Age-related telomere uncapping is associated with cellular senescence and inflammation independent of telomere shortening in human arteries

Abstract

Arterial telomere dysfunction may contribute to chronic arterial inflammation by inducing cellular senescence and subsequent senescence-associated inflammation. Although telomere shortening has been associated with arterial aging in humans, age-related telomere uncapping has not been described in non-cultured human tissues and may have substantial prognostic value. In skeletal muscle feed arteries from 104 younger, middle-aged, and older adults, we assessed the potential role of age-related telomere uncapping in arterial inflammation. Telomere uncapping, measured by p-histone γ-H2A.X (ser139) localized to telomeres (chromatin immunoprecipitation; ChIP), and telomeric repeat binding factor 2 bound to telomeres (ChIP) was greater in arteries from older adults compared with those from younger adults. There was greater tumor suppressor protein p53 (P53)/cyclin-dependent kinase inhibitor 1A (P21)-induced senescence, measured by P53 bound to P21 gene promoter (ChIP), and greater expression of P21, interleukin 8, and monocyte chemotactic protein 1 mRNA (RT-PCR) in arteries from older adults compared with younger adults. Telomere uncapping was a highly influential covariate for the age-group difference in P53/P21-induced senescence. Despite progressive age-related telomere shortening in human arteries, mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence. Collectively, these findings demonstrate that advancing age is associated with greater telomere uncapping in arteries, which is linked to P53/P21-induced senescence independent of telomere shortening.

arterial telomere dysfunction may contribute to age-related arterial inflammation by inducing cellular senescence and subsequent senescence-associated inflammation. Telomeres are terminal sequences of TTAGGG repeats that make up the natural ends of chromosomes (16, 23). Telomeres and telomere binding proteins, like telomeric repeat binding factor 2 (TRF2), form specialized structures that protect chromosome ends from being recognized as dsDNA breaks and initiating a dsDNA break response (21, 48, 49), which could induce cellular senescence through tumor suppressor protein p53 (P53)-mediated upregulation of cyclin-dependent kinase inhibitor 1A (P21) (14, 49). Several in vitro studies in various human cell types have shown that replication-dependent breakdown of telomere structure, referred to as uncapping, can lead to P53 activation and P53/P21-induced senescence (14, 49). Following in vitro telomere uncapping in human cells, phosphorylation of histone γ-H2A.X at serine 139 [p-H2A.X (ser139)] occurs at telomeric chromatin to aid in initiation of the dsDNA break response (14, 49) and TRF2 binds to telomeres to prevent chromosome end fusions (11, 29). Additional in vitro studies have described P53-mediated senescence-associated inflammation in human cells, characterized by the accumulation of cytokines and chemokines like interleukin 6 (IL6), interleukin 8 (IL8), and monocyte chemotactic protein 1 (MCP1) (1, 13, 33, 40, 46). Consequently, senescence-associated inflammation has been implicated in aging and chronic disease (5, 24).

Many cardiovascular diseases (CVDs) are recognized as diseases of the arteries (18, 50) preceded by chronic low-grade arterial inflammation (7, 17). Telomere uncapping with advancing age might lead to P53/P21-induced senescence and subsequent inflammation in arteries. Although age-related telomere uncapping has not been assessed in noncultured human tissues, telomere shortening has been shown to occur over time in most human somatic tissues (23, 30, 47), including arteries (12, 41, 44). Telomere shortening could contribute to arterial telomere uncapping with advancing age along with other factors like genotoxic stress or dysregulation of telomere binding proteins (43, 47). Age-related dysregulation of the reverse transcriptase, telomerase (hTERT), could also contribute to arterial telomere uncapping by mediating telomere shortening (39). Elucidating the potential role that telomere uncapping plays in chronic arterial inflammation may lead to the identification of novel biomarkers that are predictive of CVDs, as well as lifestyle and pharmacological interventions that blunt or even reverse age-related arterial inflammation.

Thus an important unexplored hypothesis is that telomere uncapping occurs with advancing age in arteries and is associated with P53/P21-induced senescence and inflammation. To test this hypothesis, we measured p-H2A.X (ser139) localized to telomeres, TRF2 bound to telomeres, P53 bound to P21 gene promoter, P21, IL6, IL8, and MCP1 mRNA expression, mean telomere length, and active hTERT with advancing age in arteries from a large generalizable sample of human subjects.

