Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2013 Aug;51(8):2696–2701. doi: 10.1128/JCM.00662-13

Development of a Sensitive Loop-Mediated Isothermal Amplification Assay That Provides Specimen-to-Result Diagnosis of Respiratory Syncytial Virus Infection in 30 Minutes

James Mahony a,b,✉, Sylvia Chong b, David Bulir b, Alexandra Ruyter b, Ken Mwawasi b, Daniel Waltho b
PMCID: PMC3719640  PMID: 23761156

Abstract

Rapid isothermal amplification methods have recently been introduced, and some of these methods offer significant advantages over PCR. The objective of this study was to develop a rapid and sensitive multiplex loop-mediated isothermal amplification (M-LAMP) assay for the detection of respiratory syncytial virus subgroups A and B (RSV A and B). We designed six primers each for the matrix gene of RSV A and the polymerase gene of RSV B and developed an M-LAMP assay by using a commercially available master mix and a real-time fluorometer (Genie II; Optigene, United Kingdom) that displays real-time amplification, time to positivity, and amplicon annealing temperature (Tm). The M-LAMP was evaluated against PCR by testing 275 nasopharyngeal (NP) specimens. The final optimized M-LAMP assay had a mean amplification time of 14.2 min (compared with 90 to 120 min for PCR) and had an analytical sensitivity of 1 genome equivalent (ge) for both RSV A and B. Using PCR as a comparator, M-LAMP had a sensitivity of 100% (81/81) and specificity of 100% (194/194). We also evaluated a 3- to 10-min specimen processing method involving vortexing with glass beads and heating to 98°C in M-swab medium (Copan Italia, Brescia, Italy) and found that this rapid processing method allowed detection of 37/41 (90.2%) of positives when we used extracted nucleic acid. In summary, the M-LAMP assay had excellent sensitivity and specificity for detecting RSV A and B in NP specimens and, when coupled with a rapid specimen preparation method, could provide a specimen-to-result diagnosis time of 30 min.

INTRODUCTION

Over the past 15 years there has seen a shift away from traditional testing methods for respiratory viruses, such as culture and antigen detection, and toward more sensitive nucleic acid amplification tests (NAAT) (1, 2). PCR amplification has provided diagnostic laboratories with sensitive and specific tools to detect a variety of respiratory viruses, and molecular testing has been widely adopted by clinical laboratories around the world (3–5). PCR testing, however, has some disadvantages, as these tests can be cumbersome, labor-intensive, require a thermal cycler, and require on average 2 to 3 h to obtain results. Isothermal amplification methods were first introduced in the 1990s and included transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), and strand displacement amplification (SDA). Following the introduction of these methods, 12 additional isothermal amplification formats have been developed (see recent reviews by Wu and Tang [4] and Niemz et al. [6]). Some of these newer amplification methods have been used to detect respiratory viruses, some are amenable to multiplex formats, and others can yield a result in 25 min (7–13).

Respiratory syncytial virus (RSV) is a major cause of both upper and lower respiratory tract infections (LRTI) in both the young and the elderly (14–16). RSV is the single most important cause of bronchiolitis or LRTI in infants under the age of 2 years that results in emergency room visits and hospitalizations. RSV infections in adults are generally mild and less severe, although the elderly and severely immunocompromised are susceptible to severe disease. It is estimated that between 11,000 and 17,000 adults die of RSV infection annually in the United States, and 10-fold more are admitted to the hospital with respiratory symptoms (16).

Nucleic acid amplification tests, especially PCR tests, have been used extensively to detect RSV, and these tests detect more infections than do traditional methods (2, 5). Isothermal amplification has recently been introduced for the detection of respiratory viruses. Four studies used a commercial NucliSens EasyQ RSV A/B NASBA test (17–20), and two studies reported on the use of loop-mediated isothermal amplification (LAMP) for the detection of RSV (11, 12). LAMP utilizes 4 or 6 primers (2 inner, 2 outer, and 2 loop primers) and a strand displacement polymerase, such as Bst polymerase, and is performed at a constant temperature of 62 to 65°C. In laboratories that perform a large volume of molecular tests, specimen preparation can take up to an hour to perform and can take longer than some isothermal amplification assays take to run; in settings like this, the rate-limiting step is often extraction. The objective of the current study was to develop a sensitive LAMP assay for the rapid detection of RSV A and B and to combine LAMP testing with a faster specimen processing method to attempt to provide a specimen-to-result diagnosis time of 30 min.

MATERIALS AND METHODS

Clinical specimens.

