Abstract
A study was performed to derive susceptibility testing interpretive breakpoints for doxycycline with Streptococcus pneumoniae and to reassess breakpoints for tetracycline using the requirements defined in Clinical and Laboratory Standards Institute (CLSI) document M23-A3. Tetracycline and doxycycline MICs and disk diffusion zone sizes were determined on 189 isolates selected from the 2009-2010 CDC Active Bacterial Core surveillance strain collection according to the testing methods described in CLSI documents M07-A8 and M02-A10. Tetracycline and doxycycline MICs and zones were compared to each other directly, and the reproducibility of MICs and zone diameters for both drugs was determined. Scattergrams of tetracycline MICs versus corresponding zone diameters and doxycycline MICs versus zones were prepared, and analysis indicated that the present CLSI tetracycline MIC and disk breakpoints did not fit the susceptibility data for doxycycline. Doxycycline was 1 to 3 dilutions more potent than tetracycline, especially in strains harboring the tetM resistance determinant. tetM was detected in ≥90% of isolates having tetracycline MICs of ≥4 μg/ml and in ≥90% with doxycycline MICs of ≥1. Limited pharmacokinetic/pharmacodynamic (PK/PD) data coupled with application of the error-rate bounded method of analysis suggested doxycycline-susceptible breakpoints of either ≤0.25 μg/ml or ≤0.5 μg/ml, with intermediate and resistant breakpoints 1 and 2 dilutions higher, respectively. The disk diffusion zone diameter correlates were susceptible at ≥28 mm, intermediate at 25 to 27 mm, and resistant at ≤24 mm. Revised lower tetracycline MIC breakpoints were suggested as susceptible at ≤1 μg/ml, intermediate at 2 μg/ml, and resistant at ≥4 μg/ml. Suggested tetracycline disk diffusion zones were identical to those of doxycycline.
INTRODUCTION
Streptococcus pneumoniae is a leading cause of community-acquired pneumonia (CAP), causing up to 70% of cases (1). It is also a major cause of sepsis, meningitis, and otitis media (1). The emergence of penicillin-resistant S. pneumoniae isolates has led to the increased use of extended-spectrum cephalosporins, macrolides, fluoroquinolones, and even vancomycin. The need for alternate treatment options has enhanced the importance of accurate susceptibility testing. Doxycycline is recommended by the Infectious Diseases Society of America as an alternative antimicrobial agent for the treatment of community-acquired pneumonia caused by Streptococcus pneumoniae in ambulatory patients and also in those with penicillin allergies (1); however, the CLSI document M100-S22 (2), which is used to suggest and interpret susceptibility tests, includes MIC and disk testing interpretive criteria only for tetracycline. For this reason, a footnote in the CLSI document states that “organisms that are susceptible to tetracycline are also considered susceptible to doxycycline and minocycline.” However, using tetracycline susceptibility data as a surrogate to predict doxycycline is problematic because it may underestimate the activity of doxycycline against pneumococci, in which doxycycline is usually 1 or 2 doubling dilutions more active than tetracycline (3). The principal resistance mechanism of S. pneumoniae to tetracycline and doxycycline is the ribosomal protection protein resistance mechanism mediated by the tetM gene (4). This gene product affects doxycycline to a lesser degree than it does tetracycline; thus, using tetracycline as a surrogate may underestimate the activity of doxycycline against some strains of S. pneumoniae (5). In addition, reporting tetracycline as a surrogate for doxycycline or minocycline requires susceptibility footnotes on laboratory reports to alleviate potential misunderstanding by clinicians. The purposes of this study were to compare S. pneumoniae tetracycline and doxycycline susceptibilities, to propose specific MIC and disk diffusion interpretive breakpoints for doxycycline, and to reassess the MIC and disk diffusion breakpoints for tetracycline in the context of the presence of modern pharmacokinetic (PK) and pharmacodynamic (PD) concepts and the impact of the tetM determinant.
MATERIALS AND METHODS
Isolates.