MATERIALS AND METHODS

Human artery biopsy collection and general sample processing.

Arterial biopsies were excised from patients undergoing a prophylactic melanoma-associated sentinel lymph node biopsy to rule out melanoma metastasis, at the Huntsman Cancer Hospital, University of Utah. A heterogeneous sample (n) of 104 subjects (62 men and 42 women; aged 21–93 yr) consented to donate arterial biopsies for the study. A comprehensive outline of biometric, physiological, and medical characteristics for all subjects enrolled in the study was collected (Table 1). Subjects were grouped according to age at time of biopsy into younger adult (≤40 yr of age), middle-aged adult (41–60 yr of age), and older adult (≥61 yr of age) age groups. Although medical histories and prescription medication use were noted, there were no exclusions based on this information. Subject blood pressures were measured and recorded during physician consultations according to standard clinical blood pressure measurement guidelines (3). Subjects with high lactate dehydrogenase (LDH) blood values were excluded from the study, as blood LDH levels are considered a strong indicator of melanoma metastasis when outside the normal range (6, 45). Thus all subjects were within our institutionally specified normal blood LDH range of 313–618 U/l. No subjects included in this study had previously received chemotherapy, as this criterion was a contraindication for surgery. The Institutional Review Boards of the University of Utah and the Salt Lake City Veteran's Affairs Medical Center approved all protocols, and written informed consent was obtained from all subjects prior to biopsy collection.

Table 1.

Subject characteristics

Characteristic	Younger Adults (n = 25)	Middle-Aged Adults (n = 43)	Older Adults (n = 36)	P
Age a, yr	31.2 + 1.3	52.6 + 0.7	70.9 + 1.4	<0.001*
Sexb, M/F	13/12	26/17	23/13	0.641
BMI a, kg/m2	23.8 + 0.9	29.6 + 0.9	28.9 + 0.8	<0.001*
SBP a, mmHg	127.9 + 2.8	132.7 + 2.6	146.5 + 3.4	<0.001*
DBP a, mmHg	75.0 + 2.5	80.0 + 1.7	77.0 + 2.1	0.240
Medical history
Hypertensionb	0.0% (0)	32.6% (14)	55.6% (20)	<0.001*
CADb	0.0% (0)	4.7% (2)	11.1% (4)	0.172
PVDb	0.0% (0)	0.0% (0)	2.8% (1)	0.385
Prescription medications
Calcium channel blockersb	0.0% (0)	9.3% (4)	19.4% (7)	0.049*
Beta blockersb	0.0% (0)	9.3% (4)	11.1% (4)	0.243
ACE inhibitorsb	0.0% (0)	16.3% (7)	22.2% (8)	0.047*
Angiotensin blockersb	0.0% (0)	2.3% (1)	13.9% (5)	0.033*
Diureticsb	4.0% (1)	14.0% (6)	19.4% (7)	0.219

Data presented are

^ameans ± SE, ^bn, and ^b% (n) across age groups. BMI, body mass index;SBP, systolic blood pressure; DBP, diastolic blood pressure; CAD, coronary artery disease; PVD, peripheral vascular disease; ACE, angiotensin-converting-enzyme.

^*Significant difference.

The arterial biopsies consisted of skeletal muscle feed arteries excised from the inguinal (e.g., hip adductors or quadriceps femoris) or axillary regions (e.g., serratus anterior or latissimus dorsi) and were free of melanoma cells (26). Arterial biopsies were identified as skeletal muscle feed arteries by entry into muscle bed, gross anatomy, coloration, and pulsatile bleed pattern (26). There were no differences in our outcomes between arteries from inguinal and axillary regions (all P ≥ 0.14), and no interactions were found between biopsy source and age group in any outcomes (all P ≥ 0.13). Arterial biopsies were cleaned of adipose and connective tissue, and washed to remove residual blood cells. The average size of each artery was 2 mm in length, ∼0.5 mm in luminal diameter, and approximately 10–20 mg in mass. Cleaned arteries were then snap frozen in liquid nitrogen and stored at −80°C prior to performing the following outcomes. All samples were assayed in triplicate, and replicate means were used for analysis.

Telomere uncapping.

ChIP was used to determine the amount of p-H2A.X (ser139) (Santa Cruz Biotechnology) localized to telomeres and TRF2 (Abcam) bound to telomeres. ChIPs were performed as described by Dahl and Collas (15) and analyzed via qPCR for telomere content as described by Cawthon (10). Final values were expressed as the ratio of background corrected starting quantity (SQ) of telomeric DNA enriched by ChIP to telomeric DNA SQ in INPUT fraction. INPUTs represented 50% of telomeric DNA present in corresponding ChIP and were used to control for tissue concentration in samples {e.g., [p-H2A.X (ser139) SQ − background SQ]/INPUT SQ = final value}.

P53/P21-induced senescence.

ChIPs were performed to assess P53 bound to P21 gene promoter (EMD Millipore) as described above (15), using a sequence-independent qPCR assay with FastStart SYBR Green Master (Roche Diagnostics, Roche Applied Science). Additionally, P21 mRNA expression was determined by qRT-PCR using the Quantitect Reverse Transcription kit (Qiagen) and FastStart SYBR Green Master (Roche Diagnostics, Roche Applied Science) according to the manufacturer's protocols. Final mRNA SQs were generated by standard curve and expressed as a ratio of target mRNA SQ to 18s rRNA SQ (18s rRNA QuantiTect Primer Assay: Qiagen). 18s rRNA was used as a housekeeping gene transcript to control for tissue concentration in samples (e.g., P21 mRNA SQ/18s SQ = final value). P21 mRNA primers were gacctgtcactgtcttgta (forward) and cctcttggagaagatcagccg (reverse).

Senescence-associated inflammation.

IL6, IL8, and MCP1 mRNA expression was determined by qRT-PCR as described above. IL6 mRNA primers were tacccccaggagaagattcc (forward) and gccatctttggaaggttcag (reverse). IL8 mRNA primers were aggtgcagttttgccaagga (forward) and tttctgtgttggcgcagtgt (reverse). MCP1 mRNA primers were tcgctcagccagatgcaatcaatg (forward) and tggaatcctgaacccacttctgct (reverse).

Mean telomere length.

A sequence-independent multiplex qPCR technique using a SYBR Green master mix with 0.625U AmpliTaq Gold 360 DNA polymerase (Life Technologies) was utilized to determine mean telomere length as described by Cawthon (10). Telomeric DNA (T) SQs and albumin SQs, used as single-copy gene (S) to control tissue concentration in samples, were generated by standard curve and mean telomere length was expressed as the T/S ratio. Mean telomere lengths, telomere ranges, and telomere shortening rates were generated by converting T/S ratios to base pairs (bp) of DNA using the formula: bp = 3,330(T/S) + 3,730, derived by Cawthon (10).

Active hTERT.

ChIPs were performed to assess hTERT (Abcam) bound to telomeres as described above (15). This technique allows for a sensitive and quantitative assessment of hTERT bound to telomeres versus simple protein expression or enzyme activity assays, which we believe gives us the most accurate representation of active hTERT in vivo.

Data analysis.

Primary outcomes included p-H2A.X (ser139) localized to telomeres, TRF2 bound to telomeres, P53 bound to P21 gene promoter, mean telomere length, and active hTERT. Secondary outcomes included P21, IL6, IL8, and MCP1 mRNA expression. ANOVA tests were performed with least significance difference (LSD) post hoc tests to assess all age-group and tertile differences in all primary outcomes. Independent-samples t-tests were performed to assess age-group differences in all secondary outcomes. The Pearson correlation coefficient (r) was used to assess correlations between each outcome and between all outcomes and subject characteristics. To assess age-group differences in subject characteristics, ANOVA tests with LSD post hoc tests or Chi-squared tests were performed. Analysis of covariance tests with LSD post hoc tests were performed in all outcomes that correlated with continuous-variable subject characteristics to determine the influence of covariates on the age-group differences in our outcomes. All covariates were tested for homogeneity across age groups in all outcomes, and covariate effect size was assessed using partial eta squared (η_p²). Factorial ANOVA tests were performed to assess interactions between the effects of age-group and age-related disease or prescription medication use status in all outcomes. Independent-samples t-tests or Chi-squared tests were performed to assess age-group differences in subgroup analyses of subject characteristics and all outcomes. Data are presented as means ± SE normalized to younger adult age group, means ± SE, or %(n). Significance was set at P < 0.05.

RESULTS

Arterial telomere uncapping.

Telomere uncapping was greater with advancing age in human arteries. p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres were approximately twofold greater in arteries from older adults compared with younger adults (all P ≤ 0.03; Fig. 1). p-H2A.X (ser139) localized to telomeres displayed a strong positive correlation with TRF2 bound to telomeres (r = 0.67, P < 0.001).

Fig. 1.

Arterial telomere uncapping and P53/P21-induced senescence. A: p-H2A.X (ser139) localized to telomeres. B: TRF2 bound to telomeres. C: P53 bound to P21 gene promoter across age groups (all *P ≤ 0.03). Terms: p-H2A.X (ser139), p-histone γ-H2A.X (ser139); TRF2, telomeric repeat binding factor 2; P53, tumor suppressor protein p53; P21-cyclin-dependent kinase inhibitor 1A.

Arterial P53/P21-induced senescence and senescence-associated inflammation.

Consistent with greater telomere uncapping, P53/P21-induced senescence and senescence-associated inflammation were greater with advancing age in human arteries. There was almost threefold more P53 bound to P21 gene promoter in arteries from older adults compared with younger adults (P = 0.03; Fig. 1). Accordingly, there was almost twofold greater expression of P21 mRNA in arteries from older adults compared with younger adults (P = 0.02; Table 2). There was also nearly twofold higher IL6 (P = 0.09), nearly eightfold greater IL8 (P = 0.01), and twofold greater MCP1 mRNA (P = 0.03) expression in arteries from older adults compared with younger adults (Table 2).

Table 2.

Arterial P53/P21-induced senescence and senescence-associated inflammation

Target mRNA	Fold Δ in Expression (Older/Younger)	P
P53/P21-induced senescence
P21	1.9 + 0.3	0.02*
Senescence-associated inflammation
IL6	1.7 + 0.3	0.09
IL8	7.5 + 2.1	0.01*
MCP1	2.1 + 0.3	0.03*

Data presented are fold change in means ± SE target mRNA expression in older adults compared with younger adults. P53, tumor suppressor protein p53; P21, cyclin-dependent kinase inhibitor 1A; IL6, interleukin 6; IL8, interleukin 8; MCP1, monocyte chemotactic protein 1.

^*Significant difference.

Influence of telomere uncapping on P53/P21-induced senescence.

p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres demonstrated a positive correlation with P53 bound to P21 gene promoter (r = 0.48 and r = 0.60, respectively, all P < 0.001). Likewise, there was over threefold greater P53 bound to P21 gene promoter among subjects in the highest tertiles of p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres compared with those in the median and lowest tertiles (all P ≤ 0.04; Fig. 2). Analysis of covariance results indicated that p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres had large effects on the P53 bound to P21 gene promoter age-group difference (η_p² = 0.20 and 0.33, respectively), accounting for 53% of the total age-related variance in this P53/P21-induced senescence marker. Controlling for the influence of p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres, the adjusted age-group difference in P53 bound to P21 gene promoter was no longer significant (older adults compared with younger adults; Δ: P = 0.03 to P = 0.13 and 0.492, respectively).

Fig. 2.

Influence of telomere uncapping on P53/P21-induced senescence. P53 bound to P21 gene promoter across tertiles of telomere uncapping markers, including p-H2A.X (ser139) localized to telomeres (A) and TRF2 bound to telomeres (B) (all *P < 0.001 compared with lowest tertile; all †P ≤ 0.04 compared with median tertile).

Arterial telomere shortening.

Progressive telomere shortening occurred with advancing age in human arteries, with mean telomere lengths of 13.4 ± 0.5 kb in younger adults, 11.5 ± 0.2 kb in middle-aged adults, and 10.5 ± 0.3 kb in older adults (all P < 0.001 compared with younger adults; P = 0.03 for older adults compared with middle-aged adults; Fig. 3). There was a 61 bp/yr rate of shortening, estimated by the linear equation: y = 61.2x + 14,900.7 (R² = 0.22, r = −0.47, P < 0.001; Fig. 3). Mean telomere length was not correlated with p-H2A.X (ser139) localized to telomeres (r = −0.09, P = 0.20), TRF2 bound to telomeres (r = −0.15, P = 0.09), or P53 bound to P21 gene promoter (r = −0.16, P = 0.08). Additionally, there were no differences in these markers of telomere uncapping and P53/P21-induced senescence between subjects in the shortest (8.2–10.8 kb), median (10.9–12.5 kb), and longest (12.6–17.2 kb) tertiles of mean telomere length (all P ≥ 0.20; Fig. 4). There was no difference in active hTERT between age groups in human arteries (all P ≥ 0.82; Fig. 3).

Fig. 3.

Arterial telomere shortening. A: mean telomere length across age groups (all *P < 0.001 compared with younger adults; †P = 0.03 for older adults compared with middle-aged adults). B: correlation between mean telomere length and age. C: active hTERT across age groups. hTERT, telomerase reverse transcriptase.

Fig. 4.

Influence of mean telomere length on telomere uncapping and P53/P21-induced senescence. p-H2A.X (ser139) localized to telomeres (A), TRF2 bound to telomeres (B), and P53 bound to P21 gene promoter across tertiles of mean telomere length (C).

Influence of CVD risk factors and prescription medication use.

We observed greater systolic blood pressure (SBP), body mass index (BMI), hypertension incidence and prescription blood pressure medication use with advancing age in our subjects (Table 1). P53 bound to P21 gene promoter was positively correlated with SBP (r = 0.20, P = 0.04), and analysis of covariance results indicated that SBP was an influential covariate for the age-group difference in this P53/P21-induced senescence marker (older adults compared with younger adults; Δ P = 0.03 to 0.12, η_p² = 0.02). BMI was negatively correlated with mean telomere length (r = −0.20, P = 0.03) but was not an influential covariate for the age-group differences in this primary outcome (all P remained ≤ 0.02, η_p² < 0.01). Likewise, DBP was positively correlated with MCP1 mRNA expression (r = 0.29, P = 0.01), but was not an influential covariate for the age-group difference in this marker of senescence-associated inflammation (P remained = 0.05, η_p² = 0.09). No interactions between the effects of age group and age-related disease or prescription medication use status were found using a factorial ANOVA to compare means for all outcomes (all P ≥ 0.06).

To further assess the influence of prescription medication use on the age-group differences we observed, we identified and removed all subjects using potentially confounding prescription medications and repeated analyses for all outcomes in this subgroup of unmedicated subjects (unmedicated subject characteristics; Table 3). Arteries from unmedicated older adults had greater p-H2A.X (ser139) localized to telomeres, TRF2 bound to telomeres, P53 bound to P21 gene promoter, and P21, IL8, and MCP1 mRNA expression compared with younger adults (all P < 0.05). Arteries from unmedicated older adults also had shorter mean telomere length compared with younger adults (P < 0.01), and there was no age-group difference in active hTERT (P = 0.44). SBP was positively correlated with P53 bound to the P21 gene promoter in unmedicated subjects (r = 0.35, P = 0.03) and remained an influential covariate for the age-group difference in this marker of P53/P21 senescence (older adults compared with younger adults; Δ P = 0.04 to P = 0.34, η_p² = 0.05).

Table 3.

Unmedicated subject characteristics

Characteristic	Younger Adults (n = 25)	Older Adults (n = 15)	P
Agea, yr	31.2 + 1.3	68.2 + 1.8	< 0.001*
Sex b, M/F	13/12	12/3	0.077
BMI a, kg/m2	23.8 + 0.9	28.0 + 1.2	0.004*
SBP a, mmHg	127.9 + 2.8	142.5 + 4.7	0.004*
DBP a, mmHg	75.0 + 2.5	79.5 + 3.4	0.143

Data presented are

^ameans ± SE and ^bn across age groups.

^*Significant difference.

DISCUSSION

The key novel findings of the present study are as follows. Telomere uncapping was greater in arteries from older adults compared with those from younger adults. There was greater P53/P21-induced senescence in arteries from older adults compared with younger adults. Telomere uncapping was a highly influential covariate for the age-group difference in P53/P21-induced senescence. Despite progressive age-related telomere shortening in human arteries, mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence. There was also no difference in active hTERT with advancing age in human arteries. Collectively, these findings demonstrate that advancing age is associated with greater telomere uncapping in arteries, which is linked to P53/P21-induced senescence independent of telomere shortening.

Arterial telomere uncapping.

Age-related telomere uncapping could lead to P53/P21-induced senescence and ensuing inflammation in arteries. In vitro studies in human cells have shown that replication-dependent telomere uncapping can lead to a dsDNA break response at telomeres (21, 48, 49) and ultimately P53/P21-induced senescence (14, 49). While greater telomere uncapping has been reported in CD19⁺ B cells from radiation-resistant chronic lymphocytic leukemia patients compared with radiation-sensitive patients (9), to our knowledge, no studies have measured telomere uncapping with advancing age in noncultured human tissues. We reported greater telomere uncapping, as determined by p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres, in arteries from older adults compared with those from younger adults. These results establish that greater telomere uncapping is associated with advancing age in arteries, which represents a plausible precursor to P53/P21-induced senescence and senescence-associated inflammation.

In support of evidence that TRF2 binds to uncapped telomeres to prevent chromosome end fusions (11, 29), TRF2 has also been shown to localize to nontelomeric dsDNA break sites and participate in the dsDNA break response in human cells (8). However, TRF2 has other well-established functions that are essential for normal telomere structure and stability (21, 48). Thus greater TRF2 bound to telomeres in arteries with advancing age might also be a compensatory response to telomere shortening to maintain telomere structure and stability. Nonetheless, we found a strong positive correlation between p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres, which reinforces in vitro evidence that TRF2 binds to uncapped telomeres (11, 29).

Arterial P53/P21-induced senescence and senescence-associated inflammation.

Age-related P53/P21-induced senescence and ensuing inflammation may contribute to the chronic inflammation in arteries that precedes many CVDs. In human cells, activated P53 binds to the P21 gene promoter region, resulting in P21 upregulation and subsequent inhibition of cell cycle progression (14, 49). Several in vitro studies in human cells have also shown that P53/P21-induced senescence results in increased expression of IL6, IL8, and MCP1 (1, 13, 33, 40, 46). Importantly, there is evidence that arterial P53/P21-induced senescence may play a role in carotid artery disease (38), chronic obstructive pulmonary disease (40), as well as popliteal artery aneurysm (28). Marchand et al. (37) reported greater P21 mRNA expression in arteries from older coronary artery bypass graft patients compared with middle-aged patients, but it was unknown whether age-related P53/P21-induced senescence occurs in arteries from subjects that are more generalizable. We observed greater P53 bound to P21 gene promoter and greater P21 mRNA expression in normal arteries from older adults compared with those taken from younger adults. Likewise, we found higher IL8 and MCP1 mRNA expression in arteries from older adults compared with those from younger adults. These findings demonstrate that P53/P21-induced senescence and senescence-associated inflammation occur with advancing age in human arteries.

Influence of telomere uncapping on P53/P21-induced senescence.

If age-related telomere uncapping results in P53/P21-induced senescence in arteries, there should be a close connection between these outcomes. Both p-H2A.X (ser139) localized to telomeres and TRF2 bound to telomeres demonstrated positive correlations with P53 bound to P21 gene promoter, and were highly influential covariates for the age-group difference in this P53/P21-induced senescence marker. Combined, these two markers of telomere uncapping accounted for more than half of the variance in the P53 bound to P21 gene promoter age-group difference. These results suggest that age-related telomere uncapping is a biologically relevant link to P53/P21-induced senescence in arteries.

Arterial telomere shortening.

Age-related telomere shortening is a potential mechanism by which telomere uncapping, P53/P21-induced senescence, and subsequent inflammation occur in arteries. Telomere shortening with advancing age has been documented in most human somatic tissues (12, 23, 30, 47), and numerous in vitro studies in human cells have linked telomere shortening and senescence (4, 23, 47). Arterial telomere shortening has been associated with both advancing age and atherosclerotic plaque development in studies with modestly sized subject samples (n = 27–51), using tissue taken from cadavers (12, 41, 44). We showed progressive telomere shortening with advancing age in a large sample of human arteries obtained from living donors, which extends previous findings. We also found that mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence. Arterial telomere uncapping caused by the accumulation of genotoxic insults with advancing age might explain these lack of associations (43, 47). These observations cast doubt on the biological relevance of telomere shortening as a mechanism underlying age-related telomere uncapping, P53/P21-induced senescence, and senescence-associated inflammation in arteries.

Telomere length homeostasis is maintained by hTERT activity (39), primarily in germ cells, white blood cells (WBCs), and adult stem cell compartments (25, 27, 34). While a link between age and hTERT activity has not previously been tested in human arteries, a few studies have shown age-related declines in hTERT activity in human WBCs (27, 42). Interestingly, Liu et al. (35) found greater hTERT expression and activity in atherosclerotic arteries compared with nonatherosclerotic controls, and a recent study by Kroenke et al. (31) has associated increased WBC hTERT activity with greater CVD risk. We reported no difference in active hTERT with advancing age in human arteries. Thus hTERT activity may be insufficient to prevent age-related telomere shortening in human arteries. However, a growing body of work suggests that hTERT may have important nontelomeric activities related to mitochondrial function and oxidative stress in human cells (2, 22, 32). As mitochondria-derived reactive oxygen species are well-established mediators of chronic disease (36, 51), this new area of inquiry may reveal a role for arterial hTERT activity in CVDs related to mitochondrial dysregulation.

Influence of CVD risk factors and prescription medication use.

We noted higher levels of CVD risk factors like SBP and BMI, as well as greater incidence of hypertension and prescription blood pressure medication use, with advancing age in our subjects. These trends are similar to those observed in other human studies assessing arterial aging in large generalizable subject samples (18–20), but could have influence on the age-group differences reported in our outcomes. With the exception of SBP, no subject characteristics influenced any outcomes, nor were there interactions between the effects of age-group and age-related disease or prescription medication use status in any outcomes. Controlling for the influence of SBP did affect the age-group difference in P53 bound to P21 gene promoter, which indicates a potentially interesting link between these measures. These analyses account for the impact of CVD risk factors and prescription medication use on age-related telomere uncapping and P53/P21-induced senescence.

To completely rule out any effect of prescription medication use on the age-group differences we observed, we performed analyses for all outcomes with only unmedicated subjects. The influence of age on telomere uncapping, P53/P21-induced senescence, senescence-associated inflammation, mean telomere length, and active hTERT in human arteries was not affected by prescription medication use. These results provide support for the age-group differences found in the larger more generalizable subject sample.

Conclusions.

The goal of this study was to assess the potential role of telomere uncapping in chronic arterial inflammation. Our findings reveal that telomere uncapping occurs with advancing age in arteries, which is linked to P53/P21-induced senescence independent of telomere shortening. These studies lay the clinical foundation for future studies aimed at establishing the causal role of telomere uncapping in age-related arterial inflammation and subsequent CVD.

GRANTS

Awards from the National Institute on Aging (AG-040297, AG-029337, AG-033196, AG-033755), the National Heart, Lung, and Blood Institute (HL-09183), Department of Veterans Affairs Merit Grant E6910R, and a University of Utah Center on Aging Grant financially supported this work.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: R.G.M. and A.J.D. conception and design of research; R.G.M., S.J.I., L.A.L., R.M.C., R.H.A., R.D.N., R.S.R., and A.J.D. performed experiments; R.G.M., S.J.I., L.A.L., R.M.C., R.H.A., R.D.N., R.S.R., and A.J.D. analyzed data; R.G.M. and A.J.D. interpreted results of experiments; R.G.M. and A.J.D. prepared figures; R.G.M. and A.J.D. drafted manuscript; R.G.M., S.J.I., L.A.L., R.M.C., R.H.A., R.D.N., R.S.R., and A.J.D. edited and revised manuscript; R.G.M., R.S.R., and A.J.D. approved final version of manuscript.