Skip to main content
PLOS One logoLink to PLOS One
. 2013 Jul 29;8(7):e69784. doi: 10.1371/journal.pone.0069784

Histone Demethylase Retinoblastoma Binding Protein 2 is Overexpressed in Hepatocellular Carcinoma and Negatively Regulated by hsa-miR-212

Xiuming Liang 1,#, Jiping Zeng 1,2,#, Lixiang Wang 3, Ming Fang 1, Qing Wang 1, Min Zhao 1, Xia Xu 2, Zhifang Liu 2, Wenjuan Li 1, Shili Liu 1, Han Yu 1, Jihui Jia 1, Chunyan Chen 1,4,*
Editor: Chun-Ming Wong5
PMCID: PMC3726779  PMID: 23922798

Abstract

Background

The H3K4 demethylase retinoblastoma binding protein 2 (RBP2) is involved in the pathogenesis of gastric cancer, but its role and regulation in hepatocellular carcinoma (HCC) is unknown. We determined the function of RBP2 and its regulation in HCC in vitro and in human tissues.

Methods

We analyzed gene expression in 20 specimens each of human HCC and normal liver tissue by quantitative real-time PCR and immunohistochemistry. Proliferation was analyzed by foci formation and senescence by β-galactosidase staining. Promoter activity was detected by luciferase reporter assay.

Results

The expression of RBP2 was stronger in cancerous than non-cancerous tissues, but that of its binding microRNA, Homo sapiens miR-212 (hsa-miR-212), showed an opposite pattern. SiRNA knockdown of RBP2 significantly upregulated cyclin-dependent kinase inhibitors (CDKIs), with suppression of HCC cell proliferation and induction of senescence. Overexpression of hsa-miR-212 suppressed RBP2 expression, with inhibited cell proliferation and induced cellular senescence, which coincided with upregulated CDKIs; with low hsa-miR-212 expression, CDKIs were downregulated in HCC tissue. Inhibition of hsa-miR-212 expression upregulated RBP2 expression. Luciferase reporter assay detected the direct binding of hsa-miR-212 to the RBP2 3′ UTR.

Conclusions

RBP2 is overexpressed in HCC and negatively regulated by hsa-miR-212. The hsa-miR-212–RBP2–CDKI pathway may be important in the pathogenesis of HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common tumors in China [1][3]. Its early diagnosis is difficult. HCC can be diagnosed effectively in some cases with serological assessment [4][6], but the molecular mechanism of cell proliferation and effective biological markers for diagnosis are unclear.

Retinoblastoma binding protein 2 (RBP2), a newly found histone demethylase, belongs to the JARID1 protein family [7][9] and was found to interact with pRb, regulating cellular differentiation and embryonic development [10][11]. RBP2 is a kind of H3K4 demethylase, contributing to the demethylation of H3K4me3 and H3K4me2 [12][14]. Recently, RBP2 was found to be associated with cancer. Upregulation of RBP2 was a characteristic of a drug-tolerant cancer cell subpopulation [15]. We found RBP2 overexpressed in gastric cancer, and its inhibition could trigger cancer-cell senescence [16]. We also found RBP2 overexpressed in HCC. RBP2 was significantly underexpressed in normal liver tissue but strongly expressed in cancerous liver tissues, so RBP2 may take part in the development of HCC. Furthermore, siRNA inhibition of RBP2 expression could decrease the proliferation and induce senescence of high-differentiated HepG-2 cells and low-differentiated SMMC-7721 cells, 2 representative HCC cell lines, but the mechanism of RBP2 overexpression has not been elucidated.

MicroRNAs (miRNAs), non-coding 20– to 23-nt RNAs, play a key role in gene expression in different kinds of cancer [17][18]. MiRNAs can bind to the seed sequence of the 3′ UTR of target genes and negatively regulate their expression in cell proliferation, differentiation, senescence, and apoptosis, for example. MiRNAs also participate in cancer metastasis and cancerous angiogenesis by regulating specific genes. Homo sapiens miRNA-212 (hsa-miR-212) has 2 sites binding in the 3′ UTR of RBP2. It is downregulated and suppresses methyl-CpG-binding protein MeCP2 in human gastric cancer [19]. Downregulation of hsa-miR-212 increasing the expression of HB-EGF may be involved in cetuximab resistance in head and neck squamous cell carcinoma [20].

In this research, we investigated the involvement of RBP2 in HCC and the miRNA implicated in its regulation in human HCC. RBP2 inhibition and hsa-miR-212 overexpression may lead to cell proliferation arrest and cellular senescence by depressing cyclin-dependent kinase inhibitors (CDKIs; p16ink4a, p21CIP2 and p27kip1). RBP2 and hsa-miR-212 may be biomarkers for diagnosis of HCC and therapeutic targets in its treatment.

Materials and Methods

The ethics committee of Shandong University School of Medicine approved this study and all participants provided written informed consent.

Clinical Samples

We obtained 20 samples of HCC from patients at Bengbu Medical University, AnHui Province, China, immediately after surgery and stored them in formalin. The diagnosis of HCC was confirmed by histological examination; no patient had undergone chemotherapy or radiotherapy before surgery. The general characteristics of patients are in Table S1. We excluded patients with a history of alcohol abuse.

Other Materials and Methods

Immunohistochemistry, cell culture [21][23] and siRNA interference, RNA extraction, RT-PCR and real-time PCR (primers are in Table 1), plasmid transfection and luciferase reporter gene assay (primers and methods are in Table 2), protein extraction and western blot assay, clonal formation assay and senescence-associated β-galactosidase (SA-β-Gal) staining are described in Data S1.

Table 1. PCR primer sequences used in the study.

Genes Primers
RBP2 5′-GCTGCTGCAGCCAAAGTTG-3′ (forward)
5′-AGCATCTGCTAACTGGTC-3′ (reverse)
p16ink4a 5′-TTCCTGGACACGCTGGT-3′ (forward)
5′-CAATCGGGGATGTCTGAG-3′ (reverse)
p21CIP2 5′-GCGACTGTGATGCGCTAAT-3′ (forward)
5′-TAGGGCTTCCTCTTGGAGAA-3′ (reverse)
p27kip1 5′-ATGTCAAACGTGCGAGTGTCTAA-3′ (forward)
5′-TTACGTTTGACGTCTTCTGAGG -3′ (reverse)
hsa-miR-212 5′ - GGATCC TGCGTTGATCAGCACC - 3′ (forward)
5′- AAGCTTCCCCTCTGGGACATCTTT - 3′ (reverse)
3′ UTR of hsa-miR-212 5′ - ACTAGT GCAGATGCTGTTGAATAA -3′ (forward)
5′ - AAGCTT CTACAAAGAAGGAATGG - 3′ (reverse)
hsa-miR-212 inhibitor 5′-GATCCCCATTGTCAGAGGTCAGTGCCGGTTTTTTGGAAG-3′(forward)
5′-TCGACTTCCAAAAAACCGGCACTGACCTCTGACAATGGG-3′ (reverse)
β-actin 5′ - AGTTGCGTTACACCCTTTCTTG - 3′ (forward)
5′ - CACCTTCACCGTTCCAGTTTT - 3′ (reverse)

Table 2. Primer sequences for construction of wild type (WT) and mutants (MUT1 and 2) of the 3′ UTR of retinoblastoma binding protein 2 (RBP2) by the overlap extension PCR method.

Category Primers
Sequences for construction of WT RBP2 3′ UTR 5′-ACTAGTGCAGATGCTGTTGAATAA-3′ (UTR sense)
5′-AAGCTTCTACAAAGAAGGAATGG-3′ (UTR antisense)
Sequences for construction of MUT1 5′-GTATAGGCTGTGAAGTAGTCAGAGACA-3′ (UTR MUT1 primer-1)
5′-TGTCTCTGACTACTTCACAGCCTATAC-3′ (UTR MUT1 primer-2)
Sequences for construction of MUT2 5′-ATATGCTGCTGGATGACTGAAATATA-3′ (UTR MUT2 primer-1)
5′-TATATTTCAGTCATCCAGCAGCATAT-3′ (UTR MUT1 primer-2)

Statistical Analysis

Quantitative data are expressed as mean±SD or SEM. Student’s t test was used to analyze the differences between groups. P<0.05 was considered statistically significant.

Results

RBP2 is overexpressed and hsa-miR-212 underexpressed in human HCC.

Immunohistochemical staining revealed higher RBP2 protein expression in HCC than normal liver tissue ( Figure 1A ), and the mRNA level of RBP2 was higher in HCC than normal tissue ( P<0.001; Figure 1C ) [24]. RBP2 was highly expressed in most HCC tissues (75%), whereas most normal tissues (70%) showed low RBP2 expression ( Figure 1B ). Overexpression of RBP2 at the mRNA and protein levels in HCC tissue suggested that RBP2 might participate in the initiation and development of HCC.

Figure 1. RBP2 was overexpressed and hsa-miR-212 underexpressed in human hepatic cancer tissues.

Figure 1

(A) Representative immunostaining of RBP2 overexpressed in normal and cancer tissue. (B) Quantification of RBP2 expression in normal and cancerous tissues. (C and E) RBP2 and hsa-miR-212 expression in normal and hepatic cancerous tissues. Each point represents 1 sample. Horizontal medium bar is mean and whiskers are SD. (D) The predicted miRNA that can bind to the 3′ UTR of RBP2 and regulate its expression. (F) Linear plot of data from C and E showing a negative correlation between RBP2 and hsa-miR-212 expression in hepatic cancerous tissues. P<0.001.

Hsa-miR-212, the predicted miRNA that could bind to the 3′ UTR of RBP2 ( Figure 1D ), may regulate its expression in these clinical samples. Hsa-miR-212 level was significantly lower in HCC than normal tissue (P<0.001; Figure 1E ), which suggested a negative regulation between RBP2 and hsa-miR-212 in HCC. RBP2 and miR212 levels were negatively correlated (R2 = 0.7941, Figure 1F ).

Inhibition of RBP2 Expression in HCC Cells Repressed Cell Proliferation and Induced Cell Senescence by Upregulating CDKIs

Next, we investigated the mechanism by which RBP2 participates in hepatic oncogenesis in 2 hepatic cancer cell lines, HepG-2 and SMMC-7721 cells. The mRNA level of RBP2 was decreased with RBP2 siRNA knockdown, by about 80% and 72% in HepG-2 and SMMC-7721 cells, respectively ( Figure 2A ; Figure S1A), and RBP2 protein level was decreased ( Figure 2A ). At the same time, H3K4me2 and H3K4me3 expression was significantly increased with RBP2 depletion (Figure S2C). The expression of known targets of RBP2, namely, the CDKIs p16ink4a, p21CIP2 and p27kip1, was markedly increased with RBP2 siRNA knockdown ( Figure 2B ; Figure S2A). As a result, the proliferation of HCC cells was sharply restricted ( Figure 2C ). Cell senescence was induced with RBP2 siRNA knockdown for 72 hr in cancer cells ( Figure 2D ). Therefore, CDKI expression could be regulated by RBP2, and knocking down RBP2 expression could repress cell proliferation and induce cell senescence.

Figure 2. SiRNA knockdown of RBP2 suppressed HCC cell proliferation and induced cellular senescence by regulating cyclin-dependent kinase inhibitors (CDKIs).

Figure 2

(A) Western blot analysis (left) and quantitative RT-PCR (qRT-PCR; right) of RBP2 protein and mRNA expression, respectively, with siRNA knockdown in HepG-2 and SMMC-7721 cancer cells. (B) Western blot analysis (left) and qRR-PCR analysis protein and mRNA expression of p16ink4a, p21CIP2 and p27kip1 with RBP2 siRNA knockdown. (C) Foci formation in cancer cells with RBP2 siRNA knockdown. (D) Cell senescence with RBP2 siRNA knockdown. Senescent cells were stained blue by SA-β-Gal staining. 400× magnification. Data are mean±SD of 3 biological replicates, * and **: P<0.05 and <0.01 compared with control.

Overexpression of RBP2 Blocked CDKI Expression in vitro

RBP2 mRNA and protein expression was induced with an overexpression plasmid ( Figure 3A ; Figure S1B) and the expression of the CDKIs p16ink4a, p21CIP2 and p27kip1 was downregulated ( Figure 3B and C ; Figure S2B).

Figure 3. RBP2 overexpression inhibited the expression of CDKIs, and p21CIP2 and p27kip1 were directly regulated by RBP2.

Figure 3

(A) Western blot analysis (left) and qRT-PCR analysis (right) of RBP2 protein and mRNA expression, respectively, in hepatic cancer cells with RBP2 overexpression. Western blot analysis (B) and qRT-PCR (C) of protein and mRNA expression of p16ink4a, p21CIP2 and p27kip1 with RBP2 overexpression. (D) P21CIP2 and p27kip1 promoter activity in RBP2 knocked-down HepG-2 cells. (E) ChIP assay of RBP2 directly binding to the promoters of p21CIP2 and p27kip1. (F) Immunohistochemical staining of co-localization of RBP2, p21CIP2, and p27kip1 in representative serial sections of tumors formed by injecting HepG-2 cells into nude mice. 600× magnification. Data are mean±SD of 3 biological replicates, * and **: P<0.05 and <0.01 compared with control.

Expression of the CDKIs p21CIP2 and p27kip1 was Directly Regulated by RBP2

To determine whether p21CIP2 and p27kip1 were directly regulated by RBP2, siRNA knockdown of RBP2 expression greatly increased luciferase activity of p21CIP2 and slightly but significantly increased activity of p27kip1 in HepG-2 cells ( Figure 3D ); ChIP assay confirmed the results ( Figure 3E ). Therefore, RBP2 could directly bind to p21CIP2 and p27kip1 promoters and suppress their expression.

HepG-2 cells were injected into nude mice and tumors were formed (Figure S1F). P21CIP2 and p27kip1 co-located with RBP2 on immunohistochemical staining of serial tissue sections of tumors: with RBP2 overexpression, the expression of p21CIP2 and p27kip1 was relatively low ( Figure 3F ). Thus, RBP2 regulated the expression of CDKIs and affected cell proliferation, thereby contributing to the development of HCC in humans.

RBP2 was Negatively Regulated by hsa-miR-212

We confirmed that RBP2 was overexpressed in HCC and investigated the mechanism of the increased RBP2 expression. We found that RBP2 is a target of hsa-miR-212, and hsa-miR-212 could bind with 2 regions of the 3′ UTR of RBP2 ( Figure 1D ). With hsa-miR-212 overexpression in HepG-2 and SMMC-7721 cells, hsa-miR-212 expression was significantly increased, which confirmed the success of hsa-miR-212 overexpression ( Figure 4A ). RBP2 expression was markedly repressed with hsa-miR-212 overexpression ( Figure 4B and C ; Figure S1C). The expression of p16ink4a and p27kip1, targets of RBP2, was increased in the 2 cell lines ( Figure 4D ), which agreed with previous findings. Accordingly, cell proliferation was repressed and cell senescence induced with hsa-miR-212 overexpression ( Figure 4E and F ). To further confirm that RBP2 was negatively regulated by hsa-miR-212, transfection of hsa-miR-212 inhibitor plasmid in the 2 cell lines decreased the expression of hsa-miR-212 ( Figure 5A ) and increased that of RBP2 ( Figure 5A and B ; Figure S1D). Accordingly, the expression of p16ink4a and p27kip1 was decreased with hsa-miR-212 inhibition ( Figure 5C ).

Figure 4. RBP2 expression was suppressed with hsa-miR-212 overexpression.

Figure 4

(A) qRT-PCR analysis of Hsa-miR-212 mRNA expression in cancer cells with hsa-miR-212 overexpression. Western blot (B) and qRT-PCR analysis (C) of RBP2 protein and mRNA expression, respectively. (D) qRT-PCR analysis of mRNA expression of p16ink4a and p27kip1, (E) foci formation (upper) and quantification (lower), and (F) cell senescence. 400× magnification. Data are mean±SD of 3 biological replicates, * P<0.05 compared with negative control.

Figure 5. RBP2 expression was induced with hsa-miR-212 inhibition in HCC cell lines, and reduced p16ink4a and p27kip1 expression was confirmed by qRT-PCR method in HCC with downregulated hsa-miR-212 expression.

Figure 5

Effect of hsa-miR-212 inhibition on (A) qRT-PCR analysis of mRNA expression of Hsa-miR-212 and RBP2, (B) western blot analysis of protein expression of RBP2, and (C) qRT-PCR analysis of mRNA expression of p16ink4a and p27kip1. (D) Luciferase activity of RBP2 3′ UTR with different treatment in SMMC-7721 cells. (E) RBP2 expression negatively regulated by hsa-miR-212 transfection and effect on HCC cell proliferation by foci formation. (F) qRT-PCR analysis of mRNA expression of p27kip1 and p16ink4a in HCC tissues. Each point represents 1 sample. Horizontal medium bar is mean and whiskers are SD. Data are mean±SD of 3 biological replicates, * P<0.05 compared with control.

To ascertain whether hsa-miR-212 directly regulated the expression of RBP2, use of an RBP2 3′-UTR reporter vector significantly decreased luciferase activity with hsa-miR-212 overexpression in SMMC-7721 cells. However, co-transfection of hsa-miR-212 with the 2 mutants of the RBP2 3′ UTR reporter vector (mutation of the 2 binding sites of RBP2, Table 2 ) reversed the luciferase activity ( Figure 5D ). Thus, RBP2 was a direct target of hsa-miR-212.

To confirm that RBP2 was negatively regulated by hsa-miR-212 and could affect cell proliferation, HepG-2 cells with hsa-miR-212 overexpression showed decreased RBP2 expression, with decreased cell proliferation ( Figure 5E , left). With RBP2 overexpression, RBP2 expression recovered accordingly, for enhanced cell proliferation ( Figure 5E , left). SMMC-7721 cells with hsa-miR-212 inhibitor showed increased RBP2 expression, with enhanced cell proliferation ( Figure 5E , right). RBP2 siRNA knockdown decreased RBP2 expression, for reduced cell proliferation ( Figure 5E , right). Furthermore, the expression of p16ink4a and p27kip1 was downregulated in HCC tissues with inhibited hsa-miR-212 expression (both P<0.001; Figure 5F ). Therefore, low hsa-miR-212 expression resulted in overexpressed RBP2, which contributed to downregulation of p16ink4a and p27kip1, thus confirming the hsa-miR-212–RBP2–CDKI pathway involved in HCC.

Discussion

RBP2 is involved in the pathogenesis of gastric cancer, but its role and regulation in HCC was unknown. We determined the function of RBP2 and its regulation in HCC in vivo and in vitro. The expression of RBP2 was stronger in cancerous than non-cancerous human tissues, but that of its binding miRNA, hsa-miR-212, was reversed. SiRNA knockdown of RBP2 significantly upregulated CDKIs, with suppression of HCC cell proliferation and induction of cell senescence. Overexpression of hsa-miR-212 had a similar effect. Conversely, inhibition of hsa-miR-212 expression upregulated RBP2 expression. We found that RBP2 is overexpressed in HCC and negatively regulated by hsa-miR-212. The hsa-miR-212–RBP2–CDKI pathway may be important in the pathogenesis of HCC.

Epigenetic modulation participates in various biological processes by affecting chromatin stability and transcriptional repression or activation of target genes. Epigenetic molecules may play an important role in many types of tumorigenesis [25]. An important histone demethylase family, the JARID1 protein family, has been investigated widely in the biological process of higher organisms [18]. JARID1B/RBP2–H1/KDM5B was found to be a transcriptional regulator with tumor-suppressive potential in melamoma cells [26] and was used as a biomarker for a small subpopulation of slow-cycling melanoma cells [27]. The von Hippel-Lindau tumor-suppressor protein regulates gene expression and tumor growth via the histone demethylase JARID1C/KDM5C/SMCX in clear-cell renal cell carcinoma [28]. The expression pattern of JARID1D/KDM5D/SMCY significantly differed in meningiomas of male and female patients and contributes to the female predominance of this tumor [29].

RBP2, a member of the JARID family protein, also named JARID1A or KDM5A, has histone demethylase activity that could demethylate H3K4me3 and H3K4me2 significantly [8], [12]. Thus, RBP2 may affect the stability of chromatin through histone modulation. We first investigated the expression of RBP2 in human HCC and found the same expression as in gastric cancer. Recently, upregulation of RBP2/KDM5A expression was seen as characteristic of a drug-tolerant cancer cell subpopulation, cancer stem cells [15], which highlights the role of RBP2 in tumors and suggests its role in the initiation and development of HCC, but its mechanism in cancer was not eluciated.

MiRNAs affect tumorigenesis [30][32]. They can negatively regulate oncogenes and play a role as tumour suppressor genes but can also target tumour-suppressor genes and play a role as oncogenes. MiR-21 is overexpressed in most types of cancer [33][34] and Let-7 has an exclusively strong effect in lung cancer development [35]. Here, we found that RBP2 is a direct target of hsa-miR-212, and overexpressed RBP2 in HCC tissues may result from downregulated hsa-miR-212 expression. Hsa-miR-212 has been widely investigated [36][39]. We found that Hsa-miR-212 directly binds to the 3′ UTR of RBP2 and suppressed its expression. The suppressed RBP2 expression led to inhibited proliferation and induced senescence of hepatocellular cells by upregulating CDKIs. So, the low expression of hsa-miR-212 in HCC may result in overexpression of RBP2 and downregulation of RBP2 targets such as CDKIs, accompanied by cell proliferation and blocking cellular senescence in HCC, which contributes to its pathogenesis. Here, we provide more evidence of epigenetic molecule regulation by miRNAs.

However, the mechanism by which hsa-miR-212 is downregulated in HCC is not known. Infection with hepatitis B virus (HBV) may play a role in this process because HCC can result from HBV infection. As well, downregulation of hsa-miR-212 may be due to hypermethylation of DNA in the hsa-miR-212 promoter because downregulation of hsa-miR-212 expression is through DNA hypermethylation in human gastric cancer [40]. Recently, miR-212 expression was found to be deregulated in lung cancer [41]. However, other mechanisms may lead to the suppression of hsa-miR-212 expression in HCC. Also, downregulated hsa-miR-212 expression may not be the only mechanism leading to the overexpression of RBP2. We found that depletion of one miRNA, hsa-miR-212, antagonized the suppression of RBP2, which led to RBP2 overexpression in HCC, but further investigation is needed to elucidate the reason for the overexpressed RBP2 in HCC. Induced epigenetic molecules could also regulate the expression of miRNAs [42][44], but we found no evidence of induced RBP2 affecting hsa-miR-212 expression because siRNA knockdown of RBP2 did not change the expression of hsa-miR-212 (Figure S1E).

In conclusion, our findings suggest that overexpressed RBP2 in HCC resulted from downregulated hsa-miR-212 expression and that overexpressed RBP2 could promote cell proliferation and suppress cell senescence by downregulating p16ink4a, p21CIP2 and p27kip1. The hsa-miR-212–RBP2–CDKI pathway in HCC may contribute to its initiation and development. Low expression of hsa-miR-212 and overexpression of RBP2 may be prognostic markers for HCC. As well, RBP2 and hsa-miR-212 expression may be a therapeutic target for HCC.

Supporting Information

Data S1

Supporting Materials and Methods.

(DOC)

Figure S1

RBP2 expression was inhibited with transfection of RBP2 siRNA or enhanced with transfection of RBP2 overexpression plasmid in HCC cell lines and RBP2 was negatively regulated by hsa-miR-212 (A–B) RT-PCR analysis of the mRNA expression of RBP2 with transfection of RBP2 siRNA or RBP2 overexpression plasmid. (C–D) RT-PCR analysis of mRNA expression of RBP2 expression with transfection of hsa-miR-212 overexpression or inhibitor plasmid. (E) qRT-PCR analysis of mRNA expression of hsa-miR-212 with transfection of control or RBP2 siRNA. Data are mean±SD of biological replicates. (F) Confirmation of tumor development in mice with injection of HepG-2 cells.

(TIF)

Figure S2

p16 was negatively regulated by RBP2 and H3K4me2 and H3K4me3 expression was significantly increased with RBP2 knockdown in HCC cell lines. (A) Western blot analysis of protein expression of p16 with RBP2 suppression and (B) RBP2 overexpression. (C) Expression of H3K4me2 and H3K4me3 expression in HCC cell lines with RBP2 knockdown.

(TIF)

Table S1

General characteristic of the patients.

(DOC)

Funding Statement

The study was funded by the National Natural Science Foundation of China (grant numbers 81001098, 30972775, 81000868, 30800406, 81171536, 81170514, 81172354, 30971151, 30800037, and 81071313), the National Basic Research Program of China (grant number 973 Program 2012CB911202), the Science Foundation of Shandong Province (grant numbers ZR2009CZ001, ZR2009CM002 and ZR2010HZ003) and the Postdoctoral Foundation of China (grant number 20100471516). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Yeh FS, Mo CC, Yen RC (1985) Risk factors for hepatocellular carcinoma in Guangxi, People’s Republic of China. Natl Cancer Inst Monogr 69: 47–48. [PubMed] [Google Scholar]
  • 2. Long XD, Ma Y, Wei YP, Deng ZL (2006) The polymorphisms of GSTM1, GSTT1, HYL1*2, and XRCC1, and aflatoxin B1-related hepatocellular carcinoma in Guangxi population, China. Hepatology Research 36: 48–55. [DOI] [PubMed] [Google Scholar]
  • 3. Zhu Z, Jiang Y, Chen S, Jia S, Gao X, et al. (2011) An insertion/deletion polymorphism in the 3′ untranslated region of type I collagen a2 (COL1A2) is associated with susceptibility for hepatocellular carcinoma in a Chinese population. Cancer Genetics 204: 265–269. [DOI] [PubMed] [Google Scholar]
  • 4. He YM, Wang XY, Gao SD, Yu LY, Lin XD, et al. (2005) Ultrasound-guided fine needle biopsy of intrahepatic nodules and low elevation of AFP in early diagnosis of hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int 4: 50–54. [PubMed] [Google Scholar]
  • 5. Forner A, Reig M, Bruix J (2009) Alpha-fetoprotein for hepatocellular carcinoma diagnosis: the demise of a brilliant star. Gastroenterology 137: 26–29. [DOI] [PubMed] [Google Scholar]
  • 6. El-Serag HB, Kramer JR, Chen GJ, Duan Z, Richardson PA, et al. (2011) Effectiveness of AFP and ultrasound tests on hepatocellular carcinoma mortality in HCV-infected patients in the USA. Gut 60: 992–997. [DOI] [PubMed] [Google Scholar]
  • 7. Iwase S, Lan F, Bayliss P, de la Torre-Ubieta L, Huarte M, et al. (2007) The X-linked mental retardation gene SMCX/JARID1C defines a family of histone H3 lysine 4 demethylases. Cell 128: 1077–1088. [DOI] [PubMed] [Google Scholar]
  • 8. Klose RJ, Yan Q, Tothova Z, Yamane K, Erdjument-Bromage H, et al. (2007) The retinoblastoma binding protein RBP2 is an H3K4 demethylase. Cell 128: 889–900. [DOI] [PubMed] [Google Scholar]
  • 9. Hayakawa T, Ohtani Y, Hayakawa N, Shinmyozu K, Saito M, et al. (2007) RBP2 is an MRG15 complex component and down-regulates intragenic histone H3 lysine 4 methylation. Genes Cells 12: 811–826. [DOI] [PubMed] [Google Scholar]
  • 10. Gutierrez GM, Kong E, Hinds PW (2005) Master or slave: The complex relationship of RBP2 and pRb. Cancer cell 7: 501–502. [DOI] [PubMed] [Google Scholar]
  • 11. Benevolenskaya EV, Murray HL, Branton P, Young RA, Kaelin WG Jr (2005) Binding of pRB to the PHD protein RBP2 promotes cellular differentiation. Mol Cell 18: 623–635. [DOI] [PubMed] [Google Scholar]
  • 12. Christensen J, Agger K, Cloos PA, Pasini D, Rose S, et al. (2007) RBP2 Belongs to a Family of Demethylases, Specific for Tri-and Dimethylated Lysine 4 on Histone 3. Cell 128: 1063–1076. [DOI] [PubMed] [Google Scholar]
  • 13. Pasini D, Hansen KH, Christensen J, Agger K, Cloos PA, et al. (2008) Coordinated regulation of transcriptional repression by the RBP2 H3K4 demethylase and Polycomb-Repressive Complex 2. Genes Dev 22: 1345–1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lopez-Bigas N, Kisiel TA, Dewaal DC, Holmes KB, Volkert TL, et al. (2008) Genome-wide analysis of the H3K4 histone demethylase RBP2 reveals a transcriptional program controlling differentiation. Mol Cell 31: 520–530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Sharma SV, Lee DY, Li B, Quinlan MP, Takahashi F, et al. (2010) A chromatin-mediated reversible drug-tolerant state in cancer cell subpopulations. Cell 141: 69–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zeng J, Ge Z, Wang L, Li Q, Wang N, et al. (2010) The histone demethylase RBP2 Is overexpressed in gastric cancer and its inhibition triggers senescence of cancer cells. Gastroenterology 138: 981–992. [DOI] [PubMed] [Google Scholar]
  • 17. Zhang Z, Li Z, Gao C, Chen P, Chen J, et al. (2008) miR-21 plays a pivotal role in gastric cancer pathogenesis and progression. Lab Invest 88: 1358–1366. [DOI] [PubMed] [Google Scholar]
  • 18. Jiang S, Zhang HW, Lu MH, He XH, Li Y, et al. (2010) MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res 70: 3119–3127. [DOI] [PubMed] [Google Scholar]
  • 19. Wada R, Akiyama Y, Hashimoto Y, Fukamachi H, Yuasa Y (2010) hsa-miR-212 is down-regulated and suppresses methyl-CpG-binding protein MeCP2 in human gastric cancer. Int J Cancer 127: 1106–1114. [DOI] [PubMed] [Google Scholar]
  • 20. Hatakeyama H, Cheng H, Wirth P, Counsell A, Marcrom SR, et al. (2010) Regulation of heparin-binding EGF-like growth factor by hsa-miR-212 and acquired cetuximab-resistance in head and neck squamous cell carcinoma. PLoS One. 5: e12702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Ju Y, Hou N, Meng J, Wang X, Zhang X, et al. (2010) T cell immunoglobulin- and mucin-domain-containing molecule-3 (Tim-3) mediates natural killer cell suppression in chronic hepatitis B. J. Hepatol. 52(3): 322–329. [DOI] [PubMed] [Google Scholar]
  • 22. Liu H, Luan F, Ju Y, Shen H, Gao L, et al. (2007) In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase. Biochem Biophys Res Commun. 355(2): 379–384. [DOI] [PubMed] [Google Scholar]
  • 23. Yue X, Zhang Z, Liang X, Gao L, Zhang X, et al. (2012) Zinc Fingers and Homeoboxes 2 Inhibits Hepatocellular Carcinoma Cell Proliferation and Represses Expression of Cyclins A and E. Gastroenterology. 142(7): 1559–1570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kauffman EC, Robinson BD, Downes MJ, Powell LG, Lee MM, et al. (2011) Role of androgen receptor and associated lysine-demethylase coregulators, LSD1 and JMJD2A, in localized and advanced human bladder cancer. Mol Carcinog. 50(12): 931–944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Roesch A, Mueller AM, Stempfl T, Moehle C, Landthaler M, et al. (2008) RBP2–H1/JARID1B is a transcriptional regulator with a tumor suppressive potential in melanoma cells. Int J Cancer. 122: 1047–1057. [DOI] [PubMed] [Google Scholar]
  • 26. Roesch A, Fukunaga-Kalabis M, Schmidt EC, Zabierowski SE, Brafford PA, et al. (2010) A temporarily distinct subpopulation of slow-cycling melanoma cells is required for continuous tumor growth. Cell 141: 583–594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Niu X, Zhang T, Liao L, Zhou L, Lindner DJ, et al. (2011) The von Hippel-Lindau tumor suppressor protein regulates gene expression and tumor growth through histone demethylase JARID1C. Oncogene 31(6): 776–786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Tabernero MD, Espinosa AB, Maillo A, Rebelo O, Vera JF, et al. (2007) Patient gender is associated with distinct patterns of chromosomal abnormalities and sex chromosome linked gene-expression profiles in meningiomas. Oncologist. 12: 1225–1236. [DOI] [PubMed] [Google Scholar]
  • 29. Cochrane DR, Cittelly DM, Howe EN, Spoelstra NS, McKinsey EL, et al. (2010) MicroRNAs Link Estrogen Receptor Alpha Status and Dicer Levels in Breast Cancer. Horm Cancer 1: 306–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Marcucci G, Mrózek K, Radmacher MD, Garzon R, Bloomfield CD (2011) The prognostic and functional role of microRNAs in acute myeloid leukemia. Blood 117: 1121–1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Dykxhoorn DM (2010) MicroRNAs and metastasis: little RNAs go a long way. Cancer Res 70: 6401–6406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Mongroo PS, Rustgi AK (2010) The role of the miR-200 family in epithelial-mesenchymal transition. Cancer Biol Ther 10: 219–222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Gong C, Yao Y, Wang Y, Liu B, Wu W, et al. (2011) Up-regulation of miR-21 mediates resistanc to trastuzumab therapy for breast cancer. J Biol Chem 286: 19127–19137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Medina PP, Nolde M, Slack FJ (2010) OncomiR addiction in an in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature 467: 86–90. [DOI] [PubMed] [Google Scholar]
  • 35. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, et al. (2008) Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci 105: 3903–3908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Im HI, Hollander JA, Bali P, Kenny PJ (2010) MeCP2 controls BDNF expression and cocaine intake through homeostatic interactions with microRNA-212. Nat Neurosci 13: 1120–1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Hollander JA, Im HI, Amelio AL, Kocerha J, Bali P, et al. (2010) Striatal microRNA controls cocaine intake through CREB signaling. Nature 466: 197–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Incoronato M, Garofalo M, Urso L, Romano G, Quintavalle C, et al. (2010) hsa-miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED. Cancer Res 70: 3638–3646. [DOI] [PubMed] [Google Scholar]
  • 39. Magill ST, Cambronne XA, Luikart BW, Lioy DT, Leighton BH, et al. (2010) microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. Proc Natl Acad Sci 107: 20382–20387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Xu L, Wang F, Xu XF, Mo WH, Xia YJ, et al. (2011) Down-regulation of hsa-miR-212 expression by DNA hypermethylation in human gastric cancer cells. Med Oncol. 28 Suppl 1S189–196. [DOI] [PubMed] [Google Scholar]
  • 41. Incoronato M, Urso L, Portela A, Laukkanen MO, Soini Y, et al. (2011) Epigenetic Regulation of miR-212 Expression in Lung Cancer. PLoS One 6(11): e27722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Suzuki H, Takatsuka S, Akashi H, Yamamoto E, Nojima M, et al. (2011) Genome-wide profiling of chromatin signatures reveals epigenetic regulation of microRNA genes in colorectal cancer. Cancer Res 71: 5646–5658. [DOI] [PubMed] [Google Scholar]
  • 43. Iliopoulos D, Jaeger SA, Hirsch HA, Bulyk ML, Struhl K (2010) STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer. Mol Cell 39: 493–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Prazeres H, Torres J, Rodrigues F, Pinto M, Pastoriza MC, et al. (2011) Chromosomal, epigenetic and microRNA-mediated inactivation of LRP1B, a modulator of the extracellular environment of thyroid cancer cells. Oncogene 30: 1302–1317. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1

Supporting Materials and Methods.

(DOC)

Figure S1

RBP2 expression was inhibited with transfection of RBP2 siRNA or enhanced with transfection of RBP2 overexpression plasmid in HCC cell lines and RBP2 was negatively regulated by hsa-miR-212 (A–B) RT-PCR analysis of the mRNA expression of RBP2 with transfection of RBP2 siRNA or RBP2 overexpression plasmid. (C–D) RT-PCR analysis of mRNA expression of RBP2 expression with transfection of hsa-miR-212 overexpression or inhibitor plasmid. (E) qRT-PCR analysis of mRNA expression of hsa-miR-212 with transfection of control or RBP2 siRNA. Data are mean±SD of biological replicates. (F) Confirmation of tumor development in mice with injection of HepG-2 cells.

(TIF)

Figure S2

p16 was negatively regulated by RBP2 and H3K4me2 and H3K4me3 expression was significantly increased with RBP2 knockdown in HCC cell lines. (A) Western blot analysis of protein expression of p16 with RBP2 suppression and (B) RBP2 overexpression. (C) Expression of H3K4me2 and H3K4me3 expression in HCC cell lines with RBP2 knockdown.

(TIF)

Table S1

General characteristic of the patients.

(DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES