.12024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chan S-M. Cloning of a shrimp (Metapenaeus ensis) cDNA encoding a nuclear receptor superfamily member: an insect homologue of E75 gene. FEBS Lett. 1998;436:395–400. doi: 10.1016/s0014-5793(98)01148-x. [DOI] [PubMed] [Google Scholar]
- Cruz J, Sieglaff DH, Arensberger P, Atkinson PW, Raikhel AS. Nuclear receptors in the mosquito Aedes aegypti . FEBS J. 2009;276:1233–1254. doi: 10.1111/j.1742-4658.2008.06860.x. [DOI] [PubMed] [Google Scholar]
- David P, Dauphin-Villemant C, Mesneau A, Meyran JC. Molecular approach to aquatic environmental bioreporting: differential response to environmental inducers of cytochrome P450 monooxygenase genes in the detritivorous subalpine planktonic Crustacean, Daphnia pulex . Molec. Ecol. 2003;12:2473–2481. doi: 10.1046/j.1365-294x.2003.01913.x. [DOI] [PubMed] [Google Scholar]
- de Rosny E, de Groot A, Jullian-Binard C, Gaillard J, Borel F, Pebay-Peyroula E, Fontecilla-Camps JC, Jouve HM. Drosophila nuclear receptor E75 is a thiolate hemoprotein. Biochemistry. 2006;45:9727–9734. doi: 10.1021/bi060537a. [DOI] [PubMed] [Google Scholar]
- El Haj AJ, Tamone SL, Peake M, Sreenivasula Reddy P, Chang ES. An ecdysteroid-responsive gene in a lobster - a potential crustacean member of the steroid hormone receptor superfamily. Gene. 1997;201:127–135. doi: 10.1016/s0378-1119(97)00437-x. [DOI] [PubMed] [Google Scholar]
- Gearhart MD, Holmbeck SMA, Evans RM, Dyson HJ, Wright PE. Monomeric complex of human orphan estrogen related receptor-2 with DNA: a pseudo-dimer interface mediates extended half-site recognition. J. Mol. Biol. 2003;327:819–832. doi: 10.1016/s0022-2836(03)00183-9. [DOI] [PubMed] [Google Scholar]
- Holt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, Wincker P, Clark AG, Ribeiro JM, Wides R, et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 2002;298:129–149. doi: 10.1126/science.1076181. [DOI] [PubMed] [Google Scholar]
- Hopkins PM, Durica D, Washington T. RXR isoforms and endogenous retinoids in the fiddler crab, Uca pugilator . Comp. Biochem. Phys. A. 2008;151:602–614. doi: 10.1016/j.cbpa.2008.07.021. [DOI] [PubMed] [Google Scholar]
- Horner MA, Chen T, Thummel CS. Ecdysteroid regulation and DNA binding properties of Drosophila nuclear hormone receptor superfamily members. Dev. Biol. 1995;168:490–502. doi: 10.1006/dbio.1995.1097. [DOI] [PubMed] [Google Scholar]
- Jindra M, Riddiford LM. Expression of ecdysteroid-regulated transcripts in the silk gland of the wax moth, Galleria mellonella . Dev. Genes Evol. 1996;206:305–314. doi: 10.1007/s004270050057. [DOI] [PubMed] [Google Scholar]
- Jindra M, Sehnal F, Riddiford LM. Isolation, characterization and developmental expression of the ecdysteroid-induced E75 gene of the wax moth Galleria mellonella . European J. Biochem. 2005;221:665–675. doi: 10.1111/j.1432-1033.1994.tb18779.x. [DOI] [PubMed] [Google Scholar]
- Kast-Hutcheson K, Rider CV, LeBlanc GA. The fungicide propiconazole interferes with embryonic development of the crustracean Daphnia magna . Environ. Toxicol. Chem. 2001;20:502–509. doi: 10.1897/1551-5028(2001)020<0502:tfpiwe>2.0.co;2. [DOI] [PubMed] [Google Scholar]
- Kato Y, Kobayashi K, Oda S, Tatarazako N, Watanabe H, Iguchi T. Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphna magna . J. Endocrin. 2007;193:183–194. doi: 10.1677/JOE-06-0228. [DOI] [PubMed] [Google Scholar]