Nasopharyngeal (NP) swabs collected in universal transport medium (Copan Italia, Brescia, Italy) from symptomatic patients were transported at ambient temperature to the Regional Virology Laboratory at St. Joseph's Healthcare Hamilton. A total of 275 NP specimens, including 75 preselected positives and 200 specimens collected prospectively between 14 April and 4 May 2012 (n = 100) and 7 to 17 February 2013 (n = 100) were used in the evaluation. Among the total specimens, there were 81 RSV, 11 influenza virus type A, 12 influenza virus type B, 5 adenovirus, 10 human metapneumovirus (hMPV), 4 parainfluenza virus type 1 (PIV-1), 5 PIV-2, 8 PIV-3, 2 rhino-enterovirus, 4 specimens that were positive for two viruses (1 adenovirus/PIV-2, 1 PIV-1/rhino-enterovirus, and 2 PIV-2/rhino-enterovirus), and 133 negative specimens. The 75 preselected RSV positives included 27 RSV A and 21 RSV B samples. This study was approved by St. Joseph's Healthcare Hamilton Research Ethics Review Board.

Preanalytical procedures.

Aliquots of NP specimens (0.2 ml) were extracted with either a QIASymphony (Qiagen, Germantown, MD) or easyMag (bioMérieux, St. Laurent, QC) extractor, and a 5-μl aliquot of the 50 μl of purified nucleic acid obtained was tested in the LAMP assay. A subset of 16 NP specimens was processed for direct testing by LAMP without extraction. Swabs were placed in 1 ml of M-Swab medium (Copan Italia, Brescia, Italy) and vortexed for 30 s with 1-mm glass beads (Biospec Products, Bartlesville, OK). Aliquots (0.2 ml) were transferred to thin-walled microcentrifuge tubes prior to heating at 98°C for 3 to 10 min, and a 5-μl aliquot was tested directly by LAMP.

Preparation of transcripts.

Amplification targets for LAMP, viz. the full-length matrix gene of RSV A and the pol gene of RSV B, were cloned into the pGEM-T vector by using standard methods. Transcripts were prepared using an in vitro transcription kit (Ambion, Life Technologies, Burlington, ON, Canada), and RNA copy number was determined by reading the A260 (1 absorbance unit was considered equal to 40 μg of RNA).

Design of LAMP assay primers.

Primers for RSV A and RSV B were designed using conserved regions of the matrix gene for RSV A and the pol gene for RSV B. Several matrix and pol gene sequences representing different RSV isolates from different geographical areas of the world were aligned to identify conserved regions. LAMP primers were designed from candidate conserved regions using the Primer Explorer version 4 software (Eiken Chemical Co., Tokyo, Japan). A set of 6 primers (Table 1), including two outer primers (forward primer F3 and backward primer B3), two inner primers (forward inner primer FIP and backward inner primer BIP), and two loop primers (forward loop primer LF and backward loop primer LB), were selected for each of the two gene targets (7, 8). Candidate primers were assessed for specificity before their use in the LAMP assays by doing a BLAST search with sequences in GenBank.

Table 1.

RSV A and B primers for the multiplex LAMP assay

RSV subgroup and primer name Primer sequence (5′–3′)
A
    F3 GCTGTTCAATACAATGTCCTAGA
    B3 GGTAAATTTGCTGGGCATT
    FIP TCTGCTGGCATGGATGATTGGAGACGATGATCCTGCATCA
    BIP CTAGTGAAACAAATATCCACACCCAGCACTGCACTTCTTGAGTT
    LF ACATGGGCACCCATATTGTAAG
    LB AGGGACCTTCATTAAGAGTCATGAT
B
    F3 AACCATTCCTGCTACAGAT
    B3 CATCTTGAGCATGATATTTTGC
    FIP AGCATCGCAGACAAAGATACTAATCAACTAACAACATACATTGGTCT
    BIP CCTGTCACAGCCAATTGGAGTCAGAAGAACAGTATTTGCACTT
    LF AACGCCGTCAACGACGTCGTGCCCTCGAGGACCTGCTC
    LB AGGTTCTGCAAATTTTATATGTAAATA

Optimization of the LAMP reaction.

LAMP was carried out in a final reaction volume of 25 μl. The reaction mixture contained 15 μl of isothermal Master Mix ISO 0001 (Optigene, United Kingdom) containing Geobacillus species DNA polymerase, thermostable inorganic pyrophosphatase, optimized buffer (including MgCl2, deoxynucleoside triphosphates and double-stranded DNA dye (Optigene), 5 μl of primer mix consisting of 6 primers each for RSV A and B (F3 and B3 primers at 0.2 μM, FIP and BIP primers at 0.8 μM, and LF and LB primers at 0.4 μM), 0.25 units of avian avian myeloblastosis virus reverse transcriptase (Promega, WI), and 5 μl extracted nucleic acid or processed specimen (vortexed and heated as described above). The LAMP assay was run at temperatures between 62 and 67°C in a real-time fluorometer (Genie II; Optigene) to determine the optimal temperature giving the shortest amplification time and highest fluorescence reading. All LAMP assays were subsequently run at 62°C for 30 min followed by heating and cooling steps of 98° to 80°C (0.05°C/s) to allow reannealing of amplified DNA and display of the annealing curve. The annealing temperature (Tm) values for RSV A and B were similar, so that subtyping of RSV was not possible with this set of primers. The specificity of the primers for detecting RSV was validated by testing NP specimens that were positive for other respiratory viruses, including adenovirus, influenza virus types A and B, PIV-1, PIV-2, PIV-3, hMPV, rhinovirus, and enterovirus.

