Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jul 18.
Published in final edited form as: Eur J Cancer Prev. 2005 Jun;14(3):223–230. doi: 10.1097/00008469-200506000-00005

Genetic analysis of microsomal epoxide hydrolase gene and its association with lung cancer risk

Jong Y Park 1,*, Lan Chen 1, Abul Elahi 1, Philip Lazarus 1, Melvyn S Tockman 1,2
PMCID: PMC3715303  NIHMSID: NIHMS451663  PMID: 15901990

Abstract

The human microsomal epoxide hydrolase (EH) gene contains polymorphic alleles, which may be linked to increased risk for tobacco-related lung cancer. The purpose of this study is to screen new polymorphisms and determine whether these polymorphisms can be used to predict individual susceptibility to lung cancer. The PCR-single strand conformation polymorphism (SSCP) analysis was used to screen for polymorphisms in the coding region of the EH gene. Eleven polymorphisms, including previously reported polymorphisms, were identified and the prevalence of these variants was assessed in at least 50 healthy Caucasians and African Americans. Among the eleven polymorphisms, the prevalence of the amino acid-changing EH polymorphisms in codons 43, 113, and 139 was examined in 182 Caucasian incident cases with primary lung cancer, as well as in 365 frequency-matched controls to examine the role of EH polymorphisms in lung cancer risk. A significant increase in lung cancer risk was observed for predicted high EH activity genotypes (OR = 2.3, 95% CI = 1.2–4.3) as compared to low EH activity genotypes. This association was more pronounced among patients with lung adenocarcinoma (OR = 4.7, 95% CI = 1.7–13.1). These results suggest that the EH polymorphism plays an important role in lung cancer risk and is linked to tobacco smoke exposure.

Keywords: Epoxide hydrolase, lung cancer, genetic polymorphism, metabolism

Introduction

Genetic polymorphisms are associated with a number of genes that code for enzymes involved in the metabolic activation or detoxification of carcinogens. Large differences in the activities of carcinogen metabolizing enzymes have been observed in many individuals, and it has been shown that enzyme activity-altering polymorphisms may influence individual cancer risk (McWilliams et al. 1995; Rebbeck 1997; Lazarus and Park 2000; London et al. 2000; Park et al. 2000).

The epoxide hydrolase (EH) enzyme cleaves a range of alkene and arene oxides to form trans-dihydrodiols. For some polycyclic aromatic hydrocarbons (PAHs), including benzo(a)pyrene (BaP), the dihydrodiol derivatives are substrates for additional metabolism to more highly reactive and carcinogenic compounds. In two previous studies with a small number of subjects who had adverse reactions to anticonvulsant drugs (Gaedigk et al. 1994; Green et al. 1995), several EH variants, including nonsynonymous polymorphism on codon 43, were identified, but none were associated with risk for hypersensitive reactions. Other studies have shown that two amino acid-altering polymorphisms located at codons 113 and 139 are associated with alterations in EH activity. The EH113His variant is associated with a 40% decrease in EH activity while the EH139Arg variant enhances enzyme activity by 25% via an increase in EH protein stability (Hassett et al. 1994). These polymorphic alleles have previously been linked to risk change for colon (Harrison et al. 1999), ovarian (Lancaster et al. 1996), and tobacco-related cancers, such as lung (Benhamou et al. 1998; Lin et al. 2000; London et al. 2000; To-Figueras et al. 2001; Wu et al. 2001; Yin et al. 2001; Zhao et al. 2002) and oral cavity (Park et al. 2003). Together with the finding that EH is expressed in lung tissue (Omiecinski et al. 1993), this data suggests that EH polymorphisms may play a role in lung cancer risk. The goals of the present study are to screen and identify EH polymorphisms in multiple racial groups (i.e. African Americans and Caucasians) and determine whether they may be associated with increased risk for lung cancer.

Materials and Methods

Study population for screening polymorphisms

For the identification of new EH polymorphisms in different racial groups, forty Caucasians and forty African Americans from New York City were included. They were out-patients who were visiting an ear, nose and throat clinic for conditions unrelated to oral cancer. These subjects were recruited after an initial verbal screening to determine that they had no previous diagnosis of cancer. To assess the prevalence of polymorphisms found in SSCP analysis, subjects from same area included at least fifty Caucasians and fifty African Americans.

Study population for lung cancer case:control study

For the investigation of the roles of EH polymorphisms in lung cancer risk, all subjects were recruited from the H. Lee Moffitt Cancer Center (Tampa, FL). All cases were patients diagnosed with primary lung cancer and were identified between 1999 and 2002. All cases were diagnosed within one year prior to recruitment into the study and were histologically confirmed by the Pathology Department at the H. Lee Moffitt Cancer Center. Ninety-five percent of case subjects who were asked to participate in the study consented.

We recruited control subjects at the Lifetime Cancer Screening Center affiliated with the H. Lee Moffitt Cancer Center. All control subjects were recruited after an initial verbal screening to determine that they had no previous diagnosis of cancer, and none of the controls recruited into this study were diagnosed with any form of cancer or premalignancy after screening. The eligible pool of control subjects was restricted to those individuals with the same age at diagnosis (± 5 years), race, and sex as the case subjects. Eighty-five percent of the control subjects who were asked to participate in the study consented.

For cases, buccal cell (n = 126) or blood (n = 56) samples collected at a follow-up examination were used for the analysis of polymorphic genotypes, while blood samples were collected for the analysis in controls (n = 365). Protocols involving the analysis of buccal cell and blood specimens were approved by the institutional review board at the H. Lee Moffitt Cancer Center and informed consent was obtained from all subjects.

A questionnaire that contained questions on demographics and life-long smoking habits was administered to all study subjects. Tobacco use was categorized into pack-years (py) for smokers of cigarettes (1 py equals one pack of cigarettes per day for 1 year), cigars (1 py equals four cigars per day for 1 year), and pipe tobacco (1 py equals five pipes per day for 1 year) according to the criteria described by Benhamou et. al. (Benhamou et al. 1986). Study subjects who have smoked 100 or fewer cigarettes in their lifetime (the equivalent of 0.014 or fewer pack year) were categorized as never-smokers.

PCR-SSCP and PCR-RFLP analysis of the EH gene

Genomic DNA was isolated from oral buccal cells or blood from non-cancer controls by incubation overnight with proteinase K (0.1 mg/ml) in 1% sodium dodecyl sulfate at 50oC and was extracted with phenol:chloroform and ethanol precipitation as previously described (Kabat et al. 1991).

We utilized the PCR-SSCP analysis method to identify genetic polymorphisms in the EH gene. EH intron-specific sense and antisense primers, which are homologous to intron sequences immediately adjacent to EH coding exons and splice sites were used for all SSCP analysis. The primer sequences, annealing temperatures for PCR, and expected PCR fragment sizes are outlined in Table 1. Screening for EH polymorphisms was performed by PCR amplification of genomic DNA from both African Americans (n = 40) and Caucasians (n = 40), and SSCP analysis of amplified exons. Both Caucasians and African Americans were screened to eliminate the possibility that ethnic-specific polymorphisms would be missed in this analysis. SSCP analysis of radio-labeled PCR products was performed as previously described (Park et al. 1997). When the results of SSCP analysis suggested potential polymorphisms by shifted SSCP band patterns, the exact nature of the polymorphic EH sequence was elucidated directly from the shifted band on the SSCP gel by standard dideoxy sequencing (Sanger et al. 1977). All DNA sequencing was performed at the Molecular Biology Core Facility located at the H. Lee Moffitt Cancer Center. PCR-SSCP and sequencing analysis was repeated for all polymorphism-positive samples.

Table 1.

Primer sequences, annealing temperatures, and PCR fragment lengths used for SSCP analysis.

Exon Sense Primer Antisense Primer Anneal Temp. (°C) Size of exon (bp)1 Size of PCR product (bp)
2 ggtcttcccctcatcttgc cccggcccaaggtgcctt 54 182 229
3 ggtcctgaattttgctccag ggctggcgttttgcaaacat 51 181 223
4 tgactgtgctctgtccccc caccgggcccacccttgg 57 228 308
5 cctttccccatcactgcc caccccaacagtgacctc 53 130 170
6 gcccctctctctgccttc ggacccctgagcactctc 55 209 249
7 ttgctccccgctcccgcc ggggcaaaccagggcctc 57 109 149
8 ctggctgccctttgtcacac ttcgtggagcccttgtctg 54 126 268
9 gtcggctctttcacttcc aagcctggagggcacttg 51 202 275
Open in a new tab
1

Sizes of exons 2 and 9 indicate coding region of EH gene.

PCR-restriction fragment length polymorphism (RFLP) analyses were subsequently developed to examine the prevalence of identified EH polymorphisms. The prevalence of genetic polymorphisms in the EH gene was measured in at least fifty African Americans and Caucasians, respectively (Table 2).

Table 2.

Prevalences of EH polymorphisms in Caucasian and African American controls at New York

Region Codon Sequence change Amino acid change Allelic frequencies
Caucasians African Americans
Exon 2 431 G > C Arg > Thr 0.01 (1/100)2 0.01 (2/168)
Exon 3 1131 T > C Tyr > His 0.33 (55/168)3 0.20 (54/274)
Exon 3 119 G > A Silent (Lys) 0.13 (25/188) 0.16 (16/100)
Exon 4 1391 A > G His > Arg 0.18 (30/168)3 0.31 (89/286)
Exon 4 149 C > T Silent (Gly) 0.01 (2/166) 0.01 (1/100)
Exon 4 195 T > C Ser > Pro 0.006 (1/168) 0.01 (1/102)
Intron 4 +341 G > A 0.09 (15/168) 3 0.02 (2/102)
Exon 6 284 C > T Silent (Pro) 0.08 (11/146) 0.08 (9/108)
Exon 8 357 T > C Silent (Asn) 0.11 (18/168) 0.14 (20/142)
Exon 8 382 G > T Trp > Leu 0.006 (1/168) 0.01 (1/100)
Exon 9 450 G > C Silent (Ser) 0.06 (10/168)3 0.00 (0/100)
Open in a new tab
1

Previously reported polymorphisms

2

Sample size (number of alleles detected/number of alleles screened).

3

Allelic frequencies were significantly different between African American and Caucasian controls (p < 0.05).

Genotyping assays for codons 43, 113 and 139 polymorphisms

One hundred eighty two lung cancer patients and 365 controls frequency-matched by age, gender and race were screened for the presence of the EH codon 43 polymorphism by a PCR-RFLP analysis. Exon 2 of EH gene were PCR-amplified using 100ng EH intron 1 (5′-ggtcttcccctcatcttgc-3′) and intron 2 (5′-cccggcccaaggtgcctt-3′)-specific primers to generate a 229bp fragment. The standard PCR was performed in a 50μl reaction volume containing 50ng of genomic DNA, 10mM Tris-HCl, 50mM KCl, 1.5mM MgCl2, 0.2mM of each of the dNTPs, and 2.0 units of Taq polymerase (Eppendorf, Mississauga, Ontario, Canada). The reaction mixtures underwent the following incubations: 1 cycle of 95oC for 2 min, 40 cycles of 94oC for 30sec, 51oC for 30sec, and 72oC for 30sec, followed by a final cycle of 10 min at 72oC. EH exon 2 PCR-amplified fragments were treated with BstN1 (New England Biolabs, Beverly, MA), which recognizes the wild-type (EH 43Arg allele) but not the polymorphic EH sequence (EH 43Tyr allele). Differences in RFLP patterns were detected after BstN1 restriction enzyme digestion at 60oC for 16h using 10ul of PCR amplification. In addition to the polymorphic BstN1 site at codon 43, an additional BstN1 site is present within the EH exon 2 PCR-amplified product, serving as an internal control for restriction enzyme digestion for all EH codon 43 polymorphism analysis. Three banding patterns were observed by RFLP analysis: 133bp, 79bp and 19bp bands that corresponded to the EH homozygous wild-type (EH 43Arg/43Arg) genotype, 133bp, 96bp, 79bp and 19bp bands that corresponded to the EH heterozygous (EH 43Arg/43Tyr) genotype, and 133bp and 96bp bands that corresponded to the EH 43Tyr/43Tyr homozygous polymorphic genotype.

The genotyping assays for the EH codons 113 and 139 polymorphism were performed by PCR-RFLP analysis, described previously (Park et al. 2003). This analysis was repeated for 10% of the specimens, and the selected PCR-amplified DNA samples (n = 20) were examined by dideoxy DNA sequencing (Sanger et al. 1977) to confirm EH genotyping results.

Statistical Analysis

The risks of lung cancer in relation to EH genotypes were estimated using unconditional logistic regression to calculate ORs and 95%CIs. In this study, we designated the four possible EH alleles arising from the codons 113/139 polymorphism analysis as EH*1 (EH113Tyr/139His), EH*2 (EH113Tyr/139Arg), EH*3 (EH113His/139His), and EH*4 (EH113His/139Arg) (Fig. 1). Subjects were categorized into three groups based on the predicted activity of their EH genotype as described previously (Hassett et al. 1994): the low EH activity genotypes (EH*3/EH*3 and EH*3/EH*4), intermediate EH activity genotypes (EH*1/EH*1, EH*1/EH*3, EH*2/EH*3 and EH*1/EH*4,) and high EH activity genotypes (EH*1/EH*2, EH*2/EH*2 and EH*2/EH*4). The chi-square test was utilized for the analysis of allelic frequencies. The Student’s t-test (2-tailed) was used for comparing the smoking (py) variable between cases and controls. The statistical computer software SAS (ver. 8.2) was used to perform all statistical analyses.

Fig. 1.

Fig. 1

Open in a new tab

Schematic diagram of epoxide hydrolase alleles and their corresponding polymorphisms at codons 113 and 139.

Results

PCR-SSCP analysis and identification of EH polymorphisms

Genomic DNA samples from 80 healthy subjects (40 Caucasians and 40 African Americans) were subjected to SSCP-PCR analysis (Fig. 2). Table 2 shows the location and characters of 11 polymorphisms identified in the samples we analyzed. Among the 11 polymorphisms detected, 5 nonsynonymous, 5 synonymous and 1 SNP in intron 4 were found. Among the five nonsynonymous polymorphisms, three of them were identified in previous studies (Gaedigk et al. 1994; Hassett et al. 1994; Green et al. 1995). The allelic frequencies of codon 113 and 139 polymorphisms were similar to those observed in previous studies of both Caucasians and African Americans (Hassett et al. 1994; Benhamou et al. 1998; Jourenkova-Mironova et al. 2000; London et al. 2000; Wu et al. 2001). The allelic frequency for the codon 43 polymorphism was reported as 0.08 in a small study (Gaedigk et al. 1994) (n = 26), but we observed a significantly lower allelic frequency in our control population (0.01).

Fig. 2. Detection of polymorphisms in exon 4 by SSCP analysis.

Fig. 2

Open in a new tab

Genomic DNA was used as templates in PCR designed for the amplification of the EH exon 4. Shown is a representative analysis of SSCP analysis of EH exon 4 for 21 individual DNA samples. The band A indicates EH allele with intron 4 polymorphism. Band B indicates allele with intron 4 and codon 139 polymorphism. Band C indicates wild type allele.

Differences in EH allelic frequencies were observed between Caucasians and African American controls. Two polymorphisms, which are located in intron 4 (p < 0.02) and at codon 450 (p < 0.01) show significantly different allelic frequencies between two control groups. In addition, a significantly (p = 0.0019) lower frequency of the EH139Arg allele was observed for Caucasians (0.18) as compared to African Americans (0.31), while the EH113His allelic frequency was significantly (p = 0.002) higher in Caucasians (0.33) as compared to African Americans (0.20; Table 2).

EH genotypes and risk for lung cancer

A total of 182 Caucasian lung cancer patients and 365 frequency-matched control subjects were entered into this study. The mean ages of cases and controls were 62 and 65 and 42% of subjects were female (Table 3). As expected, cases had a significantly higher level of cigarette consumption than controls (p = 0.019; Table 3).

Table 3.

Demographic information of subjects, EH polymorphisms, predicted EH activity genotypes and lung cancer risk.

Cases Controls p value
Subject numbers 182 365
mean age (range) 65.4 (36–83) 61.7 (31–88)
Sex (M/F) 105/77 214/151
Smoking [mean ± SD (py)] 53.5 ± 32.3 46.4 ± 32.9
Location Codon genotypes Cases Controls OR (95%CI)1
Exon 2 43 arg/arg 182 (100)2 358 (98) 1.0 (referent)
arg/thr 0 (0) 7 (2) p = 0.0593
Exon 3 113 tyr/tyr 81 (46) 138 (38) 1.0 (referent)
tyr/his 72 (40) 147 (40) 0.8 (0.6–1.2)
tyr/tyr 25 (14) 80 (22) 0.6 (0.3–0.96)
Exon 4 139 his/his 121 (66) 234 (64) 1.0 (referent)
arg/his 54 (30) 118 (33) 0.9 (0.6–1.4)
arg/arg 7 (4) 11 (3) 1.2 (0.4–3.1)
Predicted EH activity genotypes4 Cases Controls OR (95%CI)
low 25 (14) 80 (22) 1.0 (referent)5
intermediate 117 (66) 232 (64) 1.5 (0.9–2.6)
high 36 (20) 51 (14) 2.3 (1.2–4.3)
Open in a new tab
1

ORs were calculated by adjusting for sex, age, and smoking.

2

Numbers in parenthesis denote percentages.

3

p = 0.059 by Fisher exact test.

4

the low EH activity genotype (EH*3/EH*3 and EH*3/EH*4), intermediate EH activity genotypes (EH*1/EH*1, EH*1/EH*3, and EH*2/EH*3 or EH*1/EH*4,) and high EH activity genotypes (EH*1/EH*2, EH*2/EH*2, and EH*2/EH*4).

5

Significant increase in predicted high-risk genotypes as determined by χ2-trend test (p = 0.009).

To determine whether the EH variants contributed to increased lung cancer risk, we examined the prevalence of EH genotypes in lung cancer patients and compared them with control subjects. Due to low allelic frequencies of codons 195 (0.006) and 382 (0.006) polymorphisms, these variants were not included for estimate their association with lung cancer risk. Significantly decreased risk for lung cancer was observed for subjects with the homozygous EH 113His/113His genotype (odds ratio [OR] = 0.6, 95% confidence interval [CI] = 0.33–0.96. Table 3). No significant association between the codons 43 and 139 polymorphism and lung cancer risk was observed, although the codon 43 data suggested a potential trend (p = 0.059) (Table 3).

Genotypes of individual subjects were determined by the combined data obtained from individual PCR-RFLP analysis of the codons 113 and 139 polymorphisms. The codon 43 polymorphism was not included for determining combined genotypes due to a low allelic frequency (0.01). In controls, the prevalence of the EH113His variant was 0.42, while the prevalence of the EH139Arg variant was 0.19. The prevalence of these polymorphisms among controls followed the Hardy-Weinberg equilibrium.

When subjects were stratified based upon predicted EH activity genotypes, a significant increase in lung cancer risk was observed among subjects with high EH activity genotypes as compared to the low EH activity genotype (OR = 2.3, 95% CI = 1.2–4.3; Table 3). A significant association was found between predicted EH activity and lung cancer risk with a dose–effect relationship (trend test: p = 0.009).

To assess whether EH genotype associated lung cancer risk was linked to specific lung cancer sub-types, cases were stratified according to tumor histological classifications. A significant risk increase was observed in the adenocarcinoma subtype of non-small cell lung cancer (high EH activity genotypes; OR = 4.7, 95% CI = 1.7–13.1) (Table 4). Small cell lung carcinoma cases were not included from this analysis, due to a low number of subjects.

Table 4.

Lung cancer risk by histological diagnosis and EH genotypes.

Predicted EH Non-small cell lung cancer subtypes Total
Activity genotypes controls adenocarcinoma squamous Large Cell Non-small cell
low 80 (22) 1 3 (5) 2 9 (18) 7 (22) 25 (17)
intermediate 232 (64) 38 (63) 34 (67) 22 (69) 97 (64)
high 51 (14) 16 (32) 8 (16) 3 (9) 29 (19)
OR (95% CI) for intermediate 3 2.4 (0.9–6.0) 1.1 (0.5–2.5) 1.0 (0.5–2.5) 1.3 (0.8–2.2)
OR (95% CI) for high 3 4.7 (1.7–13.1) 1.2 (0.4–3.7) 0.8 (0.2–3.1) 1.8 (0.9–3.6)
Open in a new tab
1

Numbers in parenthesis refer to percentages.

2

Significant increase in predicted high-risk genotypes as determined by χ2-trend test (p = 0.0001).

3

Adjusted for age, gender, and smoking.

To examine the relationship between EH genotypes and lung cancer risk by exposure to the environmental risk factor, smoking, we stratified study subjects by predicted EH activity genotypes and smoking history (Table 5). Ever-smokers (i.e., ≥ 100 cigarettes lifetime) were categorized into two groups based upon lifetime smoking history and divided at the median number of pack-years (46py) of smokers in the control population. The differences in risk associated with the EH genotypes were modified by smoking history. Due to a low number (10) of lung cancer patients, we cannot assess the role of EH polymorphisms among never-smokers (data not shown). No association between EH genotypes and lung cancer risk was observed for heavy smokers (> 46 py). However, non-significant risk increases were observed in light smokers (≤ 46 py) with both the intermediate (OR = 2.3, 95%CI = 0.9–5.6) and high (OR = 2.6 95% CI = 0.9–7.7) EH activity genotypes (Table 5). Among light smokers, a significant association was found between predicted EH activity and lung cancer risk with a dose-effect relationship (trend test: p < 0.05).

Table 5.

Lung cancer risk for predicted EH activity genotypes stratified by smoking.

Smoking level Predicted EH activity genotypes Cases Controls OR (95% CI)1
LS (≤ 46py) low 7 (10) 2 34 (22) 1.0 (referent) 3
intermediate 49 (71) 97 (63) 2.3 (0.9–5.6)
high 13 (19) 23 (15) 2.6 (0.9–7.7)
HS (> 46py) low 18 (20) 33 (20) 1.0 (referent)
intermediate 55 (62) 106 (65) 0.9 (0.4–1.7)
high 16 (18) 23 (15) 1.4 (0.6–3.3)
Open in a new tab
1

ORs were calculated by adjusting for age, gender and smoking (py).

2

Numbers in parenthesis denote percentages.

3

Significant increase in predicted high-risk genotypes as determined by χ2-trend test (p = 0.048).

Discussion

Genetic polymorphisms in the genes coding for tobacco carcinogen metabolizing enzymes may influence individual susceptibility to lung cancer. Although EH-induced hydrolysis is generally considered to represent a detoxification reaction because less toxic chemicals are usually produced, some trans-dihydrodiols generated from PAHs are substrates for additional metabolic changes to highly toxic, mutagenic, and carcinogenic polycyclic aromatic hydrocarbon diol epoxides. For example, EH converts BaP-7,8-epoxide to BaP-7,8-di-hydrodiol, which is a critical intermediate metabolite in the BaP carcinogenic pathway and is formed predominantly via oxidation by the CYP1A1 (Phillips 1983). Once formed, BaP-7,8-epoxide can either be detoxified by the GST family of phase II enzymes or metabolized by EH to a diol intermediate (BaP-7,8-dihydrodiol), precursor to the ultimate carcinogenic BaP metabolite, BaP-7,8-diol-9,10-epoxide. Therefore, EH may play a significant role in the BaP-induced carcinogenic process.

Among several previous molecular epidemiological studies which have been performed on EH codons 113 and 139 polymorphisms, Lee et al. (Lee et al. 2002) reported a significant decrease in lung cancer risk for the homozygous EH 113His/113His genotype and a stronger association in lung adenocarcinoma cases than other histological types in the pooled analysis. In this study, we observed a significant association between EH polymorphisms and lung cancer risk in Caucasians. This association is dose-dependent with significantly increased risk observed for subjects with predicted high EH activity genotypes. This association is more pronounced in patients with lung adenocarcinoma than for other histological types of the non small cell lung cancers (Table 4). These results are consistent with a critical role for EH in tobacco-related cancer risk and in the metabolism of BaP-7,8-epoxide.

The effect of EH activity on lung cancer risk was modified by smoking level in the present study. Similar gene-environment interactions were also observed in a previous large EH epidemiological study (Zhou et al. 2001). Although the difference was not statistically significant, a stronger association between EH genotypes and lung cancer was found among light smokers (≤ 46 py). This pattern is similar to that observed in previous studies examining polymorphic genotypes and cancer risk. The GSTM1 (0/0) (Nakachi et al. 1993; London et al. 1995), the CYP1A1 exon 7 and Mspl polymorphisms (Nakachi et al. 1993; Ishibe et al. 1997), and CYP2D6 polymorphisms (London et al. 1997) have all been shown to be associated with increased risk for lung cancer in light but not heavy smokers. It has been postulated that genetic variations in the ability to metabolize tobacco smoke carcinogens are most important in determining cancer risk at low levels of exposure, and may be less relevant at higher smoking doses where high levels of carcinogen exposure overwhelm polymorphism-induced differences in enzyme activity and/or expression (London et al. 1995).