- Kim H-W, Lee SG, Mykles DL. Ecdysteroid-responsive genes, RXR and E75, in the tropical land crab, Gecarcinus lateralis: Differential tissue expression of multiple RXR isoforms generated at three alternative splicing sites in the hinge and ligand-binding domains. Mol. Cell. Endocrin. 2005;242:80–95. doi: 10.1016/j.mce.2005.08.001. [DOI] [PubMed] [Google Scholar]
- Laudet V, Hanni C, Coll J, Cetzeflis F, Stehelin D. Evolution of the nuclear receptor gene superfamily. EMBO J. 1992;11:1003–1013. doi: 10.1002/j.1460-2075.1992.tb05139.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li J, Ma MZW. A two-hybrid yeast assay to quantify the effects of xenobiotics on retinoid X receptor-mediated gene expression. Toxicol. Lett. 2008;176:198–206. doi: 10.1016/j.toxlet.2007.11.006. [DOI] [PubMed] [Google Scholar]
- Martin-Creuzburg D, Westerlund SA, Hoffmann KH. Ecdysteroid levels in Daphnia magna during a molt cycle: Determination by radioimmunoassay (RIA) and liquid chromatography-mass spectrometry (LC-MS) Gen. Comp. Endocrin. 2007;151:66–71. doi: 10.1016/j.ygcen.2006.11.015. [DOI] [PubMed] [Google Scholar]
- Mikitani K. A new nonsteroidal chemical class of ligand for the ecdsteroid receptor, 3,5-di-tert-butyl-4-hydroxy-N-isobutyl-benzamide shows apparent insect molting hormone activites at molecular and cellular levels. Biochem. Biophy. Res. Comm. 1996;227:427–432. doi: 10.1006/bbrc.1996.1524. [DOI] [PubMed] [Google Scholar]
- Mu X, LeBlanc GA. Environmental antiecdysteroids alter embryo development in the crustacean Daphnia magna . J. Exp. Zool. 2002;292:287–292. doi: 10.1002/jez.10020. [DOI] [PubMed] [Google Scholar]
- Mu X, LeBlanc GA. Cross communication between signaling pathways: Juvenoid hormones modulate ecdysteroid activity in a crustacean. J. Exp. Zool. 2004a;301A:793–801. doi: 10.1002/jez.a.104. [DOI] [PubMed] [Google Scholar]
- Mu X, LeBlanc GA. Synergistic interaction of endocrine disrupting chemicals: Model development using an ecdysone receptor antagonist and a hormone synthesis inhibitor. Environ. Toxicol. Chem. 2004b;23:1085–1091. doi: 10.1897/03-273. [DOI] [PubMed] [Google Scholar]
- Mu X, Rider CV, Hwang GP, Hoy H, LeBlanc GA. Covert signal disruption: Anti-ecdysteroidal activity of bisphenol A involves cross-talk between signaling pathways. Environ. Toxicol. Chem. 2005;24:146–152. doi: 10.1897/04-063r.1. [DOI] [PubMed] [Google Scholar]
- Palli SR, Sohi SS, Cook BJ, Lambert D, Ladd TR, Retnakaran A. Analysis of ecdysteroid action in Malacosaom disstria cells: cloning selected regions of E75- and MHR3-like genes. Insect Biochem. Mol. Biol. 1995;25:697–707. doi: 10.1016/0965-1748(95)00008-j. [DOI] [PubMed] [Google Scholar]
- Peters GA, Khan SA. Estrogen receptor domains E and F: Role in dimerization and interaction with coactivator RIP-140. Mol. Endocrinol. 1999;13:286–296. doi: 10.1210/mend.13.2.0244. [DOI] [PubMed] [Google Scholar]
- Reinking J, Lam MMS, Pardee K, Sampson HM, Liu S, Yang P, Williams S, White W, Lajoie G, Edwards A, Krause HM. The Drosophila nuclear receptor E75 contains heme and is gas responsive. Cell. 2005;122:195–207. doi: 10.1016/j.cell.2005.07.005. [DOI] [PubMed] [Google Scholar]
- Riddiford LM, Cherbas P, Truman JW. Ecdysone receptors and their biological actions. Vitam. Horm. 2000;60:1–73. doi: 10.1016/s0083-6729(00)60016-x. [DOI] [PubMed] [Google Scholar]
- Rider CV, Gorr TA, Olmstead AW, Wasilak BA, LeBlanc GA. Stress Signaling: Co-regulation of hemoglobin and male sex determination through a terpenoid signaling pathway in a crustacean. J. Exp. Biol. 2005;208:15–23. doi: 10.1242/jeb.01343. [DOI] [PubMed] [Google Scholar]
- Roesijadi G, Rezvankhah S, Binninger DM, Weissbach H. Ecdysone induction of MsrA protects against oxidative stress in Drosophila. Biochem. Biophys. Res. Comm. 2007;354(2):511–516. doi: 10.1016/j.bbrc.2007.01.005. [DOI] [PubMed] [Google Scholar]
- Segraves WA, Hogness DS. The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila encodes two new members of the steroid receptor superfamily. Genes Dev. 1990;4:204–219. doi: 10.1101/gad.4.2.204. [DOI] [PubMed] [Google Scholar]
- Sladek FM, Ruse MD, Jr., Nepomuceno L, Huang S-M, Stallcup MR. Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4α1. Mol. Cell Biol. 1999;19:6509–6522. doi: 10.1128/mcb.19.10.6509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Swevers L, Ito K, Iatrou K. The BmE75 nuclear receptors function as dominant repressors of the nuclear receptor BmHR3A. J. Biol. Chem. 2002;277:41637–41644. doi: 10.1074/jbc.M203581200. [DOI] [PubMed] [Google Scholar]
- Thomson SA, Baldwin WS, Wang YH, Kwon G, LeBlanc GA. Annotation, phylogenetics, and expression of the nuclear receptors in Daphnia pulex . BMC Genomics. 2009 doi: 10.1186/1471-2164-10-500. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thornton JW. Nonmammalian nuclear receptors: Evolution and endocrine disruption. Pure Appl. Chem. 2003;75:1827–1839. [Google Scholar]
- Thummel CS. From embryogenesis to metamorphosis: the regulation and function of Drosophila nuclear receptor superfamily members. Cell. 1995;83:871–877. doi: 10.1016/0092-8674(95)90203-1. [DOI] [PubMed] [Google Scholar]
- Thummel CS. Flies on steroids--Drosophila metamorphosis and the mechanisms of seroid hormone action. Trends Genet. 1996;12:306–310. doi: 10.1016/0168-9525(96)10032-9. [DOI] [PubMed] [Google Scholar]
- Velarde RA, Robinson GESEF. Nuclear receptors of the honey bee: annotation and expression in the adult brain. Insect Mol. Biol. 2006;15:583–595. doi: 10.1111/j.1365-2583.2006.00679.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang YH, LeBlanc GA. Interactions of methyl farnesoate and related compounds with a crustacean retinoid X receptor. Mol. Cell. Endocrin. 2009 doi: 10.1016/j.mce.2009.05.016. < http://dx.doi.org/10.1016/j.mce.2009.05.016>. [DOI] [PubMed] [Google Scholar]
- Wang YH, Wang G, LeBlanc GA. Cloning and characterization of the retinoid X receptor from a primitive crustacean Daphnia magna . Gen. Comp. Endocrinol. 2007;150:309–318. doi: 10.1016/j.ygcen.2006.08.002. [DOI] [PubMed] [Google Scholar]
- White KP, Hurban P, Watanabe T, Hogness DS. Coordination of Drosophila metamorphosis by two ecdysone-induced nuclear receptors. Science. 1997;276:114–117. doi: 10.1126/science.276.5309.114. [DOI] [PubMed] [Google Scholar]
- Wilson TE, Farhner TJ, Milbrandt J. The orphan receptors NGF1-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol. Cell. Biol. 1993;13:5794–5804. doi: 10.1128/mcb.13.9.5794-5804.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeis B, Becher B, Goldmann T, Clark R, Vollmer E, Bolke B, Bredebusch I, Lamkemeyer T, Pinkhaus O, Pirow R, Paul RJ. Differential haemoglobin gene expression in the crustacean Daphnia magna exposed to different oxygen partial pressures. Biol. Chem. 2003;384:1133–1145. doi: 10.1515/BC.2003.126. [DOI] [PubMed] [Google Scholar]