One hundred one S. pneumoniae strains previously characterized for tetracycline susceptibility were selected and initially tested in one laboratory (University of Texas Health Science Center, San Antonio [UTHSCSA]). The strains were from the 2009-2010 CDC Active Bacterial Core Surveillance (ABCs) study from eight of 10 sites, including California, Connecticut, Colorado, Maryland, New Mexico, New York, and Tennessee. The selected strains represented 30 different serotypes as depicted in Table 1. Fifty-seven strains were initially tetracycline resistant (MIC, ≥8), four were tetracycline intermediate (MIC, 4), and 40 were tetracycline susceptible (MIC, ≤2). Based upon initially encouraging results and on the recommendations of the staphylococcal and streptococcal working group of the CLSI Antimicrobial Susceptibility Testing Subcommittee that reviewed the initial data, the same 101 strains and an additional 88 strains from all 10 of the CDC ABCs surveillance program sites were tested at the CDC in the Streptococcal Laboratory and in the Division of Healthcare Quality Promotion (DHQP) laboratory. The additional strains included those from the states mentioned above and from Georgia and Minnesota. Overall, strains were selected to represent approximately 50% tetracycline resistance based upon previous testing results.
Table 1.
Streptococcus pneumoniae serotype distribution for the 189 isolates tested
| Serotype | No. of isolates |
|---|---|
| 1 | 6 |
| 3 | 15 |
| 6A | 2 |
| 6B | 8 |
| 6C | 7 |
| 7C | 3 |
| 7F | 12 |
| 8 | 3 |
| 9N | 6 |
| 9V | 1 |
| 10A | 3 |
| 11A | 2 |
| 12F | 6 |
| 13 | 1 |
| 14 | 2 |
| 15A | 15 |
| 15B | 2 |
| 16F | 2 |
| 18C | 2 |
| 19A | 53 |
| 19F | 3 |
| 20 | 1 |
| 22F | 8 |
| 23A | 11 |
| 23B | 4 |
| 31 | 2 |
| 33F | 5 |
| 35B | 2 |
| 35F | 1 |
| 37 | 1 |
| Total | 189 |
Reproducibility testing.
To determine the reproducibility of MIC and zone diameter determinations, nine selected isolates that exhibited resistant tetracycline MICs (8, 16, or ≥16 μg/ml) but lower doxycycline MICs (1, 2, 4, or 8 μg/ml) were repeat tested three times on three separate days. Ten selected isolates with small tetracycline zone diameters (11 to 16 mm) were repeat tested on four different days and measured by four different researchers.
Broth microdilution MIC testing.
Tetracycline and doxycycline MICs were determined for each of the 101 strains tested at UTHSCSA using frozen in-lab-prepared microdilution panels containing Mueller-Hinton broth (Difco) with 3% lysed horse blood. These same strains and the 88 additional isolates were tested at the CDC Respiratory Diseases Branch using Mueller-Hinton lysed horse blood panels prepared at CDC using a different brand (BBL) of Mueller-Hinton dehydrate than that used at the UTHSCSA lab. Retesting of some discrepant MICs was performed at the CDC DHQP laboratory using frozen CDC-prepared panels utilizing Mueller-Hinton broth (BBL) with 5% lysed horse blood. All panels were prepared and inoculated according to CLSI document M07-A8 (6). Panels were incubated at 35°C in ambient air for 20 to 24 h before MIC interpretations.
Disk diffusion testing.
Tetracycline and doxycycline disk (BBL, 30 μg) diffusion tests were performed with commercially prepared (BD) Mueller-Hinton 5% sheep blood agar plates at the UTHSCSA lab. The same brand (BD) and a second brand (Remel) of commercially prepared Mueller-Hinton sheep blood agar plates were used for disk testing at the CDC labs. The plates were incubated at 35°C in 5% CO2 for 20 to 24 h as described in CLSI document M02-A10 (7).
QC.
S. pneumoniae ATCC 49619 was used as the control organism for MIC and disk testing. Quality control (QC) was performed with each batch of tests at each laboratory.
tetM PCR.
A convenience sample of 118 isolates was analyzed at UTHSCSA and the CDC for the presence of the tetM gene. A 740-bp fragment of the tetM gene was amplified using the primer sequences TETM2 (5′GAACTCGAACAAGAGGAAAGC3′) and TETM3 (5′ATGAAGCCCAGAAAGGAT3′), using the parameters described by Olsvik et al. (4).
Data analysis.
Tetracycline and doxycycline MICs and zone diameters were compared to each other using pivot tables. Scattergrams of isolate MICs versus zone diameters were plotted for tetracycline and doxycycline with the original assumption that doxycycline MIC breakpoints should be the same as those of tetracycline. For the purpose of creating merged scattergrams, the means of the repeat disk diffusion zones determined at the CDC using Remel agar were plotted along with the BD agar zones from UTHSCSA. Doxycycline disk breakpoints were analyzed by the error-rate bounded method of Metzler and DeHaan (8, 9).
Discrepancy analysis.
Nonconcordant MIC/zone diameter results were investigated using CLSI document M23-A3, section 8.2.3.2, page 25 (10). Essentially, if no obvious technical or transcriptional errors were found, the tests were repeated twice using separate inocula. If at least two of the three results were identical, the original data point was replaced with this new data point in the scattergram. If all results (original and the repeat results) were different, the original result was retained. The detailed results of all discordant pair results were recorded in a separate table.
RESULTS
Reproducibility testing.
Both tetracycline and doxycycline MICs and zone diameters were found to be highly reproducible, with MICs varying by 1 dilution or less (data not shown). Disk diffusion zone sizes varied by 2 mm or less (data not shown).
MIC testing.
Doxycycline was consistently more potent (lower MICs) than tetracycline, especially against the tetracycline-resistant isolates harboring tetM (Table 2). Review of the doxycycline scattergrams indicated that the present CLSI tetracycline MIC and disk breakpoints did not fit the distribution of susceptibility data for doxycycline (Fig. 1).
Table 2.
Comparison of tetracycline and doxycycline MICs with the presence of the tetM resistance determinant
| No. of isolates (total, 118) | MIC (μg/ml) |
Presence of tetM, no. positive/total no. (%) | |
|---|---|---|---|
| Tetracycline | Doxycycline | ||
| 5 | >16 | 16 | 5/5 |
| 8 | >16 or 16 | 8 | 8/8 |
| 19 | >16 or 16 | 4 | 19/19 |
| 7 | >16 or 16 | 2 | 6/7 |
| 1 | 8 | 4 | 1/1 |
| 6 | 8 | 2 | 6/6 |
| 4 | 8 | 1 | 4/4 |
| 1 | 4 | 2 | 0/1 |
| 9 | 4 | 0.5 | 9/9 |
| 3 | 2 | 0.5 | 3/3 |
| 4 | 2 | 1 | 0/4 |
| 2 | 1 | 1 | 0/2 |
| 3 | 1 | 0.25 or 0.5 | 0/3 |
| 1 | 0.5 | 0.5 | 1/1 |
| 11 | 0.5 | 0.12 or 0.25 | 2/11 |
| 34 | ≤0.25 | ≤0.12 | 0/34 |
| ≥4 | 58/60 (96.6) | ||
| ≥2 | 61/67 (91) | ||
| ≤1 | 3/51 (5.9) | ||
| ≤0.5 | 3/46 (6.5) | ||
| ≥2 | 45/47 (95.7) | ||
| ≥1 | 49/57 (90) | ||
| ≤0.5 | 15/61 (24.6) | ||
| ≤0.25 | 2/47 (4.3) | ||
Fig 1.
Scattergram comparing the results of doxycycline broth microdilution MICs (micrograms/ml) to the inhibition zone diameters (mm) around a 30-μg doxycycline disk for 189 isolates of Streptococcus pneumoniae tested in three laboratories using historic tetracycline breakpoints per CLSI document M100-S22. The table at the bottom depicts the number of isolates tested (n) and very major (VM), major (M), and minor (m) error rates for each category: greater than or equal to the intermediate category breakpoint plus 2 dilutions (≥I + 2), intermediate category breakpoint plus or minus 1 dilution (I + 1 to I − 1), and less than or equal to the intermediate category breakpoint minus 2 dilutions (≤I − 2) (10). NA, not applicable.
tetM PCR.
The presence of the tetM resistance determinant was examined in 30 of the initial 101 isolates and all 88 additional isolates (118 total isolates) and was detected primarily in isolates having tetracycline MICs of ≥4 μg/ml and with doxycycline MICs of ≥1 μg/ml (Table 3). These microbiological data coupled with limited pharmacokinetic and pharmacodynamic (PK/PD) data suggested that the doxycycline susceptible breakpoint should probably be 0.25 or 0.5 μg/ml (Table 4).
Table 3.
Comparison of tetracycline and doxycycline MICs among the initial 101 isolates
| Tetracycline MIC (μg/ml) | No. of isolates with doxycycline MIC (μg/ml): |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | Total | |
| >16 | 5 | 29 | 8 | 3 | 45 | ||||||
| 16 | 1 | 6 | 1 | 8 | |||||||
| 8 | 3 | 1 | 4 | ||||||||
| 4 | 1 | 3 | 4 | ||||||||
| 0.5 | 1 | 2 | 3 | ||||||||
| 0.25 | 12 | 12 | |||||||||
| 0.12 | 12 | 9 | 21 | ||||||||
| 0.06 | 2 | 2 | 4 | ||||||||
| Total | 2 | 14 | 22 | 3 | 3 | 3 | 7 | 35 | 9 | 3 | 101 |
Table 4.
New and previous doxycycline and tetracycline MIC (μg/ml) and disk diffusion (mm) breakpoints for S. pneumoniae
| Antimicrobial agent | Breakpoint (μg/ml), S, I, R, by CLSI standard |
|||
|---|---|---|---|---|
| MIC |
Zone diam |
|||
| New (M100-S23) | Previous (M100-S22) | New (M100-S23) | Previous (M100-S22) | |
| Doxycycline | ≤0.25, 0.5, ≥1 | NAa | ≥28, 25–27, ≤24 | NA |
| Tetracycline | ≤1, 2, ≥4 | ≤2, 4, ≥8 | ≥28, 25–27, ≤24 | ≥23, 19–22, ≤18 |
NA, not applicable.
DISCUSSION
Historically, surrogate reporting of antimicrobial agents has been an accepted and efficient mechanism of testing a representative class agent and trusting that the antimicrobial susceptibility or resistance data generated would apply to other agents in the class. The combined results of this study generated in three different laboratories from 189 S. pneumoniae strains indicate that specific testing criteria for doxycycline could be employed rather than relying on the less potent agent tetracycline as a surrogate for doxycycline with Streptococcus pneumoniae. In performing this exercise and reviewing limited PK/PD data for tetracycline (3, 5), it became apparent that a revision of the tetracycline breakpoints was also in order. Doxycycline is more potent than tetracycline against S. pneumoniae, based on lower doxycycline MICs (usually by 1 to 3 2-fold dilutions), especially with strains containing the tetM determinant. Limited PK/PD data (3, 5) coupled with application of the error-rate bounded method of analysis suggested doxycycline-susceptible breakpoints of either ≤0.25 μg/ml or 0.5 μg/ml, with intermediate at 0.5 or 1 μg/ml and resistant at ≥1 or 2 μg/ml, and disk diffusion susceptible zones of ≥28 mm, intermediate zones of 25 to 27 mm, and resistant zones of ≤24 mm with either set of MIC breakpoints (Fig. 2). Revised tetracycline MIC breakpoints are suggested as susceptible at ≤1 μg/ml, intermediate at 2 μg/ml, and resistant at ≥4 μg/ml. Suggested tetracycline disk diffusion zones are identical to those of doxycycline (Fig. 3). Testing of doxycycline specifically might better represent the activity of that agent against pneumococci and would make laboratory reporting simpler than having to indicate that a surrogate marker was used in testing. These data and tentative recommendations were reviewed by the Antimicrobial Susceptibility Testing Subcommittee of the CLSI and serve as the basis of recommendations published in the newest edition of CLSI document M100, M100-S23 (11). The CLSI subcommittee chose the lower set of doxycycline breakpoints due to concerns about declaring some strains with the tetM determinant to be susceptible or intermediate to doxycycline (12).
Fig 2.
Scattergram comparing the results of doxycycline broth microdilution MICs (micrograms/ml) to the inhibition zone diameters (mm) around a 30-μg doxycycline disk for 189 isolates of Streptococcus pneumoniae tested in three laboratories. The solid lines represent the proposed interpretive criteria. The table at the bottom depicts the number of isolates tested (n) and very major (VM), major (M), and minor (m) error rates for each category: greater than or equal to the intermediate category breakpoint plus 2 dilutions (≥I + 2), intermediate category breakpoint plus or minus 1 dilution (I + 1 to I − 1), and less than or equal to the intermediate category breakpoint minus 2 dilutions (≤I − 2) (10). NA, not applicable.
Fig 3.
Scattergram comparing the results of tetracycline broth microdilution MICs (micrograms/ml) to the inhibition zone diameters (mm) around a 30-μg tetracycline disk for 189 isolates of Streptococcus pneumoniae tested in three laboratories. The dotted lines represent current interpretive criteria. The solid lines represent the proposed interpretive criteria. The table at the bottom depicts the number of isolates tested (n) and very major (VM), major (M), and minor (m) error rates for each category: greater than or equal to the intermediate category breakpoint plus 2 dilutions (≥I + 2), intermediate category breakpoint plus or minus 1 dilution (I + 1 to I − 1), and less than or equal to the intermediate category breakpoint minus 2 dilutions (≤I − 2) (10). NA, not applicable.
ACKNOWLEDGMENTS
S.D.D. has received research support from Meridian Biosciences Inc. J.H.J. has consulted for Accelerate Diagnostics and Merck and received research support from bioMerieux and Merck. For all other authors, there are no conflicts to report. No outside funding was received to support this study.
We thank the CDC ABCs sites for collection of the pneumococcal strains used in this study.
Footnotes
Published ahead of print 3 April 2013
REFERENCES
- 1. Mandell LA, Wunderink RG, Anzueto A, Bartlett JG, Campbell GD, Dean NC, Dowell SF, File TM, Jr, Musher DM, Niederman MS, Torres A, Whitney CG. 2007. Infectious Diseases Society of America/American Thoracic Society consensus guidelines on the management of community-acquired pneumonia in adults. Clin. Infect. Dis. 44(Suppl 2):S27–S72 doi:10.1086/511159 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Clinical and Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing. Twenty-second informational supplement, M100-S22. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 3. Christianson J, Andes D, Craig WA. 2001. Characterization of the pharmacodynamics of doxycycline against Streptococcus pneumoniae in a murine thigh-infection model, abstr A-1103. Abstr. 41st Intersci. Conf. Antimicrob. Agents Chemother [Google Scholar]
- 4. Olsvik B, Olsen I, Tenover FC. 1995. Detection of tet(M) and tet(O) using polymerase chain reaction in bacteria isolated from patients with periodontal disease. Oral Microbiol. Immunol. 10:87–92 [DOI] [PubMed] [Google Scholar]
- 5. Christianson J, Andes D, Craig WA. 2001. Magnitude of the 24-H AUC/MIC required for efficacy of doxycycline (DOXY) against Streptococcus pneumoniae (SP) in a murine thigh-infection model, abstr 475. Abstr. 39th Annu. Meet. Infect. Dis. Soc. Am [Google Scholar]
- 6. Clinical and Laboratory Standards Institute 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard, 8th ed, M07-A8 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 7. Clinical and Laboratory Standards Institute 2009. Performance standards for antimicrobial disk susceptibility tests; approved standard—10th ed, M02-A10. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 8. Brunden MN, Zurenko GE, Kapik B. 1992. Modification of the error-bounded classification scheme for use with two MIC breakpoints. Diagn. Microbiol. Infect. Dis. 15:135–140 [DOI] [PubMed] [Google Scholar]
- 9. Metzler DM, DeHaan RM. 1974. Susceptibility tests of anaerobic bacteria: statistical and clinical considerations. J. Infect. Dis. 130:588–594 [DOI] [PubMed] [Google Scholar]
- 10. Clinical and Laboratory Standards Institute 2008. Development of in vitro susceptibility testing interpretive criteria and quality control parameters. Approved guideline, 3rd ed, M23-A3 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 11. Clinical and Laboratory Standards Institute 2013. Performance standards for antimicrobial susceptibility testing. Twenty-third informational supplement, M100-S23. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 12. Dudley MN, Ambrose PG, Bhavnani SM, Craig WA, Ferraro MJ, Jones RN. 18 January 2013. Background and rationale for revised Clinical and Laboratory Standards Institute (CLSI) interpretive criteria (breakpoints) for Enterobacteriaceae and Pseudomonas aeruginosa: I. Cephalosporins and aztreonam. Clin. Infect. Dis. [Epub ahead of print.] doi:10.1093/cid/cit017 [DOI] [PubMed] [Google Scholar]