The data from this study presents several previously unidentified polymorphisms in the EH gene. It has been reported that SSCP analysis can detect 80–90% of single nucleotide change in DNA fragments smaller than 400 bp. However, a recent systematic analysis of the SSCP technique has shown that sensitivity varies with the size of the DNA fragment being analyzed, with the optimal size being 150 bp (Sheffield et al. 1993). The sensitivity of detecting a single base pair substitution was actually less than 60% when DNA fragments were about 400 bp. Since the PCR fragment sizes in the present study range from 149 bp for exon 7 to 308 bp for exon 4 (Table 1), polymorphisms were likely detected with relatively high efficiency (> 90%).

This is the first data which measures the for prevalence of newly-identified genetic polymorphisms in the EH gene in African Americans and Caucasians. As expected, the prevalences of genetic polymorphisms found in African Americans are often significantly different than those found in Caucasians. This data corresponds with the fact that significant differences in prevalence were observed with EH codons 113 and 139 in different ethnic groups (London et al. 2000; Wu et al. 2001). We investigated potential roles of codons 43, 113 and 139 nonsynonymous polymorphisms among eleven polymorphisms identified from screening process. Since there was not enough justification for investigating the roles of the other eight polymorphisms in lung cancer risk because they are not likely to affect activity of EH enzyme, the exact role was not assessed because of a lack of statistical power. Although we could not evaluate the exact role of codon 43 polymorphism due to a low allelic frequency (0.01), a marginal protective effect was observed (p = 0.059). Therefore, the codon 43 polymorphism is warranted for further investigation with a larger cohort study.

Another important smoking-related lung disease, chronic obstructive pulmonary disease (COPD), was linked with the EH codon 113 polymorphism. (Yoshikawa et al. 2000; Sandford et al. 2001; Rodriguez et al. 2002). However, these associations were not observed in other COPD epidemiological studies (Yim et al. 2000; Yim et al. 2002; Zhang et al. 2002). Therefore, the role of EH polymorphisms in risk for pulmonary obstruction is not yet conclusive. Since this disease is associated with smoking and an increased 4–6 fold risk for lung cancer (Tockman et al. 1987), it would be interesting to investigate the exact role of EH polymorphisms in lung cancer risk among subjects who have pulmonary obstructive disease.

In the present study, only the coding region of the EH gene had been analyzed by SSCP analysis. Polymorphisms in the promoter or intronic region may also play important roles in lung cancer risk. Further studies examining these regions will be required to explore this possibility. A second limitation of this study is the fact that the number of case subjects recruited into this study was relatively small especially for adenocarcinoma. Therefore, these results must be confirmed in larger studies especially for investigating a role of low EH activity genotypes in lung adenocarcinoma risk. In conclusion, the present study has identified several polymorphisms in the coding region of the EH gene and observed that EH codon 43 polymorphism may decrease lung cancer risk and that predicted high activity EH genotypes are associated with increased risk for lung cancer.

Acknowledgments

The authors thank Joseph Burton for their participation in the collection of clinical samples and questionnaire data, Nina Wadhwa, Meliza Roque and Dr. Jun Zhou for providing clinical samples and demographic information, Dr. Michael Gruidl for helpful discussions, Rachel Park for manuscript preparation and Susan Gray for her excellent technical assistance. These studies were supported by NIH Grants: CA91314 (JP), CA084973 supplement (JP), CA084973 (MT), and DE12206 (PL).

References

  1. Benhamou S, Benhamou E, Flamant R. Lung cancer risk associated with cigar and pipe smoking. Int J Cancer. 1986;37(6):825–9. doi: 10.1002/ijc.2910370605. [DOI] [PubMed] [Google Scholar]
  2. Benhamou S, Reinikainen M, Bouchardy C, Dayer P, Hirvonen A. Association between lung cancer and microsomal epoxide hydrolase genotypes. Cancer Res. 1998;58(23):5291–3. [PubMed] [Google Scholar]
  3. Gaedigk A, Spielberg SP, Grant DM. Characterization of the microsomal epoxide hydrolase gene in patients with anticonvulsant adverse drug reactions. Pharmacogenetics. 1994;4(3):142–53. doi: 10.1097/00008571-199406000-00005. [DOI] [PubMed] [Google Scholar]
  4. Green VJ, Pirmohamed M, Kitteringham NR, Gaedigk A, Grant DM, Boxer M, Burchell B, Park BK. Genetic analysis of microsomal epoxide hydrolase in patients with carbamazepine hypersensitivity. Biochem Pharmacol. 1995;50(9):1353–9. doi: 10.1016/0006-2952(95)02009-8. [DOI] [PubMed] [Google Scholar]
  5. Harrison DJ, Hubbard AL, MacMillan J, Wyllie AH, Smith CA. Microsomal epoxide hydrolase gene polymorphism and susceptibility to colon cancer. Br J Cancer. 1999;79(1):168–71. doi: 10.1038/sj.bjc.6690028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hassett C, Aicher L, Sidhu JS, Omiecinski CJ. Human microsomal epoxide hydrolase: genetic polymorphism and functional expression in vitro of amino acid variants. Hum Mol Genet. 1994;3(3):421–8. doi: 10.1093/hmg/3.3.421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ishibe N, Wiencke JK, Zuo ZF, McMillan A, Spitz M, Kelsey KT. Susceptibility to lung cancer in light smokers associated with CYP1A1 polymorphisms in Mexican- and African-Americans. Cancer Epidemiol Biomarkers Prev. 1997;6(12):1075–80. [PubMed] [Google Scholar]
  8. Jourenkova-Mironova N, Mitrunen K, Bouchardy C, Dayer P, Benhamou S, Hirvonen A. High-activity microsomal epoxide hydrolase genotypes and the risk of oral, pharynx, and larynx cancers. Cancer Res. 2000;60(3):534–6. [PubMed] [Google Scholar]
  9. Kabat GC, Morabia A, Wynder EL. Comparison of smoking habits of blacks and whites in a case-control study. Am J Public Health. 1991;81(11):1483–6. doi: 10.2105/ajph.81.11.1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lancaster JM, Brownlee HA, Bell DA, Futreal PA, Marks JR, Berchuck A, Wiseman RW, Taylor JA. Microsomal epoxide hydrolase polymorphism as a risk factor for ovarian cancer. Mol Carcinog. 1996;17(3):160–2. doi: 10.1002/(SICI)1098-2744(199611)17:3<160::AID-MC8>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  11. Lazarus P, Park JY. Metabolizing enzyme genotype and risk for upper aerodigestive tract cancer. Oral Oncol. 2000;36(5):421–31. doi: 10.1016/s1368-8375(00)00030-0. [DOI] [PubMed] [Google Scholar]
  12. Lee WJ, Brennan P, Boffetta P, London SJ, Benhamou S, Rannug A, To-Figueras J, Ingelman-Sundberg M, Shields P, Gaspari L, et al. Microsomal epoxide hydrolase polymorphisms and lung cancer risk: a quantitative review. Biomarkers. 2002;7(3):230–41. doi: 10.1080/13547500210121882. [DOI] [PubMed] [Google Scholar]
  13. Lin P, Wang SL, Wang HJ, Chen KW, Lee HS, Tsai KJ, Chen CY, Lee H. Association of CYP1A1 and microsomal epoxide hydrolase polymorphisms with lung squamous cell carcinoma. Br J Cancer. 2000;82(4):852–7. doi: 10.1054/bjoc.1999.1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. London SJ, Daly AK, Cooper J, Navidi WC, Carpenter CL, Idle JR. Polymorphism of glutathione S-transferase M1 and lung cancer risk among African-Americans and Caucasians in Los Angeles County, California. J Natl Cancer Inst. 1995;87(16):1246–53. doi: 10.1093/jnci/87.16.1246. [DOI] [PubMed] [Google Scholar]
  15. London SJ, Daly AK, Leathart JB, Navidi WC, Carpenter CC, Idle JR. Genetic polymorphism of CYP2D6 and lung cancer risk in African-Americans and Caucasians in Los Angeles County. Carcinogenesis. 1997;18(6):1203–14. doi: 10.1093/carcin/18.6.1203. [DOI] [PubMed] [Google Scholar]
  16. London SJ, Smart J, Daly AK. Lung cancer risk in relation to genetic polymorphisms of microsomal epoxide hydrolase among African-Americans and Caucasians in Los Angeles County. Lung Cancer. 2000;28(2):147–55. doi: 10.1016/s0169-5002(99)00130-0. [DOI] [PubMed] [Google Scholar]
  17. McWilliams JE, Sanderson BJ, Harris EL, Richert-Boe KE, Henner WD. Glutathione S-transferase M1 (GSTM1) deficiency and lung cancer risk. Cancer Epidemiol Biomarkers Prev. 1995;4(6):589–94. [PubMed] [Google Scholar]
  18. Nakachi K, Imai K, Hayashi S, Kawajiri K. Polymorphisms of the CYP1A1 and glutathione S-transferase genes associated with susceptibility to lung cancer in relation to cigarette dose in a Japanese population. Cancer Res. 1993;53(13):2994–9. [PubMed] [Google Scholar]
  19. Omiecinski CJ, Aicher L, Holubkov R, Checkoway H. Human peripheral lymphocytes as indicators of microsomal epoxide hydrolase activity in liver and lung. Pharmacogenetics. 1993;3(3):150–8. doi: 10.1097/00008571-199306000-00005. [DOI] [PubMed] [Google Scholar]
  20. Park JY, Muscat JE, Ren Q, Schantz SP, Harwick RD, Stern JC, Pike V, Richie JP, Jr, Lazarus P. CYP1A1 and GSTM1 polymorphisms and oral cancer risk. Cancer Epidemiol Biomarkers Prev. 1997;6(10):791–7. [PubMed] [Google Scholar]
  21. Park JY, Schantz SP, Lazarus P. Epoxide hydrolase genotype and orolaryngeal cancer risk: interaction with GSTM1 genotype. Oral Oncol. 2003;39(5):483–90. doi: 10.1016/s1368-8375(03)00008-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Park JY, Muscat JE, Kaur T, Schantz SP, Stern JC, Richie JP, Jr, Lazarus P. Comparison of GSTM polymorphisms and risk for oral cancer between African-Americans and Caucasians. Pharmacogenetics. 2000;10(2):123–31. doi: 10.1097/00008571-200003000-00004. [DOI] [PubMed] [Google Scholar]
  23. Phillips DH. Fifty years of benzo(a)pyrene. Nature. 1983;303(5917):468–72. doi: 10.1038/303468a0. [DOI] [PubMed] [Google Scholar]
  24. Rebbeck TR. Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev. 1997;6(9):733–43. [PubMed] [Google Scholar]
  25. Rodriguez F, Jardi R, Costa X, Juan D, Galimany R, Vidal R, Miravitlles M. Detection of polymorphisms at exons 3 (Tyr113→His) and 4 (His139→Arg) of the microsomal epoxide hydrolase gene using fluorescence PCR method combined with melting curves analysis. Anal Biochem. 2002;308(1):120–6. doi: 10.1016/s0003-2697(02)00219-1. [DOI] [PubMed] [Google Scholar]
  26. Sandford AJ, Chagani T, Weir TD, Connett JE, Anthonisen NR, Pare PD. Susceptibility genes for rapid decline of lung function in the lung health study. Am J Respir Crit Care Med. 2001;163(2):469–73. doi: 10.1164/ajrccm.163.2.2006158. [DOI] [PubMed] [Google Scholar]
  27. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74(12):5463–7. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sheffield VC, Beck JS, Kwitek AE, Sandstrom DW, Stone EM. The sensitivity of single-strand conformation polymorphism analysis for the detection of single base substitutions. Genomics. 1993;16(2):325–32. doi: 10.1006/geno.1993.1193. [DOI] [PubMed] [Google Scholar]
  29. Tockman MS, Anthonisen NR, Wright EC, Donithan MG. Airways obstruction and the risk for lung cancer. Ann Intern Med. 1987;106(4):512–8. doi: 10.7326/0003-4819-106-4-512. [DOI] [PubMed] [Google Scholar]
  30. To-Figueras J, Gene M, Gomez-Catalan J, Pique E, Borrego N, Corbella J. Lung cancer susceptibility in relation to combined polymorphisms of microsomal epoxide hydrolase and glutathione S-transferase P1. Cancer Lett. 2001;173(2):155–62. doi: 10.1016/s0304-3835(01)00626-7. [DOI] [PubMed] [Google Scholar]
  31. Wu X, Gwyn K, Amos CI, Makan N, Hong WK, Spitz MR. The association of microsomal epoxide hydrolase polymorphisms and lung cancer risk in African-Americans and Mexican-Americans. Carcinogenesis. 2001;22(6):923–8. doi: 10.1093/carcin/22.6.923. [DOI] [PubMed] [Google Scholar]
  32. Yim JJ, Park GY, Lee CT, Kim YW, Han SK, Shim YS, Yoo CG. Genetic susceptibility to chronic obstructive pulmonary disease in Koreans: combined analysis of polymorphic genotypes for microsomal epoxide hydrolase and glutathione S-transferase M1 and T1. Thorax. 2000;55(2):121–5. doi: 10.1136/thorax.55.2.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yim JJ, Yoo CG, Lee CT, Kim YW, Han SK, Shim YS. Lack of association between glutathione S-transferase P1 polymorphism and COPD in Koreans. Lung. 2002;180(2):119–25. doi: 10.1007/s004080000086. [DOI] [PubMed] [Google Scholar]
  34. Yin L, Pu Y, Liu TY, Tung YH, Chen KW, Lin P. Genetic polymorphisms of NAD(P)H quinone oxidoreductase, CYP1A1 and microsomal epoxide hydrolase and lung cancer risk in Nanjing, China. Lung Cancer. 2001;33(2–3):133–41. doi: 10.1016/s0169-5002(01)00182-9. [DOI] [PubMed] [Google Scholar]
  35. Yoshikawa M, Hiyama K, Ishioka S, Maeda H, Maeda A, Yamakido M. Microsomal epoxide hydrolase genotypes and chronic obstructive pulmonary disease in Japanese. Int J Mol Med. 2000;5(1):49–53. doi: 10.3892/ijmm.5.1.49. [DOI] [PubMed] [Google Scholar]
  36. Zhang R, Zhang A, He Q, Lu B. Microsomal epoxide hydrolase gene polymorphism and susceptibility to chronic obstructive pulmonary disease in Han nationality of North China. Zhonghua Nei Ke Za Zhi. 2002;41(1):11–4. [PubMed] [Google Scholar]
  37. Zhao H, Spitz MR, Gwyn KM, Wu X. Microsomal epoxide hydrolase polymorphisms and lung cancer risk in non-Hispanic whites. Mol Carcinog. 2002;33(2):99–104. doi: 10.1002/mc.10023. [DOI] [PubMed] [Google Scholar]
  38. Zhou W, Thurston SW, Liu G, Xu LL, Miller DP, Wain JC, Lynch TJ, Su L, Christiani DC. The interaction between microsomal epoxide hydrolase polymorphisms and cumulative cigarette smoking in different histological subtypes of lung cancer. Cancer Epidemiol Biomarkers Prev. 2001;10(5):461–6. [PubMed] [Google Scholar]

RESOURCES