Skip to main content
American Journal of Physiology - Renal Physiology logoLink to American Journal of Physiology - Renal Physiology
. 2013 Apr 17;305(1):F111–F122. doi: 10.1152/ajprenal.00139.2013

Expression and function of CCL2/CCR2 in rat micturition reflexes and somatic sensitivity with urinary bladder inflammation

Lauren Arms 1, Beatrice M Girard 1, Susan E Malley 1, Margaret A Vizzard 1,✉
PMCID: PMC3725675  PMID: 23594826

Abstract

Chemokines are proinflammatory mediators of the immune response, and there is growing evidence for chemokine/receptor signaling involvement in pronociception. Bladder pain syndrome (BPS)/interstitial cystitis (IC) is a chronic pain syndrome characterized by pain, pressure, or discomfort perceived to be bladder-related with at least one urinary symptom. We have explored the expression and functional roles of CCL2 (monocyte chemoattractant protein-1) and its high-affinity receptor, CCR2, in micturition reflex function and somatic sensitivity in rats with urinary bladder inflammation induced by cyclophosphamide (CYP) treatment of varying duration (4 h, 48 h, chronic). Real-time quantitative RT-PCR, ELISAs, and immunohistochemistry demonstrated significant (P ≤ 0.01) increases in CCL2 and CCR2 expression in the urothelium and in Fast Blue-labeled bladder afferent neurons in lumbosacral dorsal root ganglia with CYP-induced cystitis. Intravesical infusion of RS504393 (5 μM), a specific CCR2 antagonist, reduced voiding frequency and increased bladder capacity and void volume in rats with CYP-induced cystitis (4 h), as determined with open outlet, conscious cystometry. In addition, CCR2 blockade, at the level of the urinary bladder, reduced referred somatic sensitivity of the hindpaw and pelvic region in rats with CYP treatment, as determined with von Frey filament testing. We provide evidence of functional roles for CCL2/CCR2 signaling at the level of the urinary bladder in reducing voiding frequency and somatic sensitivity following CYP-induced cystitis (4 h). These studies suggest that chemokines/receptors may be novel targets with therapeutic potential in the context of urinary bladder inflammation.

Keywords: chemokine/receptor signaling, conscious cystometry, von Frey filaments, urothelium


bladder pain syndrome (bps)/Interstitial Cystitis (IC) is a chronic pain syndrome characterized by pain, pressure, or discomfort perceived to be bladder-related with at least one urinary symptom (28, 29). Although the etiology and pathogenesis of BPS/IC are unknown, numerous theories, including infection, inflammation, autoimmune disorder, toxic urinary agents, urothelial dysfunction and neurogenic causes have been proposed (22, 34, 50, 54, 55). We have hypothesized that pain associated with BPS/IC involves an alteration of visceral sensation/bladder sensory physiology. BPS/IC patients have a lower threshold for sensing bladder volume and often experience pain at normal bladder volumes, suggesting altered sensory processing within the urinary tract and/or its innervation (24, 48). The majority of biopsies from BPS/IC patients reveal some degree of inflammation; therefore; inflammatory mediators, including, but not limited to, chemokines, may contribute to inflammation-induced changes, such as urinary bladder sensory dysfunction (55).

Chemokines, chemotactic cytokines, have well-established roles in the innate immune system, and they are also emerging as nociceptive mediators and contributors to neuron-glia communication (47, 52, 56, 75). Under physiological conditions, neuronal chemokine expression is limited; however, following mechanical injury or inflammation, chemokine expression increases in multiple cell types, including neurons, glia, macrophages, T-cells, and urothelium (8, 9, 43, 52, 65, 69, 76). Specifically, numerous studies suggest a role for the chemokine, CCL2 (monocyte chemoattractant protein-1, MCP), and its high-affinity receptor, chemokine (C-C motif) receptor 2 (CCR2), in hypersensitivity following neuronal inflammation or mechanical injury (1, 20, 25, 45, 51, 65, 67) in the central (i.e., spinal cord) and peripheral (i.e., dorsal root ganglia, DRG) nervous system. Blockade of CCR2 reduces established pain behaviors resulting from chronic nerve injury (20, 25, 51, 67) and exogenous application of CCL2, either centrally or peripherally, can elicit exaggerated sensory behavioral responses in rodents (20, 25, 51, 65, 67). In addition, CCR2-null mice fail to develop somatic sensitivity following partial sciatic nerve ligation (1), whereas mice with CCL2 overexpression in astrocytes develop exaggerated thermal hyperalgesia following complete Freund's adjuvant-induced inflammation (45).

Importantly, BPS/IC patients demonstrate increased serum expression of chemokines (53). Additionally, recent rodent studies, including those by the Vizzard laboratory, have demonstrated chemokine expression, regulation, and function in the urinary bladder following cyclophosphamide (CYP)-induced bladder inflammation in rats (5, 79). CYP induces increased voiding frequency and somatic sensitization (15, 27, 59), and it is associated with neurochemical (70, 71, 73, 83), organizational (71, 74), and electrophysiological (33, 78) plasticity within the urinary bladder, bladder afferent neurons in lumbosacral DRG, and central micturition pathways. Potential mediators of urinary bladder inflammation and subsequent urinary bladder dysfunction and referred somatic sensitivity are numerous and include chemokines (5, 53, 68), cytokines (23, 41, 44), neuropeptides (14, 70), neuroactive compounds (13), and growth factors (72, 77, 82).

This study addresses the contribution of CCL2/CCR2 interactions in rat micturition reflexes and somatic (e.g., hindpaw, pelvic) sensitivity during control (no inflammation) or CYP-induced inflammation. We determined 1) expression of CCL2 and CCR2 in the urinary bladder and bladder primary afferents using immunohistochemistry, quantitative PCR (qRT-PCR), and ELISAs with CYP-induced cystitis of varying duration; and 2) the effects of CCR2 blockade with a highly selective CCR2 chemokine receptor antagonist, RS504393, on micturition reflex activity and somatic sensitivity in both CYP-treated and control (no inflammation) rats using conscious cystometry and von Frey filament sensitivity testing, respectively.

MATERIALS AND METHODS

Animals

Adult female Wistar rats (150–250 g), purchased from Charles River Canada (St. Constant, PQ, Canada), were housed two per cage and maintained in standard laboratory conditions with free access to food and water. All experimental protocols involving animal use were approved by the University of Vermont Institutional Animal Care and Use Committee (IACUC no. 08-085). Animal care was under the supervision of the University of Vermont's Office of Animal Care Management, in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care and National Institutes of Health guidelines. All efforts were made to minimize the potential for animal pain, stress, or distress.

CYP-Induced Cystitis in Female Rats

Rats were anesthetized with isoflurane (2%) and received intraperitoneal injection(s) of CYP (Sigma Aldrich, St. Louis, MO) to produce urinary bladder inflammation. To induce chronic bladder inflammation, CYP was injected (75 mg/kg ip) every third day for 8 days with euthanasia occurring on the 8th day (5, 19, 38). To induce acute bladder inflammation, CYP was injected (150 mg/kg ip) with euthanasia occurring 4 or 48 h after injection (5, 19, 38). Control rats received no treatment. For conscious cystometry studies, rats received CYP, as described with bladder function testing occurring 4 h after injection.

CCL2 and CCR2 Transcript Expression in Urinary Bladder: qRT-PCR

Bladders (n = 5 or 6 rats per group) were harvested, and the urothelium was separated from the detrusor. The bladder was cut open along the midline and pinned to a silicon-coated plate (Sylgard, Dow Corning, Midland, MI), the urothelium was removed with the aid of fine forceps and a dissecting microscope, and all tissues were snap-frozen on dry ice before processing, as previously described. Thus dissected, the urothelium also includes suburothelial structures; the term “urothelium” in this article refers to both urothelial and suburothelial structures. Total RNA was extracted using the STAT-60 total RNA/mRNA isolation reagent (Tel-Test “B”; Friendswood, TX), as previously described (5, 26). One to 2 μg of RNA per sample were used to synthesize cDNA using SuperScript II reverse transcriptase and random hexamer primers with the SuperScript II Preamplification System (Invitrogen, Carlsbad, CA) in a 20-μl final reaction volume. Amplification of cDNA was performed using oligonucleotide primers specific for CCL2, CCR2, or 18S (Table 1).

Table 1.

Primer sequences

Name Sequence
CCL2 Upper: AGCCAACTCTCACTGAAGC
CCL2 Lower: GTGAATGAGTAGCAGCAGGT
CCR2 Upper: CACCGTATGACTATGATGATG
CCR2 Lower: CAGGAGAGCAGGTCAGAGAT
18S Upper: AGTCGCCGTGCCTACCAT
18S Lower: GCCTGCTGCCTTCCTTG

The qRT-PCR standards for all transcripts were prepared with the amplified CCL2, CCR2, and 18S cDNA products ligated directly into pCR2.1 TOPO vector using the TOPO TA cloning kit (Invitrogen). The nucleotide sequences of the inserts were verified by automated fluorescent dideoxy dye terminator sequencing (Vermont Cancer Center DNA Analysis Facility). To estimate the relative expression of the receptor transcripts, 10-fold serial dilutions of stock plasmids were prepared as quantitative standards. The range of standard concentrations was determined empirically.

Real-time qRT-PCR was performed using SYBR Green I detection (5, 26). cDNA templates, diluted 10-fold to minimize the inhibitory effects of the reverse transcription reaction components, were assayed using HotStart-IT SYBR Green qPCR Master Mix (USB, Cleveland, OH) containing 5 mM MgCl2, 0.4 mM dATP, dGTP, dCTP, and dTTP, HotStart-IT Taq DNA polymerase, and 300 nM of each primer in a final 25-μl reaction volume. The real-time qRT-PCR was performed on an Applied Biosystems 7500 fast real-time PCR system (Applied Biosystems, Foster City, CA) (5, 26) using the following standard conditions: 1) 94°C for 2 min; and 2) amplification over 40 cycles at 94°C for 15 s and 58–60°C depending on primer set for 30 s. The amplified product from these amplification parameters was subjected to SYBR Green I melting analysis by ramping the temperature of the reaction samples from 60 to 95°C. A single DNA melting profile was observed under these dissociation assay conditions, demonstrating amplification of a single unique product free of primer dimers or other anomalous products.

For data analyses, a standard curve was constructed by amplification of serially diluted plasmids containing the target sequence. Data were analyzed at the termination of each assay using the Sequence Detection Software version 1.3.1 (Applied Biosystems, Norwalk, CT). In standard assays, default baseline settings were selected. The increase in SYBR Green I fluorescence intensity (ΔRn) was plotted as a function of cycle number, and the threshold cycle was determined by the software as the amplification cycle at which the ΔRn first intersects the established baseline. All data are expressed as the relative quantity of the gene of interest normalized to the relative quantity of reference gene (18S). Control samples were set equal to 100%.

Preparation of Tissue Samples for ELISAs

Rats from all experimental groups (control, 4 h, 48 h, and chronic; n = 6–8) were euthanized with isoflurane (4%), a thoracotomy was performed, and the urinary bladder was harvested. Individual bladders were immediately weighed and solubilized in tissue protein extraction agent (T-PER; Roche, Indianapolis, IN), a mild zwitterionic dialyzable detergent in 25 mM bicine, 150 mM sodium chloride (pH 7.6), supplemented with a protease inhibitor mix (16 μg/ml benzamidine, 2 μg/ml leupeptin, 50 μg/ml lima bean trypsin inhibitor, and 2 μg/ml pepstatin A, Sigma-Aldrich), and aliquots were removed for protein assays (5, 79). Tissue was homogenized using a Polytron homogenizer, centrifuged (10,000 rpm for 10 min), and the resulting supernatant was used for CCL2 protein quantification. Total protein was determined using the Coomassie Plus protein assay reagent kit (Thermo Fischer Scientific, Rockford, IL). CCL2 was quantified using standard 96-well ELISA plates (R&D Systems, Minneapolis, MN), according to the manufacturer's recommendations.

ELISAs for CCL2 in Urinary Bladder

Microtiter plates (R&D Systems) were coated with anti-CCL2 antibody. Sample and standard solutions were run in duplicate. Horseradish peroxidase-streptavidin conjugate was used to detect the antibody complex. Tetramethylbenzidine was the substrate, and the enzyme activity was measured by the change in optical density. The standards provided with these protocols generated a linear standard curve from 3.9–250 pg/ml (R2 = 0.998, P ≤ 0.0001) for samples. The absorbance values of standards and samples were corrected by the subtraction of the background value (absorbance resulting from nonspecific binding). Samples were not diluted, and no samples fell below the detection limits of the assays.

Immunohistochemical Localization of CCR2 in Cryostat Sections of Urinary Bladder from Control and CYP-Treated Rats

The bladders were rapidly dissected from control and CYP-treated rats (n = 16; 4 each group), placed in 4% paraformaldehyde followed by overnight incubation in 30% sucrose in 0.1 M PBS for cryoprotection. Tissue was frozen in optimal cutting temperature compound, sectioned (20 μm) on a freezing cryostat, and mounted directly onto gelled (0.5%) microscope slides (5, 19). Sections were incubated overnight at room temperature in rabbit anti-CCR2 (1:2,000; Aviva Systems Biology, San Diego, CA) diluted in 1% goat serum and 0.1 M phosphate buffer. After overnight incubation, sections were washed (3 × 10 min) with 0.1 M PBS (pH 7.4). Sections were then incubated with goat anti-rabbit Cy3-conjugated secondary antibody (1:500; Jackson ImmunoResearch Laboratories, West Grove, PA) for 2 h at room temperature followed by washes (3 × 10 min) with PBS and coverslipping with antifade medium (Citifluor, Fisher Scientific, Pittsburgh, PA). Immunohistochemical controls included incubation of tissue sections with 1% goat serum and 0.1 M phosphate buffer alone (no primary antibody) or rabbit isotype control (1:500; Cell Signaling Technology, Danvers, MA), followed by normal washing and incubation with secondary antibodies to evaluate background staining levels. In the absence of primary antibody or in the presence of the isotype control, no positive immunostaining above background levels was observed. Control tissues that were incubated in the absence of secondary antibody were also processed and evaluated for specificity or background staining levels. In the absence of secondary antibody, no positive immunostaining was observed. Finally, immunoabsorptions with CCR2 peptide (5 μg/ml; Aviva Systems Biology) and antisera in urinary bladder sections resulted in no staining above background (data not shown).

Visualization and Semiquantitative Analyses of CCR2 in Urothelium and Detrusor Smooth Muscle

CCR2-immunoreactivity (IR) in bladder sections was visualized, and images were captured using an Olympus fluorescence photomicroscope (Optical Analysis, Nashua, NH). The filter was set to an excitation range of 560–569 nm and an emission range of 610–655 nm for visualization of Cy3. Images were captured, acquired in tagged image file format (TIFF), and imported into image analysis software (MetaMorph, version 4.5r4; University Imaging, Downingtown, PA) (5, 19). The free-hand drawing tool was used to select the urothelium, and the urothelium was measured in total pixels area (5, 19). To evaluate staining in the detrusor smooth muscle, being careful to avoid nondetrusor structures (e.g., blood vessels, inflammatory cells), a rectangle of fixed dimension (125 × 125 pixels) was placed on the section according to random x and y coordinates. This process was repeated 5 times for each image without overlap (6, 40). A threshold encompassing an intensity range of 100–250 grayscale values was applied to the region of interest in the least brightly stained condition first. The threshold was adjusted for each experimental series using concomitantly processed negative controls as a guide for setting background fluorescence. The same threshold was subsequently used for all images. Immunoreactivity was considered to be positive only when the staining for CCR2 exceeded the established threshold. Percent CCR2-IR above threshold in the total area selected was calculated. For the detrusor smooth muscle, the percent CCR2-IR above threshold was calculated by averaging the data collected from all rectangles placed on the image (6, 40).

Assessment of Immunohistochemical Staining in Urinary Bladder Regions

Immunohistochemistry and subsequent evaluation of CCR2-IR in bladder sections or whole mount preparations were performed on control and experimental tissues simultaneously to reduce the incidence of staining variation that can occur between tissues processed on different days. Staining in experimental tissue was compared with that in experiment-matched negative controls. Urinary bladder sections or whole mounts exhibiting immunoreactivity that was greater than background level in experiment-matched negative controls were considered positively stained.

Immunohistochemical Localization of CCR2 in Suburothelial Nerve Plexus in Urinary Bladder Whole Mounts

The urinary bladder was dissected rapidly and placed into oxygenated (95% O2 and 5% CO2) physiological saline solution (119.0 mmol NaCl, 4.7 mmol KCl, 24.0 mmol NaHCO3, 1.2 mmol KH2PO4, 1.2 mmol MgSO4·7H2O, 11.0 mmol glucose) (38, 79). Starting at the urethra, a midline incision was made through the bladder, and then it was pinned flat onto a silicon-coated plate (Sylgard, Dow Corning, Midland, MI), maximally stretched, and then fixed in 2% paraformaldehyde + 0.2% picric acid for 1.5 h. After fixation, the urothelium was separated from the detrusor layer using fine-tip forceps, iris scissors, and a dissecting microscope, as previously described (38, 79). Notches were made in the region of the bladder neck to track orientation and assess regional immunoreactivity of the bladder. Urothelium and bladder musculature were processed for CCR2-IR, as described above. In some whole mount preparations processed for CCR2-IR, nerve fibers in the suburothelial nerve plexus were also stained with the pan-neuronal marker protein gene product (PGP9.5, 1: 3,000; AbD Serotec, Raleigh, NC) to determine potential expression of CCR2 in suburothelial nerve fibers and visualized with Cy2-conjugated species-specific secondary antibodies (1:200; Jackson ImmunoResearch Laboratories).

Visualization of CCR2-IR in Suburothelial Plexus in Bladder Whole Mounts

Whole mount tissues from control and experimental groups (n = 4 for control and CYP treatment groups) were examined using an Olympus fluorescence photomicroscope (Optical Analysis) with a multiband filter set for simultaneous visualization of the Cy3 and Cy2 fluorophores. Cy2 was viewed using a filter with an excitation range of 447–501 nm and an emission range from 510 to 540 nm.

Retrograde Labeling of Bladder Afferent Neurons in Lumbosacral DRG

Five to seven days prior to CYP injection or no treatment, Fast Blue (FB; 4%, wt/vol; Polyol, Gross-Umstadt, Germany) was injected into the bladder to retrogradely label bladder afferent neurons in lumbosacral (L1, L2, L6, S1) DRG in control (n = 5) and 4 h CYP-treated (n = 7) rats. As previously described (18, 39), a total volume of 40 μl divided into six to eight injections was injected into the dorsal surface of the bladder wall with particular care to avoid injections into the bladder lumen, major blood vessels, or overlying fascial layers. At each injection site, the needle was kept in place for several seconds after injection, and the site was washed with saline to minimize contamination of adjacent organs with FB. The 4 h CYP treatment group was selected for analysis of CCR2 expression in FB-labeled (presumptive bladder) afferent neurons and to determine the bladder function effects of pharmacological blockade of CCR2 in cystometry experiments (described below) because CCR2 transcript and protein was significantly increased in whole urinary bladder with acute (4 h) bladder inflammation. Furthermore, longer duration of CYP treatment did not result in additional increases in expression.

Immunohistochemical Localization of CCR2 in Lumbosacral Dorsal Root Ganglia

In control situations and after CYP treatment (4 h) (n = 5–7), animals were deeply anesthetized with isoflurane (3–4%) and then euthanized via thoracotomy. The lumbosacral DRG were quickly removed and postfixed in 4% paraformaldehyde for 12 h. Tissue was then placed overnight in sucrose (30%) in 0.1 M PBS for cryoprotection. DRG were identified on the basis of at least two criteria: 1) the T13 DRG are present after the last rib and 2) the L6 vertebra was the last moveable vertebra followed by the fused sacral vertebrae (18, 39). Another less precise criterion is the observation that the L6 DRG are the smallest ganglia following the largest DRG, L5 (18, 39). DRG (L1, L2, L5-S1) were sectioned parasagittally at a thickness of 20 μm on a cryostat. Some DRG (L1, L2, L6, S1) were specifically chosen for analysis based upon the previously determined segmental representation of urinary bladder circuitry. The L5 DRG were used as internal controls because bladder afferents are not distributed within the L4-L5 DRG that contain only somatic afferents. Tissues from control animals (no CYP treatment) were handled in an identical manner to that described.

CCR2-Immunoreactivity in DRG

DRG sections from both control and 4 h CYP-treated rats were processed for CCR2-immunoreactivity (IR) using an on-slide processing technique using methodology described above with some minor modifications. Tissues from control and experimental animals were processed simultaneously to decrease the possible incidence of variation in staining and background between tissues and between animals. DRG sections were incubated overnight at room temperature with rabbit polyclonal anti-CCR2 antibody (1:1,000; Aviva Systems Biology) in 1% goat serum and 0.1 M KPBS (phosphate buffer solution with potassium), and then washed (3×15 min) with 0.1 M KPBS, pH 7.4. Tissue was then incubated with Cy3-conjugated goat anti-rabbit IgG (1:500; Jackson ImmunoResearch) for 2 h at room temperature. After several rinses with 0.1 M KPBS, tissues were mounted on slides and coverslipped with Citifluor (Citifluor, London, UK). Methodological and procedural controls, as well as immunoabsorptions involving DRG tissues, were performed as described above. In the absence of primary antibody or in the presence of the isotype control, no positive immunostaining that was above background levels was observed. Immunoabsorptions with CCR2 peptide (5 μg/ml; Aviva Systems Biology) and antisera in DRG sections resulted in no staining above background (data not shown). Repeated attempts to localize CCL2-IR in cryostat bladder and DRG sections and in urinary bladder whole mount preparations with several different antibodies and substantial trouble-shooting were not successful. Thus, data are not presented for immunohistochemical localization of CCL2-IR in urinary bladder or DRG.

Data Analysis of CCR2- and FB-Labeled DRG

Tissues were examined under an Olympus fluorescence photomicroscope for visualization of Cy3 and FB. Cy3 was visualized with a filter with an excitation range of 560–596 nm and an emission range of 610–655 nm. In DRG from control and 4 h CYP-treated rats, CCR2-immunoreactive cell profiles were counted in 6–8 sections of each selected DRG (L1, L2, L5-S1) (18, 39). Only cell profiles with a nucleus were quantified in a blinded fashion (18, 39). DRG sections with FB-labeled cells were viewed with a filter with an excitation wavelength of 340–380 nm and an emission wavelength of 420 nm. Cells labeled with FB and expressing CCR2-IR were similarly counted. Numbers of CCR2-immunoreactive cell profiles per DRG section are presented (means ± SE). The percentage of presumptive bladder afferent cells (FB-labeled) expressing CCR2-IR in each DRG examined is also presented (means ± SE). The results are not corrected for double counting.

Intravesical Catheter Implant

A lower midline abdominal incision was performed under general anesthesia with 2–3% isoflurane using aseptic surgical techniques (5, 6, 15, 31, 40). The end of polyethylene tubing (PE-50; Clay Adams, Parsippany, NJ) was flared with heat, inserted into the dome of the bladder, and secured in place with a 6–0 nylon purse-string suture (5, 6, 15, 31, 40). The distal end of the tubing was sealed and tunneled subcutaneously to the back of the neck where it was externalized, out of the animal's reach (5, 6, 15, 31, 40). Rats received buprenorphine (0.05 mg/kg sc) starting at the time of surgery and then every 8–12 h postoperatively for a total of four doses. Animals were maintained for 96 h after surgery before conscious cystometry was initiated to ensure complete recovery and clearance of postoperative analgesics.

Open Voiding, Conscious Cystometry With Continuous Intravesical Infusion of Saline and CCR2 Antagonist

The effects of CCR2 receptor blockade on bladder function in control (no inflammation; n = 6) and CYP-treated rats (4 h; n = 6) were evaluated with intravesical infusion of RS504393 (5 μM; Tocris, Bristol, United Kingdom), a highly specific CCR2 receptor antagonist. Unrestrained and conscious rats were placed in a recording cage over a scale and pan to collect and measure voided urine. To elicit repetitive bladder contractions using conscious cystometry, continuous intravesical infusion of room temperature saline was infused at a constant rate (10 ml/h). At least six reproducible micturition cycles were recorded after an initial stabilization period (15–30 min). Intravesical pressure changes were recorded using a Small Animal Cystometry System (Med Associates, St. Albans, VT) (5, 6, 15, 19, 40). Filling pressure, pressure threshold for voiding, maximal voiding pressure, and intercontraction interval were evaluated. Nonvoiding bladder contractions (NVCs), defined as rhythmic intravesical pressure increases 7 cm H2O above baseline without the release of fluid from the urethra, were also determined per voiding cycle. Bladder capacity was measured as the amount of saline infused into the bladder at the time when micturition commenced (12, 30).

To evaluate the effects of CCR2 blockade on bladder function, rats were anesthetized (1–2% isoflurane) and saline or RS504393 (5 μM), a highly specific CCR2 receptor antagonist (7, 37, 81), was intravesically infused for 30 min. Prior to intravesical drug infusion, the bladder was manually emptied using the Credé maneuver. Bladders were then infused with ∼300 μl-1 ml (a volume less than bladder capacity to not elicit a bladder contraction and expulsion of instillate) of vehicle (1% DMSO in saline; Sigma-Aldrich), or RS504393 (5 μM), according to prior published studies (5, 6, 15, 40). Rats remained anesthetized (1–2% isoflurane) during infusion (30 min) to subdue the micturition reflex and prevent expulsion of drug from the bladder. To avoid potential variation resulting from circadian rhythms, experiments were conducted at similar times of the day (21). At the conclusion of the study, rats were euthanized as described above. Micturition function before and after vehicle or RS504393 intravesical instillation was evaluated in the same rats (control and 4-h CYP-induced cystitis). A variety of routes of administration and concentrations of RS504393 have been used in diverse applications (7, 37, 81). Thus, the concentration used in the present study was based on published studies (7, 37, 81) but was also determined empirically in pilot studies. In pilot studies, a range of RS504393 concentrations (1, 5, and 10 μM) were evaluated. The lowest concentration evaluated was without effect; 5 μM produced effects described in the current study, and 10 μM RS504393 produced results comparable to but not greater than those observed with 5 μM. Thus, the effects of 5 μM RS504393 on bladder function and somatic sensitivity are presented in this study.

Mechanical Sensitivity Testing

Mechanical sensitivity testing was performed in separate groups (n = 8–10 each; hindpaw, pelvic region) of rats not used for bladder function determination. Referred (secondary) hyperalgesia and tactile allodynia were tested using calibrated von Frey hairs with forces of 0.1–4 g applied to the hindpaw or pelvic region. Rats were tested in individual Plexiglas chambers with a stainless-steel wire grid floor. Rats were acclimated to the chambers for a period of 2 h (15, 57). The von Frey hairs were applied in an up-down method for 1–3 s with an inter-stimulus interval of 15 s. For pelvic region stimulation, stimulation was confined to the lower abdominal area overlying the urinary bladder. Testing of the plantar region of the hindpaw and lower abdominal area was performed by perpendicular application of von Frey hairs to the indicated areas until the hair bent slightly. The following behaviors were considered positive responses to pelvic region stimulation: sharp retraction of the abdomen, jumping, or immediate licking or scratching of the pelvic area (15, 57). A positive response to hindpaw stimulation was sharp withdrawal of the paw or licking of the tested hindpaw (15, 57). Somatic sensitivity before and after vehicle or RS504393 intravesical instillation was evaluated in the same rats (control and 4 h CYP-induced cystitis). All somatic testing was performed in a blinded manner with respect to treatment. The groups were decoded after data analysis.

Exclusion Criteria

Rats were removed from the study when adverse events occurred that included: 20% reduction in body weight postsurgery, a significant postoperative event, lethargy, pain, or distress not relieved by our IACUC-approved regimen of postoperative analgesics or hematuria in control rodents (5, 6, 15, 19, 40). In the present study, no rats were excluded from the study or from analysis due to any of these exclusion criteria. In addition, behavioral movements, such as grooming, standing, walking, and defecation rendered bladder pressure recordings unusable during these events.

Materials

RS504393 was prepared as a stock solution in DMSO, aliquoted and stored at −20°C until use. Aliquots were diluted with saline to achieve final concentration.

Figure Preparation

Digital images were obtained using a charge-coupled device camera (MagnaFire SP, Optronics; Optical Analysis, Nashua, NH) and LG-3 frame grabber attached to an Olympus fluorescence photomicroscope (Optical Analysis). Exposure times were held constant when acquiring images from control and CYP-treated groups processed and analyzed on the same day. Images were imported into a graphics-editing program (Adobe Photoshop, version 8.0, Adobe Systems, San Jose, CA) where groups of images were assembled and labeled.

Statistical Analyses

All values represent means ± SE. Data were compared with ANOVA. Percentage data were arcsine transformed to meet the requirements of this statistical test. Cystometry data were compared using repeated-measures ANOVA, where each animal served as its own control. Animals, processed and analyzed on the same day, were tested as a block in the ANOVA. When F ratios exceeded the critical value (P ≤ 0.05), the Newman-Keul's or Dunnett's post hoc tests were used to compare group means.

RESULTS

CCL2 Protein Expression in the Whole Urinary Bladder with CYP-Induced Cystitis

CCL2 protein expression in the whole urinary bladder increased significantly (P ≤ 0.01) compared with control urinary bladders (no CYP) with all durations of CYP treatment evaluated as determined with ELISAs (Fig. 1). CCL2 expression in the urinary bladder was greatest (9.5-fold) with 4 h of CYP treatment. With 4 h of CYP treatment, CCL2 expression in urinary bladder was significantly (P ≤ 0.01) greater than that with 48 h or chronic CYP treatment. CCL2 protein expression with 48 h of CYP treatment was significantly (P ≤ 0.01) greater than protein expression with chronic CYP treatment (Fig. 1).

Fig. 1.

Fig. 1.

CCL2 protein expression is increased in whole urinary bladders following cyclophosphamide (CYP) treatment of varying duration, as determined with ELISAs. CCL2 protein expression increased significantly (*P ≤ 0.01) with each time point examined compared with control urinary bladders (no CYP). Sample sizes are n = 6–8 for each group.

CCL2 and CCR2 mRNA Transcript Levels With and Without CYP-Induced Cystitis

Real-time qRT-PCR experiments demonstrated significant increases (P ≤ 0.01) in CCL2 mRNA transcript expression in both the urothelium and detrusor smooth muscle with acute (4 h) and intermediate (48 h) CYP treatment, but not chronic CYP-induced bladder inflammation (Fig. 2A). Increases in CCL2 mRNA levels in urothelium and detrusor were most robust with 4 h of CYP treatment, and these levels were significantly (P ≤ 0.01) higher than those detected with 48 h of CYP treatment (Fig. 2A). CCL2 mRNA expression in urothelium and detrusor returned to control expression with chronic CYP treatment.

Fig. 2.

Fig. 2.

CCL2 and CCR2 mRNA transcript expression is increased in urothelium and detrusor smooth muscle following CYP treatment of varying duration as determined by quantitative PCR (qRT-PCR). A: CCL2 mRNA levels increased significantly (*P ≤ 0.01) with 4 h and 48 h CYP treatment in both the urothelium and detrusor smooth muscle. CCL2 mRNA levels with 4-h CYP treatment were significantly (*P ≤ 0.01) higher than those detected at the 48-h time point. B: CCR2 mRNA levels were significantly (*P ≤ 0.01) increased in the urothelium with 4 h of CYP treatment, and these levels were significantly (*P ≤ 0.01) higher than those detected at the 48 h and chronic time points. In the detrusor smooth muscle, CCR2 mRNA levels increased significantly with 4 h and 48 h CYP treatment. Sample sizes are n = 5 or 6 for each group.

CCR2 mRNA transcript expression also significantly (P < 0.01) increased in the urothelium and detrusor with acute (4 h) and intermediate (48 h) CYP treatment. CCR2 mRNA expression increased significantly (P ≤ 0.01) in the urothelium with 4 h of CYP treatment only, whereas CCR2 mRNA levels increased significantly (P ≤ 0.01) in the detrusor with both 4 h and 48 h CYP treatment (Fig. 2B). CCR2 mRNA expression in urothelium and detrusor returned to control levels with chronic CYP treatment.

CCR2- IR in Urinary Bladder With Acute (4 h) CYP-Induced Cystitis

Low expression of CCR2-IR was present in the urothelium of control bladders (no CYP treatment) (Fig. 3, A and C). CCR2-IR increased significantly (P ≤ 0.01) in the urothelium in all layers (basal, intermediate, apical) with 4 h of CYP treatment in both cryostat urinary bladder sections (Fig. 3, B, E, and F) and whole mount preparations (Fig. 3D). Low expression of CCR2-IR was also present in the detrusor smooth muscle of control rats, but expression was not altered with CYP treatment of any duration examined (4 h, 48 h, chronic) (data not shown). CCR2-IR was not observed in whole mount preparations of the suburothelial nerve plexus in control or CYP-treated rats (data not shown).

Fig. 3.

Fig. 3.

CCR2-immunoreactivity (IR) is increased in the urothelium (U) of bladders with 4 h of CYP treatment. Epifluorescence images of cryostat sections from control (no CYP; A) and 4-h treated urinary bladders (B). Epifluorescence images of whole mounts from control (C) and 4-h CYP-treated urinary bladders (D). E: higher power image of a cryostat section from a 4-h CYP-treated urinary bladder. F: summary histogram of CCR2-IR in the urothelium of urinary bladders from control and CYP-treated rats. Sample sizes are n = 4 in each group. *P ≤ 0.01. Calibration bar represents 120 μm in A, B and 30 μm in C–E. L, lumen; lp, lamina propria.

CCR2-Immunoreactivity (IR) Is Increased in Lumbosacral DRG Cells With 4-h CYP-Induced Cystitis

CCR2 expression was observed in the cytoplasm of DRG cells in all levels examined (L1-L2; L5-S1) and the number of DRG cells exhibiting CCR2-IR was similar (8–15 cells/section) across DRG levels examined (Fig. 4A). The number of cells that expressed CCR2-IR (Fig. 4A) increased (17–45 cells/section) significantly (P ≤ 0.01) in L1, L2, L6, and S1 DRG examined after 4 h CYP. CCR2 expression was significantly (P ≤ 0.01) greater in L6 DRG with 4 h CYP treatment compared with L1 or L2 DRG with 4 h CYP treatment (Fig. 4A). CCR2-IR was observed primarily in small-diameter DRG cells (19.6 ± 2.4 μm), but some larger DRG cells (24.3 ± 3.2 μm) also exhibited CCR2-IR. No changes in CCR2-IR were observed in L5 DRG (Fig. 4A).

Fig. 4.

Fig. 4.

CCR2-immunoreactivity (IR) in DRG cells, including bladder afferent cells and is increased after CYP-induced cystitis. A: summary histogram of numbers of dorsal root ganglion (DRG) cells that exhibit CCR2-IR under control conditions (n = 5) and after induction of 4 h CYP-induced cystitis (n = 7). B: summary histogram of the percentage of bladder afferent cells expressing CCR2-IR in control and 4-h CYP-treated rats. CYP-induced cystitis increases the number of CCR2-IR cells in lumbosacral DRG and the percentage of bladder afferent cells expressing CCR2-IR following 4 h CYP-induced cystitis. C1: L1 DRG section from 4-h CYP-treated rat, demonstrating CCR2-immunoreactive cells (white arrows). C2: bladder afferent cells [Fast Blue (FB)-labeled] in same section (C1) demonstrating bladder afferent cells with CCR2-IR (white arrows). D1: L6 DRG section from 4-h CYP-treated rat, demonstrating CCR2-immunoreactive cells (white arrows). D2: bladder afferent cells (FB-labeled) in same section (D1) demonstrating bladder afferent cells with CCR2-IR (white arrows). White arrows indicate some examples of bladder afferent cells that exhibit CCR2-IR (C1, C2, D1, D2). Sample sizes are n = 5–7; *P ≤ 0.01. Calibration bar represents 35 μm.

CCR2-IR in Fast Blue-Labeled Bladder Afferent Cells

To determine whether CCR2-IR was expressed in bladder afferent cells in DRG from control rats or from those treated with CYP (4 h), FB was injected into the urinary bladder to retrogradely label bladder afferent cells in the L1, L2, L6, and S1 DRG (Fig. 4, C and D). In control animals (Fig. 4B), 25.2–27.4% of bladder afferent cells expressed CCR2-IR in L1, L2, L6 and S1 DRG. After 4 h CYP (Fig. 4, B–D), there was a significant (P ≤ 0.01) increase in the percentage of bladder afferent cells that expressed CCR2-IR in L1 (70.2% ± 4.0) (Fig. 4C), L2 (69.2% ± 3.9), L6 (78.3% ± 12.2) (Fig. 4D), and S1 (75.3% ± 7.8) DRG. No differences were observed in the number of CCR2-IR cells in DRG examined between control and control with FB injection or between CYP-treated and CYP-treated with FB injection (data not shown).

CCR2 Receptor Blockade With Intravesical Infusion of RS504393 Using Conscious Cystometry in Rats With or Without CYP-Induced Cystitis (4 h)

Control (no inflammation).

Conscious cystometry was performed in control rats before intravesical infusion of RS504393 (5 μM), a CCR2 antagonist, to establish baseline voiding frequency, bladder capacity, and void volume (data not shown). Drug treatment with RS504393 did not change bladder capacity, as measured as the amount of saline infused in the bladder at the time when micturition commenced, void frequency or threshold, filling or peak micturition pressures (data not shown) in control rats. Intravesical infusion of vehicle in control rats was also without effect on the cystometric parameters evaluated.

4-h CYP treatment.

Conscious cystometry was performed in rats with 4-h CYP treatment before intravesical infusion of RS504393 to establish baseline voiding frequency, bladder capacity, and void volume associated with acute (4 h) CYP treatment (Fig. 5A). As previously demonstrated (5, 14, 15, 31, 71), CYP treatment (4 h) increased void frequency and decreased bladder capacity (3.4-fold), intercontraction interval (3.5-fold), and void volume (3.2-fold) compared with control rats (no CYP treatment). Following intravesical infusion of the CCR2 receptor antagonist, RS504393 (5 μM), the same CYP-treated rats exhibited decreased voiding frequency and significantly (P ≤ 0.01) increased bladder capacity (as measured as the amount of saline infused in the bladder at the time when micturition commenced), intercontraction interval, and void volume (Figs. 5B and 6, A and B). There were no changes in threshold, baseline, or maximum micturition pressures following intravesical instillation with the CCR2 receptor infusion in 4-h CYP-treated rats (Fig. 6C). Intravesical infusion of vehicle in CYP-treated rats was also without effect on the cystometric parameters evaluated, consistent with previous studies (6, 40). NVCs (increases in baseline pressure with an amplitude ≥7 cmH2O without the expulsion of urine) were infrequently observed in the evaluated rats with CYP treatment. Therefore, any effects of the CCR2 receptor antagonist on NVCs were not evaluated.

Fig. 5.

Fig. 5.

Representative cystometrogram recordings using continuous intravesical infusion of saline in conscious rats with an open outlet from a CYP-treated (4 h) rat before and after intravesical CCR2 receptor blockade with RS504393 (5 μM). Bladder function before RS504393 instillation (A) and after RS504393 instillation (B) in a 4-h CYP-treated rat during continuous intravesical infusion of saline. Bladder function recordings in A and B are from the same rat. Infused volume (μl, top), bladder pressure (cm H2O, middle), and void volume (ml, bottom) prior to (A) and after (B) RS504393 treatment are shown.

Fig. 6.

Fig. 6.

Summary histograms of the effects of intravesical RS504393 treatment on intercontraction interval (s), infused volume (μl), and void volume (ml) in CYP-treated (4 h) rats. Intravesical instillation of RS significantly increased intercontraction interval (A), infused volume (B), and void volume (C) in CYP-treated (4 h) rats compared with before intravesical RS504393 instillation. *P ≤ 0.01. Sample sizes are n = 6 in each group. ICI, intercontraction interval; BP, bladder pressure.

Hindpaw and Pelvic Somatic Sensitivity With CYP-Induced Cystitis and Effects of CCR2 Antagonist, RS504393

Somatic sensitivity in the hindpaw was significantly (P ≤ 0.01) increased with the monofilament forces tested (0.1 to 4 g) following 4 h of CYP treatment compared with control rats (Fig. 7A), as previously described (15). Similarly, pelvic somatic sensitivity was also significantly (P ≤ 0.01) increased following 4-h CYP treatment at all monofilament forces evaluated (0.1 to 4 g) (Fig. 7B). Intravesical infusion of RS504393 (5 μM) significantly (P ≤ 0.01) decreased the somatic sensitivity in the hindpaw (Fig. 7A) and pelvic region (Fig. 7B) in rats with CYP-induced cystitis (4 h). Intravesical infusion of RS504393 in control rats (no CYP treatment) produced no change in somatic sensitivity in the hindpaw or pelvic region (data not shown).

Fig. 7.

Fig. 7.

Somatic sensitivity of hindpaw and pelvic region is increased with cyclophosphamide (CYP) treatment and reduced with intravesical instillation of RS504393. Somatic sensitivity testing of the hindpaw (A) and pelvic regions (B) with von Frey filaments in control (circles) rats, rats treated with cyclophosphamide (4 h; triangles) and rats treated with CYP (4 h), and intravesical instillation of a CCR2 receptor antagonist, RS504393 (squares). The von Frey filaments were applied in an up-down method for 1–3 s with an interstimulus interval of 15 s. A positive response to hindpaw stimulation was sharp withdrawal of the paw or licking of the tested hindpaw. For pelvic region stimulation, stimulation was confined to the lower abdominal area overlying the urinary bladder. The following behaviors were considered positive responses to pelvic region stimulation: sharp retraction of the abdomen, jumping, or immediate licking or scratching of the pelvic area. Rats treated acutely (4 h) with CYP had a significantly (*P ≤ 0.01) increased hindpaw response frequency (A) and pelvic response frequency (B) with all von Frey filaments (0.1–4 g) tested compared with control rats (no CYP + vehicle). Rats treated acutely (4 h) with CYP and intravesical infusion of RS504393 had a significantly (*P ≤ 0.01) reduced hindpaw response frequency (A) and pelvic response frequency (B) with all von Frey filaments (0.1–4 g) tested compared with CYP (4 h + vehicle). Hindpaw or pelvic sensitivity testing with calibrated von Frey filaments was determined in separate groups of rats. All somatic testing was performed in a blinded manner with respect to treatment. Sample sizes are n = 8–10; *P ≤ 0.01.

DISCUSSION

Models of neuropathic pain, neuronal injury, and tissue inflammation have demonstrated nociceptive roles for chemokine/receptor signaling, particularly for CCL2 and its high-affinity receptor, CCR2. The present studies demonstrate novel findings with respect to the contribution of CCL2/CCR2 interactions with bladder inflammation-induced changes in bladder function and somatic sensitivity in female rats. We demonstrate that CYP-induced cystitis increases: 1) CCL2 and CCR2 transcript and protein expression in the rat urinary bladder and 2) the number of bladder-associated CCR2-immunoreactive bladder afferent cells in the lumbosacral DRG. Blockade of CCR2 receptor interactions with the highly selective receptor antagonist RS504393 (5 μM) at the level of the urinary bladder, increased bladder capacity and decreased void frequency and reduced somatic sensitivity of the hindpaw and pelvic region following CYP treatment. Our laboratory and others have previously demonstrated chemokine/receptor expression (CX3CL1/CX3CR1; CXCL12/CXCR4) (5, 68, 79) and function (CXCL12/CXCR4) (5) associated with urinary bladder inflammation. These results extend previous findings (20, 65, 76, 80, 81) by demonstrating that CCL2/CCR2 interactions contribute to inflammation-induced bladder dysfunction and increased referred somatic sensitivity. These studies provide additional support for chemokines/receptors as potential lower urinary tract targets with therapeutic potential in the context of urinary bladder inflammation.

BPS/IC is viewed as one type of chronic pain syndrome characterized by pain, pressure, or discomfort perceived to be bladder related with at least one urinary symptom, such as urinary frequency (22, 32, 34, 49, 50, 55). We hypothesize that pain associated with BPS/IC involves alteration of visceral sensation/bladder sensory physiology. Altered visceral sensation from the bladder (i.e., pain at low or moderate bladder filling) that accompany BPS/IC may be mediated by many factors, including changes in the properties of peripheral bladder afferent pathways such that bladder afferent neurons respond in an exaggerated manner to normally innocuous stimuli (allodynia). These changes may be mediated, in part, by inflammatory changes in the bladder. Potential mediators of bladder inflammation are numerous and include chemokines (5, 53, 68, 79), cytokines (23, 41, 44), neuropeptides (14, 70), neuroactive compounds (13), and growth factors (72, 77, 82). Interestingly, elevated chemokine levels have been detected in the serum from patients with BPS/IC (53); therefore, further investigation of chemokine/receptor signaling related to bladder dysfunction is warranted.

Our overall hypothesis is that inflammation-induced changes within the sensory limb (e.g., bladder afferent cells, urothelium) of the micturition reflex pathway can lead to bladder dysfunction. Changes within the afferent limb can occur at peripheral sites such as the urinary bladder and bladder-associated DRG neurons, as well as at central locations, including spinal cord and supraspinal regions. The present studies provide evidence of functional roles for CCL2/CCR2 signaling at the level of the urinary bladder in reducing voiding frequency and somatic sensitivity following CYP-induced cystitis (4 h). Immunohistochemical experiments detected robust increases of CCR2-IR with CYP-induced cystitis (4 h) in the urothelium of urinary bladders and a relative increase in the overall percentage of CCR2-positive bladder-associated DRG neurons. CCR2 blockade in the urinary bladder with intravesical infusion of RS504393 (5 μM) reduced void frequency and increased bladder capacity and void volume in rats with CYP-induced cystitis (4 h). In addition, CCR2 blockade, at the level of the urinary bladder, reduced somatic sensitivity of the hindpaw and pelvic region in rats treated with CYP. CCL2/CCR2 is another chemokine/receptor pair (after CXCL12/CXCR4) now identified to have a functional contribution to urinary bladder function and referred somatic sensitivity during inflammation-induced bladder hyperreflexia.

CCL2/CCR2 interactions at the level of the urothelium and suburothelial nerve plexus in the urinary bladder are likely to contribute to bladder dysfunction and increased somatic sensitivity following CYP-induced cystitis. Intravesical instillation of RS504393 likely makes direct contact with the urothelium that expresses CCR2 and the increased urothelial permeability due to CYP treatment makes it likely that intravesical RS504393 also contacts suburothelial nerves. In the present study, we did not observe CCR2-IR in the suburothelial nerve plexus in whole mount preparations of the urinary bladder from control or CYP-treated rats, but basal as well as increased CCR2-IR was present in bladder afferent cell bodies in the L1, L2, L6, and S1 DRG. The reasons for the failure to demonstrate CCR2-IR in the peripheral terminals of bladder afferent cells are not known but may be a reflection of low expression in the terminals, difficulty in visualizing CCR2 expression in small structures or lack of distal transport. These results are consistent with previous studies examining different chemokine/receptor (CXCL12/CXCR4; CX3CL1/CX3CR1) expression in micturition reflex pathways with and without bladder inflammation (5, 79). Additionally, focal nerve demyelination induces a change in CCR2-IR in associated DRG, but neuronal CCL2-IR remained unchanged at the lesion site (8). CCL2/CCR2 interactions may influence nucleus-bound processes, such as inflammatory gene expression, more than peripheral branch processes, such as neurotransmitter release and/or excitability (36). Ex vivo studies examining the impact of chemokine/receptor activation and blockade on proinflammatory gene expression and neuronal excitability in DRG cells are necessary to clarify this point.

Recent evidence suggests that urothelial cells have “neuron-like” properties, including sensory, transduction, and signaling capabilities (2, 4, 10, 11, 61–64). Urothelial cells share a number of similarities with sensory neurons, including the expression of receptors, including purinergic, norepinephrine, acetylcholine, neuropeptide- and protease-activated receptors, acid-sensing ion channels, neurotrophin receptors, and transient receptor potential channels. Current and prior studies demonstrate chemokine receptor expression (2, 10, 11, 17, 46, 61–64). The current studies do not differentiate between direct urothelial or nerve-mediated CCR2 effects vs. indirect urothelial-mediated communication with the detrusor smooth muscle, suburothelial nerve plexus and/or interstitial cells as previously suggested (2, 10). It is possible that urothelial CCL2/CCR2 signaling facilitates the release of urothelial-derived mediators, such as ATP or nitric oxide, which may then influence underlying structures, such as the suburothelial nerve plexus and/or detrusor smooth muscle (2, 10, 11). These possibilities need further investigation.

Alternatively, or in addition to urothelial-mediated mechanisms, CCL2/CCR2 interactions in bladder-associated DRG neurons may contribute to inflammatory induced changes in bladder sensory physiology and function. Numerous studies suggest a role for the chemokines CCL2 and CCR2 in hypersensitivity following neuronal inflammation or injury (1, 20, 25, 45, 51, 65, 67) in the peripheral nervous system. In the present study, CYP treatment triggered a robust increase in the percentage of bladder afferent cell bodies expressing CCR2-IR. These results complement previous findings demonstrating an increase in the percentage of primary sensory afferent cells expressing CCL2 and/or CCR2 following focal nerve demyelination, sciatic nerve ligation, or chronic constriction injury (8, 36, 42, 65, 76, 80). Jung and Miller (35) demonstrate that depolarization of cultured sensory neurons is sufficient to induce CCR2 mRNA expression, suggesting that heightened sensory neuron activity during states of injury or inflammation may contribute to elevated levels of neuronal CCR2 expression. Increased receptor expression may explain why peripheral nerve damage or inflammation can also change the functional properties of sensory neuron populations, such that an increasing percentage of DRG neurons respond to CCL2 application or neurons respond with increased intracellular calcium ion currents and/or frequency of excitatory postsynaptic currents (8, 25, 42, 51, 60, 76). Therefore, it is possible that CCL2 released, in vivo, by DRG neurons, glial cells, and urothelial cells could contribute to nociceptive sensations/behaviors by autocrine or paracrine signaling mechanisms. Exogenous application of CCL2, either intrathecally or in peripheral tissues, or genetic overexpression of CCL2 elicits heightened sensory behaviors in rodents (20, 25, 45, 51, 65, 67). In contrast, CCR2 antagonists attenuate established pain behaviors following nerve injury, and CCR2-null mice fail to develop certain neuropathic pain behaviors after sciatic nerve ligation (1, 20, 25, 51, 67).

Blockade of chemokine/receptor signaling may represent a potential therapeutic target for inflammation-associated bladder dysfunction. In addition, the presence of certain chemokines and other inflammatory molecules in a patient's urine may be useful biomarkers for BPS/IC or other bladder dysfunction syndromes, such as overactive bladder (OAB). Similar to BPS/IC, the etiology of OAB remains elusive; however, on the basis of patient biopsies, an inflammatory contribution has been suggested (3, 16, 58). Tyagi et al. (66) detected a 10-fold increase of CCL2 and the soluble fraction of the CD40 ligand (CD40L) in the urine of OAB patients vs. controls. Various cytokines, epidermal growth factor, and the oncogene GRO-2 were also elevated (3–5-fold) in the urine of OAB patients (66). Whether certain chemokine/receptor interactions and downstream signaling pathways are redundant or unique across diverse bladder dysfunction or pelvic pain syndromes remains to be determined. Identification of urinary biomarkers in BPS/IC, OAB, or other bladder dysfunction would improve diagnostic strategies and reduce invasiveness to the patient, improving exclusionary criteria, reducing time to diagnosis and aid in patient selection for pharmacological trials.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Author contributions: L.A., B.M.G., S.E.M., and M.A.V. performed experiments; L.A., B.M.G., S.E.M., and M.A.V. analyzed data; L.A., B.M.G., and M.A.V. interpreted results of experiments; L.A., S.E.M., and M.A.V. prepared figures; L.A. and M.A.V. drafted manuscript; L.A., B.M.G., S.E.M., and M.A.V. edited and revised manuscript; L.A., B.M.G., S.E.M., and M.A.V. approved final version of manuscript; M.A.V. conception and design of research.

ACKNOWLEDGMENTS

The authors gratefully acknowledge the technical expertise of Kimberly Corrow and additional support provided by the Vermont Cancer Center DNA Analysis Facility. This work was funded by National Insitutes of Health (NIH) grants DK-051369, DK-060481, and DK-065989. NIH Grant P20 RR-16435 from the COBRE Program of the National Center also supported the project for Research Resources.

REFERENCES

  • 1. Abbadie C, Lindia JA, Cumiskey AM, Peterson LB, Mudgett JS, Bayne EK, DeMartino JA, MacIntyre DE, Forrest MJ. Impaired neuropathic pain responses in mice lacking the chemokine receptor CCR2. Proc Natl Acad Sci USA 100: 7947–7952, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Apodaca G, Balestreire E, Birder LA. The uroepithelial-associated sensory web. Kidney Int 72: 1057–1064, 2007 [DOI] [PubMed] [Google Scholar]
  • 3. Apostolidis A, Jacques TS, Freeman A, Kalsi V, Popat R, Gonzales G, Datta SN, Ghazi-Noori S, Elneil S, Dasgupta P, Fowler CJ. Histological changes in the urothelium and suburothelium of human overactive bladder following intradetrusor injections of botulinum neurotoxin type A for the treatment of neurogenic or idiopathic detrusor overactivity. Eur Urol 53: 1245–1253, 2008 [DOI] [PubMed] [Google Scholar]
  • 4. Arms LGB, Vizzard MA. Role of the bladder urothelium in voiding dysfunction. Curr Bladder Dysfunct Rep 4: 227–233, 2009 [Google Scholar]
  • 5. Arms L, Girard BM, Vizzard MA. Expression and function of CXCL12/CXCR4 in rat urinary bladder with cyclophosphamide-induced cystitis. Am J Physiol Renal Physiol 298: F589–F600, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Arms L, Vizzard MA. Role for pAKT in rat urinary bladder with cyclophosphamide (CYP)-induced cystitis. Am J Physiol Renal Physiol 301: F252–F262, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Awad AS, Kinsey GR, Khutsishvili K, Gao T, Bolton WK, Okusa MD. Monocyte/macrophage chemokine receptor CCR2 mediates diabetic renal injury. Am J Physiol Renal Physiol 301: F1358–F1366, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Bhangoo S, Ren D, Miller RJ, Henry KJ, Lineswala J, Hamdouchi C, Li B, Monahan PE, Chan DM, Ripsch MS, White FA. Delayed functional expression of neuronal chemokine receptors following focal nerve demyelination in the rat: a mechanism for the development of chronic sensitization of peripheral nociceptors. Mol Pain 3: 38, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Bhangoo SK, Ren D, Miller RJ, Chan DM, Ripsch MS, Weiss C, McGinnis C, White FA. CXCR4 chemokine receptor signaling mediates pain hypersensitivity in association with antiretroviral toxic neuropathy. Brain Behav Immun 21: 581–591, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Birder LA. Urinary bladder urothelium: molecular sensors of chemical/thermal/mechanical stimuli. Vasc Pharmacol 45: 221–226, 2006 [DOI] [PubMed] [Google Scholar]
  • 11. Birder LA, de Groat WC. Mechanisms of disease: involvement of the urothelium in bladder dysfunction. Nat Clin Pract 4: 46–54, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Birder LA, Nakamura Y, Kiss S, Nealen ML, Barrick S, Kanai AJ, Wang E, Ruiz G, De Groat WC, Apodaca G, Watkins S, Caterina MJ. Altered urinary bladder function in mice lacking the vanilloid receptor TRPV1. Nat Neurosci 5: 856–860, 2002 [DOI] [PubMed] [Google Scholar]
  • 13. Birder LA, Wolf-Johnston A, Buffington CA, Roppolo JR, de Groat WC, Kanai AJ. Altered inducible nitric oxide synthase expression and nitric oxide production in the bladder of cats with feline interstitial cystitis. J Urol 173: 625–629, 2005 [DOI] [PubMed] [Google Scholar]
  • 14. Braas KM, May V, Zvara P, Nausch B, Kliment J, Dunleavy JD, Nelson MT, Vizzard MA. Role for pituitary adenylate cyclase activating polypeptide in cystitis-induced plasticity of micturition reflexes. Am J Physiol Regul Integr Comp Physiol 290: R951–R962, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Cheppudira BP, Girard BM, Malley SE, Dattilio A, Schutz KC, May V, Vizzard MA. Involvement of JAK-STAT signaling/function after cyclophosphamide-induced bladder inflammation in female rats. Am J Physiol Renal Physiol 297: F1038–F1044, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Comperat E, Reitz A, Delcourt A, Capron F, Denys P, Chartier-Kastler E. Histologic features in the urinary bladder wall affected from neurogenic overactivity—a comparison of inflammation, oedema and fibrosis with and without injection of botulinum toxin type A. Eur Urol 50: 1058–1064, 2006 [DOI] [PubMed] [Google Scholar]
  • 17. Corrow K, Girard BM, Vizzard MA. Expression and response of acid-sensing ion channels in urinary bladder to cyclophosphamide-induced cystitis. Am J Physiol Renal Physiol 298: F1130–F1139, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Corrow KA, Vizzard MA. Phosphorylation of extracellular signal-regulated kinases in bladder afferent pathways with cyclophosphamide-induced cystitis. Neuroscience 163: 1353–1362, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Corrow KA, Vizzard MA. Phosphorylation of extracellular signal-regulated kinases in urinary bladder in rats with cyclophosphamide-induced cystitis. Am J Physiol Regul Integr Comp Physiol 293: R125–R134, 2007 [DOI] [PubMed] [Google Scholar]
  • 20. Dansereau MA, Gosselin RD, Pohl M, Pommier B, Mechighel P, Mauborgne A, Rostene W, Kitabgi P, Beaudet N, Sarret P, Melik-Parsadaniantz S. Spinal CCL2 pronociceptive action is no longer effective in CCR2 receptor antagonist-treated rats. J Neurochem 106: 757–769, 2008 [DOI] [PubMed] [Google Scholar]
  • 21. Dorr W. Cystometry in mice—influence of bladder filling rate and circadian variations in bladder compliance. J Urol 148: 183–187, 1992 [DOI] [PubMed] [Google Scholar]
  • 22. Driscoll A, Teichman JM. How do patients with interstitial cystitis present? J Urol 166: 2118–2120, 2001 [PubMed] [Google Scholar]
  • 23. Erickson DR, Xie SX, Bhavanandan VP, Wheeler MA, Hurst RE, Demers LM, Kushner L, Keay SK. A comparison of multiple urine markers for interstitial cystitis. J Urol 167: 2461–2469, 2002 [PubMed] [Google Scholar]
  • 24. Fitzgerald MP, Koch D, Senka J. Visceral and cutaneous sensory testing in patients with painful bladder syndrome. Neurourol Urodyn 24: 627–632, 2005 [DOI] [PubMed] [Google Scholar]
  • 25. Gao YJ, Zhang L, Samad OA, Suter MR, Yasuhiko K, Xu ZZ, Park JY, Lind AL, Ma Q, Ji RR. JNK-induced MCP-1 production in spinal cord astrocytes contributes to central sensitization and neuropathic pain. J Neurosci 29: 4096–4108, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Girard BM, Malley SE, Vizzard MA. Neurotrophin/receptor expression in urinary bladder of mice with overexpression of NGF in urothelium. Am J Physiol Renal Physiol 300: F345–F355, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Guerios SD, Wang ZY, Boldon K, Bushman W, Bjorling DE. Blockade of NGF and trk receptors inhibits increased peripheral mechanical sensitivity accompanying cystitis in rats. Am J Physiol Regul Integr Comp Physiol 295: R111–R122, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Hanno P, Lin A, Nordling J, Nyberg L, van Ophoven A, Ueda T, Wein A. Bladder Pain Syndrome Committee of the International Consultation on Incontinence. Neurourol Urodyn 29: 191–198, 2010 [DOI] [PubMed] [Google Scholar]
  • 29. Hanno P, Nordling J, Fall M. Bladder pain syndrome. Med Clin North Am 95: 55–73, 2011 [DOI] [PubMed] [Google Scholar]
  • 30. Herrera GM, Pozo MJ, Zvara P, Petkov GV, Bond CT, Adelman JP, Nelson MT. Urinary bladder instability induced by selective suppression of the murine small conductance calcium-activated potassium (SK3) channel. J Physiol 551: 893–903, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Hu VY, Zvara P, Dattilio A, Redman TL, Allen SJ, Dawbarn D, Stroemer RP, Vizzard MA. Decrease in bladder overactivity with REN1820 in rats with cyclophosphamide induced cystitis. J Urol 173: 1016–1021, 2005 [DOI] [PubMed] [Google Scholar]
  • 32. Hurst RE, Moldwin RM, Mulholland SG. Bladder defense molecules, urothelial differentiation, urinary biomarkers, and interstitial cystitis. Urology 69: 17–23, 2007 [DOI] [PubMed] [Google Scholar]
  • 33. Jennings L, Vizzard MA. Cyclophosphamide-induced inflammation of the urinary bladder alters electrical properties of small-diameter afferent neurons from dorsal root ganglia. FASEB J 13: A57, 1999 [Google Scholar]
  • 34. Johansson S, Ogawa K, Fall M. Interstitial cystitis. In: The Pathology of Interstitial Cystitis, edited by Sant GR. Philadelphia, PA: Lippincott-Raven, 1997, p. 143–152 [Google Scholar]
  • 35. Jung H, Miller RJ. Activation of the nuclear factor of activated T-cells (NFAT) mediates upregulation of CCR2 chemokine receptors in dorsal root ganglion (DRG) neurons: a possible mechanism for activity-dependent transcription in DRG neurons in association with neuropathic pain. Mol Cell Neurosci 37: 170–177, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Jung H, Toth PT, White FA, Miller RJ. Monocyte chemoattractant protein-1 functions as a neuromodulator in dorsal root ganglia neurons. J Neurochem 104: 254–263, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Kang YS, Lee MH, Song HK, Ko GJ, Kwon OS, Lim TK, Kim SH, Han SY, Han KH, Lee JE, Han JY, Kim HK, Cha DR. CCR2 antagonism improves insulin resistance, lipid metabolism, and diabetic nephropathy in type 2 diabetic mice. Kidney Int 78: 883–894, 2010 [DOI] [PubMed] [Google Scholar]
  • 38. Klinger MB, Dattilio A, Vizzard MA. Expression of cyclooxygenase-2 in urinary bladder in rats with cyclophosphamide-induced cystitis. Am J Physiol Regul Integr Comp Physiol 293: R677–R685, 2007 [DOI] [PubMed] [Google Scholar]
  • 39. Klinger MB, Girard B, Vizzard MA. p75NTR expression in rat urinary bladder sensory neurons and spinal cord with cyclophosphamide-induced cystitis. J Comp Neurol 507: 1379–1392, 2008 [DOI] [PubMed] [Google Scholar]
  • 40. Klinger MB, Vizzard MA. Role of p75NTR in female rat urinary bladder with cyclophosphamide-induced cystitis. Am J Physiol Renal Physiol 295: F1778–F1789, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Lamale LM, Lutgendorf SK, Zimmerman MB, Kreder KJ. Interleukin-6, histamine, and methylhistamine as diagnostic markers for interstitial cystitis. Urology 68: 702–706, 2006 [DOI] [PubMed] [Google Scholar]
  • 42. Lamotte RH, Ma C. Hyperexcitable neurons and altered non-neuronal cells in the compressed spinal ganglion. Sheng Li Xue Bao 60: 597–602, 2008 [PMC free article] [PubMed] [Google Scholar]
  • 43. Lindia JA, McGowan E, Jochnowitz N, Abbadie C. Induction of CX3CL1 expression in astrocytes and CX3CR1 in microglia in the spinal cord of a rat model of neuropathic pain. J Pain 6: 434–438, 2005 [DOI] [PubMed] [Google Scholar]
  • 44. Malley SE, Vizzard MA. Changes in urinary bladder cytokine mRNA and protein after cyclophosphamide-induced cystitis. Physiol Genomics 9: 5–13, 2002 [DOI] [PubMed] [Google Scholar]
  • 45. Menetski J, Mistry S, Lu M, Mudgett JS, Ransohoff RM, Demartino JA, Macintyre DE, Abbadie C. Mice overexpressing chemokine ligand 2 (CCL2) in astrocytes display enhanced nociceptive responses. Neuroscience 149: 706–714, 2007 [DOI] [PubMed] [Google Scholar]
  • 46. Merrill L, Girard BM, May V, Vizzard MA. Transcriptional and translational plasticity in rodent urinary bladder TRP channels with urinary bladder inflammation, bladder dysfunction, or postnatal maturation. J Mol Neurosci 48: 744–756, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Milligan ED, Sloane EM, Watkins LR. Glia in pathological pain: a role for fractalkine. J Neuroimmunol 198: 113–120, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Nazif O, Teichman JM, Gebhart GF. Neural upregulation in interstitial cystitis. Urology 69: 24–33, 2007 [DOI] [PubMed] [Google Scholar]
  • 49. Parsons CL. The role of the urinary epithelium in the pathogenesis of interstitial cystitis/prostatitis/urethritis. Urology 69: 9–16, 2007 [DOI] [PubMed] [Google Scholar]
  • 50. Petrone R, Agha A, Roy J, Hurst R. Urodynamic findings in patients with interstitial cystitis. J Urol 153: 290A, 1995 [Google Scholar]
  • 51. Qin X, Wan Y, Wang X. CCL2 and CXCL1 trigger calcitonin gene-related peptide release by exciting primary nociceptive neurons. J Neurosci Res 82: 51–62, 2005 [DOI] [PubMed] [Google Scholar]
  • 52. Rutkowski MD, DeLeo JA. The role of cytokines in the initiation and maintenance of chronic pain. Drug News Perspect 15: 626–632, 2002 [PubMed] [Google Scholar]
  • 53. Sakthivel SK, Singh UP, Singh S, Taub DD, Novakovic KR, Lillard JW., Jr CXCL10 blockade protects mice from cyclophosphamide-induced cystitis. J Immune Based Ther Vaccines 6: 6, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Sant GR, Hanno PM. Interstitial cystitis: current issues and controversies in diagnosis. Urology 57: 82–88, 2001 [DOI] [PubMed] [Google Scholar]
  • 55. Sant GR, Kempuraj D, Marchand JE, Theoharides TC. The mast cell in interstitial cystitis: role in pathophysiology and pathogenesis. Urology 69: 34–40, 2007 [DOI] [PubMed] [Google Scholar]
  • 56. Savarin-Vuaillat C, Ransohoff RM. Chemokines and chemokine receptors in neurological disease: raise, retain, or reduce? Neurotherapeutics 4: 590–601, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Schnegelsberg B, Sun TT, Cain G, Bhattacharya A, Nunn PA, Ford AP, Vizzard MA, Cockayne DA. Overexpression of NGF in mouse urothelium leads to neuronal hyperinnervation, pelvic sensitivity, and changes in urinary bladder function. Am J Physiol Regul Integr Comp Physiol 298: R534–R547, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Steers W. Pathogenesis of the overactive bladder and its attendant risk factors. BJU Int 85 Suppl 3: 69; discussion 70–61, 2000 [DOI] [PubMed] [Google Scholar]
  • 59. Studeny S, Cheppudira BP, Meyers S, Balestreire EM, Apodaca G, Birder LA, Braas KM, Waschek JA, May V, Vizzard MA. Urinary bladder function and somatic sensitivity in vasoactive intestinal polypeptide (VIP)−/− Mice. J Mol Neurosci 36: 175–187, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Sun JH, Yang B, Donnelly DF, Ma C, LaMotte RH. MCP-1 enhances excitability of nociceptive neurons in chronically compressed dorsal root ganglia. J Neurophysiol 96: 2189–2199, 2006 [DOI] [PubMed] [Google Scholar]
  • 61. Sun Y, Chai TC. Augmented extracellular ATP signaling in bladder urothelial cells from patients with interstitial cystitis. Am J Physiol Cell Physiol 290: C27–C34, 2006 [DOI] [PubMed] [Google Scholar]
  • 62. Sun Y, Chai TC. Up-regulation of P2X3 receptor during stretch of bladder urothelial cells from patients with interstitial cystitis. J Urol 171: 448–452, 2004 [DOI] [PubMed] [Google Scholar]
  • 63. Sun Y, Keay S, De Deyne PG, Chai TC. Augmented stretch activated adenosine triphosphate release from bladder uroepithelial cells in patients with interstitial cystitis. J Urol 166: 1951–1956, 2001 [PubMed] [Google Scholar]
  • 64. Sun Y, Keay S, Lehrfeld TJ, Chai TC. Changes in adenosine triphosphate-stimulated ATP release suggest association between cytokine and purinergic signaling in bladder urothelial cells. Urology 74: 1163–1168, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Tanaka T, Minami M, Nakagawa T, Satoh M. Enhanced production of monocyte chemoattractant protein-1 in the dorsal root ganglia in a rat model of neuropathic pain: possible involvement in the development of neuropathic pain. Neurosci Res 48: 463–469, 2004 [DOI] [PubMed] [Google Scholar]
  • 66. Tyagi P, Barclay D, Zamora R, Yoshimura N, Peters K, Vodovotz Y, Chancellor M. Urine cytokines suggest an inflammatory response in the overactive bladder: a pilot study. Int Urol Nephrol 42: 629–635, 2010 [DOI] [PubMed] [Google Scholar]
  • 67. Van Steenwinckel J, Reaux-Le Goazigo A, Pommier B, Mauborgne A, Dansereau MA, Kitabgi P, Sarret P, Pohl M, Melik Parsadaniantz S. CCL2 released from neuronal synaptic vesicles in the spinal cord is a major mediator of local inflammation and pain after peripheral nerve injury. J Neurosci 31: 5865–5875, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Vera PL, Iczkowski KA, Wang X, Meyer-Siegler KL. Cyclophosphamide-induced cystitis increases bladder CXCR4 expression and CXCR4-macrophage migration inhibitory factor association. PLos One 3: e3898, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Verge GM, Milligan ED, Maier SF, Watkins LR, Naeve GS, Foster AC. Fractalkine (CX3CL1) and fractalkine receptor (CX3CR1) distribution in spinal cord and dorsal root ganglia under basal and neuropathic pain conditions. Eur J Neurosci 20: 1150–1160, 2004 [DOI] [PubMed] [Google Scholar]
  • 70. Vizzard MA. Alterations in neuropeptide expression in lumbosacral bladder pathways following chronic cystitis. J Chem Neuroanat 21: 125–138, 2001 [DOI] [PubMed] [Google Scholar]
  • 71. Vizzard MA. Alterations in spinal cord Fos protein expression induced by bladder stimulation following cystitis. Am J Physiol Regul Integr Comp Physiol 278: R1027–R1039, 2000 [DOI] [PubMed] [Google Scholar]
  • 72. Vizzard MA. Changes in urinary bladder neurotrophic factor mRNA and NGF protein following urinary bladder dysfunction. Exp Neurol 161: 273–284, 2000 [DOI] [PubMed] [Google Scholar]
  • 73. Vizzard MA. Up-regulation of pituitary adenylate cyclase-activating polypeptide in urinary bladder pathways after chronic cystitis. J Comp Neurol 420: 335–348, 2000 [PubMed] [Google Scholar]
  • 74. Vizzard MA, Boyle MM. Increased expression of growth-associated protein (GAP-43) in lower urinary tract pathways following cyclophosphamide (CYP)-induced cystitis. Brain Res 844: 174–187, 1999 [DOI] [PubMed] [Google Scholar]
  • 75. Watkins LR, Maier SF. Glia: a novel drug discovery target for clinical pain. Nat Rev Drug Discov 2: 973–985, 2003 [DOI] [PubMed] [Google Scholar]
  • 76. White FA, Sun J, Waters SM, Ma C, Ren D, Ripsch M, Steflik J, Cortright DN, Lamotte RH, Miller RJ. Excitatory monocyte chemoattractant protein-1 signaling is up-regulated in sensory neurons after chronic compression of the dorsal root ganglion. Proc Natl Acad Sci USA 102: 14092–14097, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Yoshimura N, Bennett NE, Hayashi Y, Ogawa T, Nishizawa O, Chancellor MB, de Groat WC, Seki S. Bladder overactivity and hyperexcitability of bladder afferent neurons after intrathecal delivery of nerve growth factor in rats. J Neurosci 26: 10847–10855, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Yoshimura N, de Groat WC. Increased excitability of afferent neurons innervating rat urinary bladder after chronic bladder inflammation. J Neurosci 19: 4644–4653, 1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Yuridullah R, Corrow KA, Malley SE, Vizzard MA. Expression of fractalkine and fractalkine receptor in urinary bladder after cyclophosphamide (CYP)-induced cystitis. Auton Neurosci 126–127: 380–389, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Zhang J, De Koninck Y. Spatial and temporal relationship between monocyte chemoattractant protein-1 expression and spinal glial activation following peripheral nerve injury. J Neurochem 97: 772–783, 2006 [DOI] [PubMed] [Google Scholar]
  • 81. Zhang ZJ, Dong YL, Lu Y, Cao S, Zhao ZQ, Gao YJ. Chemokine CCL2 and its receptor CCR2 in the medullary dorsal horn are involved in trigeminal neuropathic pain. J Neuroinflamm 9: 136, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Zvara P, Vizzard MA. Exogenous overexpression of nerve growth factor in the urinary bladder produces bladder overactivity and altered micturition circuitry in the lumbosacral spinal cord. BMC Physiol 7: 9, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Zvarova K, Vizzard MA. Changes in galanin immunoreactivity in rat micturition reflex pathways after cyclophosphamide-induced cystitis. Cell Tissue Res 324: 213–224, 2006 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Renal Physiology are provided here courtesy of American Physiological Society

RESOURCES