Conventional PCR testing.

All 275 specimens used in the study were first tested in the Regional Virology Laboratory at St. Joseph's Healthcare Hamilton by using in-house real-time PCR assays for influenza virus types A and B, RSV, hMPV, adenovirus, PIV-1, PIV-2, and PIV-3. These assays have been validated by comparison of results with direct fluorescent-antibody assay, shell vial culture, and the xTAG RVP assay (Luminex, Toronto, Ontario) (21). LAMP testing was performed in a blinded fashion with the operator unaware of PCR test results.

RESULTS

Design of LAMP primers for RSV A and B.

We developed a multiplex LAMP assay for the detection of both RSV A and B. We designed six primers for conserved regions of the matrix gene of RSV A and the large polymerase (pol) gene of RSV B (Table 1). The specificity of the primers was initially validated by testing 27 selected NP specimens that were positive for one or more other respiratory viruses, including adenovirus, influenza virus types A and B, PIV-1, PIV-2, PIV-3, hMPV, rhinovirus, and enterovirus. All of these other respiratory viruses tested negative in the LAMP assay, attesting to the specificity of the primers.

Detection of RSV A and B by LAMP.

The temperature and primer concentrations for M-LAMP were optimized for the rapid detection of RSV A and B with the Genie II fluorometer. The Genie II displays amplification signals, and at the end of the run it displays the time to positivity and Tm for each specimen. The amplification times and Tm values for 23 randomly selected RSV A- and B-positive specimens are shown in Table 2. The primers designed for LAMP gave a Tm for RSV A that ranged from 81.62°C to 83.73°C and a Tm for RSV B that ranged from 81.29°C to 83.7°C. The overlap in Tm values for RSV A and RSV B did not allow an identification of the RSV subtype when using this set of primers. The mean amplification times for the 48 preselected positives were as follows: 13.8 min (range, 10.5 to 20 min) for 21 RSV A positives; 14.5 min (range, 11.25 to 20 min) for 27 RSV B positives. The overall mean time to positivity for all positives was 14.2 min. The LAMP reaction was therefore set to run for 30 min for testing unknown specimens.

Table 2.

Amplification times and annealing temperatures for RSV A-positive or B-positive specimens tested by LAMPa

Specimen RSV subgroup Amplification time (min:s) Tm (°C)
11:VR471 B 11:15 81.29
11:VR868 B 12:45 81.56
11:VR1440 B 13:15 81.51
11:VR518 B 11:45 81.43
90595 A 11:45 83.47
09:VR15257 A 13:45 83.42
09:VR15053 A 11:15 83.36
09:VR6545 A 13:45 83.22
09:VR15543 A 11:45 83.58
09:VR15631 A 15:15 83.62
09:VR13429 A 11:30 83.64
09:VR14544 A 12:30 83.54
09:VR15591 A 12:45 83.36
09:VR15521 A 12:00 83.48
09:VR13029 A 12:15 83.67
09:VR16242 A 19:00 83.47
09:VR16542 B 17:15 81.84
10:VR536 B 14:30 82.07
11:VR657 B 12:15 82.08
11:VR634 B 15:45 81.85
11:VR471 B 13:00 81.63
11:VR68 B 15:00 81.97
11:VR1440 B 15:30 81.83
a

Extracted nucleic acids from 23 RSV-positive specimens were tested by LAMP using the Genie II fluorometer (Optigene, United Kingdom). Amplification times and annealing temperatures (Tm) were recorded at the end of the run. The annealing temperatures for RSV A and RSV B overlap, and so it was not possible to distinguish subtypes with this set of primers.

Performance of M-LAMP.

We determined the analytical sensitivity of LAMP by testing serial dilutions of viral transcripts prepared in vitro from target genes cloned into the pGEM-T vector. The LAMP assay detected RSV over 7 logs of transcript copies (Table 3). LAMP detected both RSV A and B in 3 out of 3 replicates for dilutions ranging from 103 to 1 copy and detected 0.1 copy in 1 out of 3 replicates of both RSV A and B. Based on Probit regression analysis, the lower limit of detection for RSV A and B was 1 ge (P < 0.05) (22).

Table 3.

Lower limit of detection RSV A and B when using M-LAMPa

No. of RNA transcripts (copies/5 μl) Amplification time (min:s), Tm (°C)
RSV A RSV B
107 6:30, 83.46 7:15, 82.24
106 8:00, 83.60 8:45, 82.17
105 9:00, 83.40 10:15, 82.06
104 11:15, 83.16 11:30, 82.10
103 12:30, 83.51 13:30, 82:00
103 12:30, 83.60 13:30, 81.76
103 12:15, 83.63 13:30, 82.15
102 14:00, 83.48 15:30, 82.20
102 13:45, 83.55 15:30, 82.23
102 14:00, 83.42 15:15, 82.13
101 15:45, 83.59 18:00, 81.90
101 16:30, 83.62 18:00, 81.87
101 16:30, 83.54 18:15, 81.92
1 18:00, 83.14 20:45, 82.15
1 17:30, 83.05 20:45, 81.97
1 18:30, 83.38 20:15, 81.95
0.1 Negb —,c 81.66
0.1 24:30, 83.28 Neg
0.1 Neg Neg
a

RNA transcripts for each gene target were prepared using an in vitro transcription kit, and the copy number was determined based on absorbance, as described in Materials and Methods. Serial dilutions of RNA transcripts containing 107 to 10−1 copies were tested by LAMP using the Genie II fluorometer. By using probit regression analysis (22), the lower limit of detection when using LAMP was 1 copy of RNA for both RSV A and B.

b

Neg, no amplification detected.

c

—, the amplification curve was visible after 22 min, but the amplification time was not recorded on the Genie II instrument.

We evaluated the performance of the M-LAMP assay by testing 275 NP specimens submitted to the Regional Virology Laboratory during the respiratory virus seasons of 2011-2012 and 2012-2013. All specimens were first tested in the Regional Virology Laboratory in in-house PCR assays for influenza virus types A and B, RSV, adenovirus, PIV types 1 to 3, and hMPV and then tested blindly with M-LAMP. Of the 275 specimens tested by PCR, there were 142 specimens positive for one or more viruses, including the following: 81 RSV, 11 influenza virus type A, 12 influenza virus type B, 5 adenovirus, 10 hMPV, 2 rhino/enterovirus, 4 PIV-1, 5 PIV-2, and 8 PIV-3, and 4 specimens that were positive for two viruses. Of the 81 specimens that were positive for RSV by PCR, all 81 were positive by M-LAMP. All 133 NP specimens that were negative by PCR for respiratory viruses and the 61 NP specimens that were positive for other respiratory viruses but negative for RSV were negative in the M-LAMP assay. The sensitivity and specificity of M-LAMP for detecting RSV A and B were 100% (81/81) and 100% (194/194).

Reproducibility of M-LAMP.

To determine the precision of LAMP, we tested 10 replicates of a strong RSV-positive specimen (threshold cycle [CT], 17.32) and 10 replicates of a weaker RSV-positive specimen (CT, 29.11). The mean amplification times of the replicates for the weak and strong positive specimens were 16.56 min (standard deviation [SD], 0.193) and 9.95 min (SD, 0.09), respectively, and the coefficients of variation (CVs) were 0.9% and 1.1%, respectively (data not shown). To further assess the reproducibility of M-LAMP, we tested 8 NP positive specimens in four separate LAMP runs and recorded the time to positivity and the Tm for each specimen. The amplification times and Tm values for the replicates for all 8 specimens across four separate runs were similar, with amplification times within 1.5 min for each specimen and SDs ranging from 0.14 and 0.63 (Table 4), indicating that M-LAMP was highly reproducible.

Table 4.

Reproducibility of LAMP testinga

Specimen no. Amplification time (min:s), Tm (°C)
Amplification time (min) (mean, SD)
Run 1 Run 2 Run 3 Run 4
1 10:45, 81.90 10:45, 81.85 10:30, 81.91 11:30, 81.70 10.62, 0.14
2 12:45, 81.94 12:30, 81.92 12:15, 81.95 13:30, 81.77 12.75, 0.54
3 14:00, 81.84 14:00, 82.15 13:30, 81.75 15:00, 81.95 14.13, 0.63
4 11:45, 81.55 11:30, 82.09 11:30, 81.56 12:00, 81.89 11.69, 0.24
5 15:00, 83.75 15:45, 83.72 15:30, 83.70 16:30, 83.54 15.69, 0.63
6 12:30, 83.61 13:00, 83.52 13:00, 83.57 14:00, 83.39 13.12, 0.63
7 12:45, 81.93 12:30, 81.91 12:30, 81.83 13:45, 81.66 12.88, 0.60
8 12:00, 83.42 12:30, 83.37 12:30, 83.42 13:00, 83.27 12.5, 0.40
a

Eight NP specimens were extracted, and aliquots of RNA were tested by LAMP on four separate occasions. The mean amplification time ± 1 standard deviation is shown for each specimen.

Rapid specimen processing.

In order to generate results in the shortest possible time, we evaluated a novel specimen processing method that consisted of vortexing the swab in 1 ml M-swab medium with glass beads for 30 s, followed by heating at 98°C for 3, 5, or 10 min, then testing 5 μl of the specimen directly by LAMP without nucleic acid extraction. Vortexing and heating gave positive results for 37/41 (90.2%) NP specimens when the specimens were heated for 3, 5, or 10 min (Table 5). There was no clear trend for results obtained with the different heating times; 4 specimens (numbers 5, 20, 21, and 27) were missed for all three heating times, 2 specimens (numbers 1 and 28) were positive for 10 min but negative for 3 and 5 min, and 1 specimen (number 14) was positive for 3 and 5 min but negative for 10 min. The amplification times for positives heated for 3, 5, or 10 min were not significantly different (P > 0.05), suggesting that longer heating times did not yield faster amplification times. There were five weak-positive specimens (PCR CT values, ≥30) that were tested by the rapid method. Three of these (CT values of 31.60, 30.53, and 30.41) were detected by the rapid method, while the other two (CT values of 31.51 and 32.40) were missed by the rapid method. Two other specimens that were also missed by the rapid method had CT values of 25.12 and 28.88, so there was no apparent correlation between viral load and the ability to detect virus when using the rapid method.

Table 5.

Comparison of M-LAMP to PCR for rapid specimen processing and nucleic acid extractiona

Sample no. Specimen ID Real-time PCR CT for extracted nucleic acid RSV LAMP amplification time (min:s), Tm (°C)
Extracted nucleic acid Heated for:
3 min 5 min 10 min
1 13:VR3139 27.55 15:00, 81.77 Negb Neg 24:30, 82.62
2 13:VR3159 27.34 14:15, 83.36 20:00, 82.92 22:15, 82.92 23:00, 82.91
3 13:VR2888 26.60 15:15, 83.16 29:00, 82.47 26:15, 82.56 29:00, 82.46
4 13:VR3055 26.21 15:15, 83.20 23:15, 82.43 27:15, 82.57 22:45, 82.87
5 13:VR3056 28.88 16:30, 82.87 Neg Neg Neg
6 13:VR3164 20.53 12:00, 85.35 19:00, 83.12 21:30, 83.22 25:45, 83.12
7 13:VR3037 26.21 13:15, 81.54 19:30, 81.05 26:30, 81.05 28:00, 81.10
8 13:VR3058 19.65 10:15, 81.93 15:30, 81.20 16:45, 81.35 17:30, 81.24
9 13:VR3057 27.19 15:45, 83.64 22:00, 84.74 23:00, 83.90 24:00, 83.94
10 13:VR2890 24.80 14:30, 83.48 20:00, 83.92 21:30, 84.02 21:45, 83.81
11 13:VR2559 24.49 13:45, 84.69 20:00, 84.13 24:00, 84.32 21:15, 84.12
12 13:VR2562 20.94 10:45, 82.88 18:15, 82.51 18:45, 82.52 21:30, 82.42
13 13:VR2676 17.43 10:15, 83.35 16:15, 82.78 17:45, 83.03 18:30, 82.63
14 13:VR2576 27.31 15:45, 84.80 21:30, 84.08 22:15, 84.07 Neg
15 13:VR2563 23.63 13:00, 84.58 18:30, 83.96 20:30, 84.02 20:15, 83.96
16 13:VR2886 23.26 13:30, 84.56 18:00, 83.83 19:15, 83.98 19:00, 83.88
17 13:VR5130 31.60 19:15, 83.82 21:00, 83.08 ND 20:00, 83.20
18 13:VR5739 30.53 ND 21:15, 82.97 ND 18:15, 84.29
19 13:VR3286 30.41 20:00, 84.88 27:00, 82.86 ND 27:00, 84.56
20 13:VR3263 31.51 17:00, 84.11 Neg (1:5, 1:10)c ND Neg
21 13:VR3387 32.40 16:15, 83.34 Neg (1:5, 1:10)c ND Neg
22 13:VR2501 29.06 ND 25:30, 81.63 ND 18:00, 82.98
23 13:VR3155 29.11 ND 23:15, 83.30 ND 20:15, 84.62
24 13:VR3095 27.38 14:15, 85.10 21:45, 82.98 ND 20:15, 83.10
25 13:VR3495 21.87 11:00, 83.28 17:45, 81.42 ND 16:15, 82.47
26 13:VR3523 24.47 12:30, 85.12 19:45, 83.06 ND 19:15, 84.37
27 13:VR3649 25.12 12:45, 81.91 Neg (1:5, 1:10)c ND Neg
28 13:VR3626 24.60 12:30, 81.82 20:15, 83.38d ND 19:00, 82.70
29 13:VR3308 24.30 12:15, 83.50 18:45, 81.83 ND 17:15, 82.88
30 13:VR3278 24.15 ND 23:30, 83.25 ND 22:30, 84.42
31 13:VR3262 22.61 12:00, 84.97 20:00, 82.98 ND 19:00, 83.15
32 13:VR5340 25.20 ND 19:00, 82.87 ND 19:15, 83.90
33 13:VR5337 26.45 13:00, 82.27 19:30, 81.47 ND 21:45, 82.69
34 13:VR3517 23.27 11:45, 85.15 19:15, 82.83 ND 19:15, 84.56
35 13:VR5142 24.53 12:15, 83.45 17:15, 83.21 ND 17:15, 84.40
36 13:VR3041 23.84 12:30, 85.07 21:00, 83.12 ND 20:45, 84.24
37 13:VR2503 25.19 ND 20:30, 82.95 ND 21:15, 84.07
38 13:VR2656 21.84 ND 18:45, 82.89 ND 20:15, 83.08
39 13:VR2631 23.88 ND 21:30, 82.82 ND 22:00, 83.03
40 13:VR5113 21.15 10:45, 83.11 17:00, 82.72 ND 17:30, 82.91
41 13:VR2639 20.37 ND 18:15, 82.58 ND 18:30, 82.96
a

Aliquots of 41 NP specimens were either extracted (easyMag; bioMérieux) and tested with real-time PCR to determine CT values and by M-LAMP or were processed by vortexing and heating to 98°C for 3, 5, or 10 min (as described in Materials and Methods) and then tested directly by M-LAMP without extraction. ND, not done.

b

Neg, no amplification detected.

c

Negative when tested neat and when diluted 1:5 or 1:10.

d

Negative when tested neat, positive when tested at 1:5 dilution.

DISCUSSION

We developed an M-LAMP assay for the rapid detection of RSV A and B that had an analytical sensitivity of 1 ge and gave positive results in under 30 min. Optimization of the amplification temperature (62°C), primer concentrations (F3 and B3 primers at 0.2 μM, FIP and BIP primers at 0.8 μM, LF and LB primers at 0.4 μM), coupled with the use of a commercially available Master Mix containing an improved polymerase (Optigene, United Kingdom) decreased amplification times by a factor of 2 (data not shown). The M-LAMP assay had an overall sensitivity (81/81) and specificity (194/194) of 100%. We attribute the excellent sensitivity to the use of an improved polymerase and the excellent specificity from the use of 6 primers instead of 4 for each gene target (8, 13). We have not tested bacteria to determine the specificity of the RSV LAMP assay. Amplification times for RSV A and B ranged from 11 to 19 min (mean, 14.2 min), which was significantly faster than the 90 to 120 min required for real-time PCR. The overlapping Tm for RSV A and B, however, did not allow for the discrimination of RSV A and B subtypes (Table 2).

There have only been a few reports on the use of isothermal amplification for the detection of RSV A and B. A commercially available NASBA test called the NucliSensQ RSV A+B assay from bioMérieux was introduced in 2005 and has been evaluated in four studies. Moore et al. evaluated NASBA by using 508 specimens with a positivity rate of 21% and showed that NASBA picked up 38% more positives than traditional methods (17). Deiman et al. reported that NASBA was more sensitive than culture and immunofluorescence staining and picked up 30% more positives than the Binax NOW enzyme-linked immunosorbent assyay (18). In a study from Germany that studied 251 NP washings, NASBA detected 29% additional positives (80 versus 62) than an in-house PCR (19), and in a study from the United States of 603 pediatric specimens, the NucliSens analyte-specific reagents and the NucliSensQ analyzer were able to detect 5 to 20 copies/reaction mixture and had a sensitivity of 93.8% and a specificity of 97% (20). There have been only two reports about the use of LAMP for the detection of RSV. In 2005, Ushio et al. described an RT-LAMP assay for RSV A and B with an analytical sensitivity of 0.1 50% tissue culture infective doses and a 60-min amplification time (11). This RT-LAMP detected 47 positives compared with 42 by nested RT-PCR. In 2007, Shirato et al. compared RT-LAMP to virus culture and the BD Directogen EZ RSV test, using specimens from 59 children; RT-LAMP detected 36 positives, compared to 26 by enzyme immunoassay (EIA) and 20 by culture (12). Our M-LAMP assay had a lower limit of detection of 1 ge and gave faster amplification times than these earlier assays for detecting RSV A and B in NP specimens, with a mean time to positivity of 14.2 min. As mentioned above, the shorter amplification time of our assay was likely due to the use of an improved polymerase with faster kinetics (13) and the use of six primers as opposed to four (8).

The rapid amplification times for LAMP and its lower susceptibility to amplification inhibitors compared to PCR (23, 24) prompted us to evaluate whether we could use LAMP to detect RSV in NP specimens without the need for extraction. We evaluated mechanical disruption by vortexing with glass beads and heating to 98°C in the presence of the M-swab medium to release nucleic acids. This proprietary medium assists with lysis and is compatible with molecular testing. In our hands, nonionic detergents such as NP-40 did not work as well as the M-Swab medium. This rapid lysis procedure worked for 90.2% (37/41) of NP specimens, giving positive results by LAMP without the need for extraction; however, amplification times were longer than those obtained using extracted RNA. The slower amplification times obtained with the nonextracted samples was due in part to the 4-fold concentration of RNA achieved during extraction and the smaller amount of RNA tested using the rapid method. Since heating for 3 min gave similar amplification times as 10 min (Table 5), the slower amplification times obtained by the rapid method are probably not due to incomplete lysis and release of RNA. Since 3 of the 5 weakest positives (CT values of ≥30) were detected using the rapid method, there was little or no correlation between viral load and the ability to detect RSV with the rapid method. Testing of additional weak positives will therefore be required to determine whether low positives are efficiently detected using the rapid method. It is not known at this time whether the rapid processing method will work with NP aspirates or washes.

Despite the slightly longer amplification times used with the rapid processing method (heating for 3 min) compared with extraction, this approach still provided a specimen-to-result diagnosis in 30 min. This would compare with slightly longer times of 45 to 60 min when extraction is used, depending on which extraction protocol is used. Since we only tested 41 specimens using the rapid processing method, further evaluation using a larger number of specimens will be required. We believe that this rapid processing method coupled with LAMP represents the fastest diagnostic method for RSV infection reported to date for a test with a sensitivity of a single virus particle. We are currently exploring alternative RNA release methods, using electrical lysis or electroporation (25) which, when coupled with rapid amplification methods such as LAMP will facilitate the development of point-of-need (PON) tests for respiratory virus infections (26). Inexpensive, one-time use, PON devices employing microfluidic technology are currently under development for global heath pathogens, such as HIV and tuberculosis (27–29), and the application of microfluidic technology for PON devices for the detection of respiratory viruses in settings such as emergency departments, walk-in clinics, or doctor offices is not far into the future.

ACKNOWLEDGMENTS

We acknowledge the secretarial assistance of Joanne Warner. J.M. conceived of and designed the study. S.C., A.R., D.B., K.M., and D.W. acquired data, analyzed data, and critically reviewed the manuscript. All authors approved the manuscript.

Footnotes

Published ahead of print 12 June 2013

REFERENCES

  • 1. Mahony JB. 2008. Detection of respiratory viruses by molecular methods. Clin. Microbiol. Rev. 21:716–747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Mahony JB. 2010. Nucleic acid amplification-based diagnosis of respiratory virus infections. Expert Rev. Anti Infect. Ther. 8:1273–1292 [DOI] [PubMed] [Google Scholar]
  • 3. Yan Y, Zhang S, Tang Y. 2011. Molecular assays for the detection and characterization of respiratory viruses. Semin. Respir. Crit. Care Med. 32:512–526 [DOI] [PubMed] [Google Scholar]
  • 4. Wu W, Tang Y-W. 2009. Emerging molecular assays for detection and characterization of respiratory viruses. Clin. Lab. Med. 29:673–693 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Mahony J, Smieja M, Petrich A. 2011. Molecular diagnostics for viral respiratory infections. Crit. Rev. Clin. Lab. Sci. 48:217–249 [DOI] [PubMed] [Google Scholar]
  • 6. Niemz A, Ferguson TM, Boyle DS. 2011. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 29:240–250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino M, Hase T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:e63. 10.1093/nar/28.12.e63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Nagamine K, Hase T, Notomi T. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 16:223–229 [DOI] [PubMed] [Google Scholar]
  • 9. Ito M, Watanabe M, Nakagawa N, Ihara T, Okuno Y. 2006. Rapid detection and typing of influenza A and B by loop-mediated isothermal amplification: comparison with immunochromatography and virus isolation. J. Virol. Methods 135:272–275 [DOI] [PubMed] [Google Scholar]
  • 10. Li S, Fang M, Zhou B, Ni H, Shen Q, Zhang H, Han Y, Yin J, Chang W, Xu G, Cao G. 2011. Simultaneous detection and differentiation of dengue virus serotypes 1–4, Japanese encephalitis virus, and West Nile virus by a combined reverse-amplification assay. Virol. J. 8:360–368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Ushio M, Yui I, Yoshida N, Fujino M, Yonekawas T, Ota Y, Notomi T, Nakayama T. 2005. Detection of respiratory syncytial virus genome by subgroups A, B specific reverse transcriptase loop-mediated isothermal amplification (RT-LAMP). J. Med. Virol. 77:121–127 [DOI] [PubMed] [Google Scholar]
  • 12. Shirato K, Nishimura H, Saijo M, Okamoto M, Noda M, Tashiro M, Taguchi F. 2007. Diagnosis of human respiratory syncytial virus infection using reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 139:78–84 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Tanner NA, Zhang Y, Evans TC., Jr 2012. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques 53:81–89 [DOI] [PubMed] [Google Scholar]
  • 14. Hall CB. 2012. The burgeoning burden of respiratory syncytial virus among children. Infect. Disord. Drug Targets 12:92–97 [DOI] [PubMed] [Google Scholar]
  • 15. Gilleland J, Mahony J, Paes B. 2012. Respiratory syncytial virus infection: diagnostic investigation, management and preventive strategies, p 1–78 In Nam H, Gippeum K. (ed), Respiratory syncytial virus. Nova Sciences Publishers Inc., New York, NY [Google Scholar]
  • 16. Walsh EE, Falsey AR. 2012. Respiratory syncytial virus infection in adults. Infect. Disord. Drug Targets 12:98–102 [DOI] [PubMed] [Google Scholar]
  • 17. Moore C, Valappil M, Corden S, Westmoreland D. 2006. Enhanced clinical utility of the NucliSens EasyQ RSV A+B assay for rapid detection of respiratory syncytial virus in clinical specimens. Eur. J. Clin. Microbiol. Infect. Dis. 25:167–174 [DOI] [PubMed] [Google Scholar]
  • 18. Deiman B, Schrover C, Moore C, Westmorland D, van de Wiel P. 2007. Rapid and highly sensitive qualitative real-time assay for the detection of respiratory syncytical virus A and B using NASBA and molecular beacon technology. J. Virol. Methods 146:29–35 [DOI] [PubMed] [Google Scholar]
  • 19. Tillman RL, Simon A, Muller A, Schildgen O. 2007. Sensitive commercial NASBA assay for the detection of respiratory syncytial virus in clinical specimens. PLoS One 2(12):e1357. 10.1371/journal.pone.0001357 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Manji R, Lotlikar M, Zhang F, Ginocchio C. 2009. Clinical evaluation of NucleSens magnetic extraction and NucliSENS analyte specific reagents for the real-time detection of respiratory syncytial virus (RSV) in pediatric respiratory specimens. J. Clin. Pathol. 62:998–1002 [DOI] [PubMed] [Google Scholar]
  • 21. Merante F, Yaghoubian S, Janeczko R. 2007. Principles of the xTAGTM respiratory viral panel assay (RVP assay). J. Clin. Virol. 40(Suppl. 1):S31–S35 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Smieja M, Mahony JB, Goldsmith CH, Chong S, Petrich A, Chernesky M. 2001. Replicate PCR testing and probit analysis for detection and quantitation of Chlamydia pneumoniae in clinical specimens. J. Clin. Microbiol. 39:1796–1801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Curtis KA, Rudolph DL, Owen SM. 2008. Rapid detection of HIV-1 by reverse transcription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151:264–270 [DOI] [PubMed] [Google Scholar]
  • 24. Kiddle G, Hardinge P, Buttigieg N, Gandelman O, Pereira C, McElgunn CJ, Rizzoli M, Jackson R, Appleton N, Moore C, Tisi LC, Murray JA. 2012. GMO detection using a bioluminescent reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use. BMC Biotechnol. 12:15–28. 10.1186/1472-6750-12-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Shaikh FA, Ugaz VM. 2006. Collection, focusing, and metering of DNA in microchannels using addressable electrode arrays for portable low-power bioanalysis. Proc. Natl. Acad. Sci. U. S. A. 103:4825–4830 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Mahony JB. Molecular detection of respiratory viruses: where do we go from here? Eur. Infect. Dis. Rev., in press [Google Scholar]
  • 27. Yager P, Domingo GJ, Gerdes J. 2008. Point-of-care diagnostics for global health. Annu. Rev. Biomed. Eng. 10:107–144 [DOI] [PubMed] [Google Scholar]
  • 28. Asiello PJ, Baeumner AJ. 2011. Miniaturized isothermal nucleic acid amplification, a review. Lab Chip 11:1420–1430 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES